Vítězslav Bryja, 2014    Attachments 
 
 
#1 
 
 
Schulte1 
G, Bryja V1
, Rawal N, Castelo‐Branco G, Sousa KM, Arenas E (2005): Purified HA‐
Wnt5a increases differentiation of dopaminergic precursor cells. J. Neurochem 92:1550‐3. 
1
 equal contribution 
 
 
 
Impact factor (2005): 4.500 
Times cited (without autocitations, WoS, Feb 21st 2014): 44 
Significance: Description of the first purification of the Wnt ligand, which can activate 
non‐canonical Wnt signaling. This step allowed biochemical analysis of Dishevelled 
in the beta‐catenin‐independent pathways. 
Contibution  of  the  author/author´s  team:  Purification  of  Wnt5a  (preparation  of 
conditioned  media,  chromatography)  and  functional  validation  in  dopaminergic 
cells 
 
 
   
 
 
 
RAPID
COMMUNICATION
Purified Wnt-5a increases differentiation of midbrain
dopaminergic cells and dishevelled phosphorylation
Gunnar Schulte,1
Vı´teˇzslav Bryja,1
Nina Rawal, Goncalo Castelo-Branco,
Kyle M. Sousa and Ernest Arenas
Laboratory of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics,
Karolinska Institutet, Stockholm, Sweden
Abstract
The Wnt family of lipoproteins regulates several aspects of the
development of the nervous system. Recently, we reported that
Wnt-3a enhances the proliferation of midbrain dopaminergic precursors
and that Wnt-5a promotes their differentiation into dopaminergic
neurones. Here we report the purification of
hemagglutinin-tagged Wnt-5a using a three-step purification
method similar to that previously described for Wnt-3a. Haemagglutinin-tagged
Wnt-5a was biologically active and induced the
differentiation of immature primary midbrain precursors into tyrosine
hydroxylase-positive dopaminergic neurones. Using a
substantia nigra-derived dopaminergic cell line (SN4741), we
found that Wnt-5a, unlike Wnt-3a, did not promote b-catenin
phosphorylation or stabilization. However, both Wnt-5a and Wnt-
3a activated dishevelled, as assessed by a phosphorylationdependent
mobility shift. Moreover, the activity of Wnt-5a on
dishevelled was blocked by pre-treatment with acyl protein thioesterase-1,
indicating that palmitoylation of Wnt-5a is necessary
for its function. Thus, our results suggest that Wnt-3a and Wnt-5a,
respectively, activate canonical and non-canonical Wnt signalling
pathways in ventral midbrain dopaminergic cells. Furthermore, we
identify dishevelled as a key player in transducing both Wnt
canonical and non-canonical signals in dopaminergic cells.
Keywords: b-catenin, dopaminergic neurones, proliferation,
SN4741, Wnt-3a, Wnt signalling.
J. Neurochem. (2005) 92, 1550–1553.
Wnts are secreted, lipid-anchored proteins (Nusse 2003) that bind and
activate the Frizzled receptor family (Malbon 2004). Palmitoylation of
Wnts renders these proteins highly lipophilic (Willert et al. 2003), a fact
which has hampered purification of biologically active Wnts for a long
time. Recently, however, Willert et al. (2003) published a purification
procedure for active Wnt-3a, a method that is applicable to the
purification of other members of the Wnt family.
Wnt signalling via Frizzled receptors involves several different
important players, including the phosphoprotein dishevelled (Dvl), axin,
glycogen synthase kinase 3, b-catenin and heterotrimeric and monomeric
G proteins and others (Nelson and Nusse 2004). Glycogen synthase
kinase 3 constitutively phosphorylates b-catenin, targeting it for proteasome-dependent
degradation. Activation of canonical Wnt signalling
inhibits glycogen synthase kinase 3 and consequently leads to decreased
b-catenin phosphorylation and accumulation of transcriptionally active
b-catenin. Non-canonical Wnt signalling pathways include the calcium
pathway, involving heterotrimeric G proteins, small GTPases, calcineurin
and nuclear factor activated in T-cells (NFAT; Huelsken and Behrens
2002; Wang and Malbon 2004). In addition, non-canonical signalling via
the planar cell polarity pathway involves Rho, Rock and JNK (Huelsken
and Behrens 2002). However, according to recent studies, Dvl appears to
be the element common to all of these pathways as it is activated by
Frizzleds irrespective of the signalling pathway (Huelsken and Behrens
2002; Chen et al. 2003; Gonza´lez-Sancho et al. 2004).
Although Wnt-1 and Wnt-3a primarily stimulate canonical signalling
and Wnt-5a stimulates non-canonical pathways, the specific pharmacological
profiles of Wnt binding to its cognate Frizzled receptors remain
unknown (Hsieh 2004). In addition to Frizzleds, Wnts have been shown to
bind to the low-density lipoprotein-related protein 5 and 6 coreceptor,
apparently only necessary for canonical signalling (Gonza´lez-Sancho
et al. 2004).
The development of dopaminergic neurones in the ventral midbrain
requires a complex programme of epigenetic and genetic signals in order
to acquire a mature neuronal phenotype (Riddle and Pollock 2003). We
have previously shown that the Wnt family plays an important role in the
regulation of midbrain dopaminergic development. While Wnt-3a
increased the proliferation of precursor cells, Wnt-5a increased the
maturation of dopaminergic precursors into dopaminergic neurones
(Castelo-Branco et al. 2003).
Here we describe the purification of hemagglutinin (HA)-tagged Wnt-
5a and its effects on the differentiation of E14.5 rat ventral midbrain
dopaminergic precursor cells. We report that Wnt-5a activates Dvl in the
substantia nigra-derived cell line SN4741 (Son et al. 1999). Furthermore,
we show that post-translational lipid modification of Wnt-5a is
necessary for its activity.
Materials and methods
Materials
The chromatography columns, polyvinylidene difluoride membrane and
enhanced chemiluminescence system (ECLplus) were from Amersham
Received November 10, 2004; revised manuscript received December 1, 2004;
accepted December 2, 2004.
Address correspondence and reprint requests to Ernest Arenas, Laboratory of
Molecular Neurobiology, Department of Medical Biochemistry and Biophysics,
Karolinska Institutet, S-171 77 Stockholm, Sweden.
E-mail: ernest.arenas@mbb.ki.se
1
These authors contributed equally to this article.
Abbreviations used: Dvl, dishevelled; HA, haemagglutinin; PBS, phosphatebuffered
saline.
Journal of Neurochemistry, 2005, 92, 1550–1553 doi:10.1111/j.1471-4159.2004.03022.x
1550 Ó 2005 International Society for Neurochemistry, J. Neurochem. (2005) 92, 1550–1553
Biosciences (Uppsala, Sweden). CHAPS was from Amresco (Solon,
OH, USA). N-glycosidase F was from Roche (Mannheim, Germany).
Cell culture media and foetal calf serum were from Invitrogen (Carlsbad,
CA, USA). Recombinant Wnt-3a was purchased from R & D Systems
(Minneapolis, MN, USA) and Wnt-5a was a gift from R & D Systems.
Primary antibodies were: mouse anti-HA (Covance Princeton, NJ, USA);
mouse anti-Wnt-5a (R & D Systems); mouse anti-Dvl3 (Santa Cruz
Biotechnology, Santa Cruz, CA, USA); mouse anti-(Ser37/Thr41
dephospho) active b-catenin (Upstate Biotechnology, Lake Placid, NY,
USA); mouse anti-b-catenin (BD Biosciences, San Jose, CA, USA) and
rabbit anti-Ser33/37/Thr41 phospho-b-catenin (Cell Signaling Technology,
Beverly, MA, USA). APT-1 was kindly provided by Dr A. Gilman
(University of Texas, Dallas, TX, USA).
Purification of haemagglutinin-tagged Wnt-5a
Purification of C-terminally-tagged HA-Wnt-5a was performed according
to Willert et al. (2003) with minor changes. Briefly, 4 L of
conditioned medium from HA-Wnt-5a expressing rat B1a fibroblasts
(Shimizu et al. 1997) were harvested and filtered (0.45 lm filter). Before
Blue Sepharose affinity chromatography (Blue Sepharose 6 Fast Flow),
1% CHAPS was added and the medium was filtered again (0.2 lm
filter). The Blue Sepharose column was equilibrated with 20 mM Tris,
150 mM KCl, 1% CHAPS, pH 7.5 (Buffer A), loaded with the HA-Wnt-
5a-containing medium and washed extensively in Buffer A. Fractions
eluted with high salt buffer (20 mM Tris, 1.5 M KCl, 1% CHAPS,
pH 7.5) were analysed by immunoblotting for the presence of HA tag
(mouse anti-HA) and Wnt-5a protein (anti-Wnt-5a). HA-Wnt-5a-positive
fractions were pooled and concentrated in Centricon Plus-80 filters
(Millipore Corporation, Bedford, MA, USA) for loading onto a HiLoad
26/60 Superdex 200 gel filtration column using phosphate-buffered
saline (PBS), 1% CHAPS, pH 7.5. Eluted fractions were analysed for the
presence of HA-Wnt-5a by immunoblotting and further purified with a
HiTrap Heparin HP column using PBS, 1% CHAPS, pH 7.5 as loading
buffer and PBS, 1 M NaCl, 1% CHAPS, pH 7.5 as elution buffer. The
presence of HA-Wnt-5a was confirmed by immunoblotting for HA tag
and Wnt-5a protein. Deglycosylation of HA-Wnt-5a was performed in
PBS, 1 M NaCl, 1% CHAPS using 3 U N-glycosidase F at 37°C for
90 min. Removal of lipid modification was performed by pre-treatment
with APT-1 at 30°C overnight [reaction mix: 100 ng Wnt, 1 lg bovine
serum albumin, 19 ng APT-1 in total 15 lL PBS, 1% CHAPS].
Primary cell culture and culture of SN4741 cells
Rat ventral midbrain E14.5 precursor cultures were prepared as described
previously (Castelo-Branco et al. 2003). Experiments were performed
with the approval of the ethical committee (Stockholms Norra
Djurfo¨rso¨ksetiska Na¨mnd). Cells were treated with HA-Wnt-5a
(100 ng/mL) for 3 days in vitro before fixation. The biological effects
of HA-Wnt-5a on precursor cultures were quantified in three independent
experiments performed in duplicate and analysed by one-sample
Student’s t-test. Data were normalized by setting the control-stimulated
values to 100% while experimental values were compared with
normalized values and found to be significantly different.
SN4741 cells were generously provided by Dr J.H. Son (Son et al.
1999) and grown in Dulbecco’s modified Eagle’s medium, 10% foetal
calf serum, L-glutamine (2 mM), penicillin (50 U/mL), streptomycin
(50 U/mL), glucose (0.6%). For analysis of intracellular signalling,
100 000 cells/well were seeded in 12-well plates, grown overnight in the
absence of serum and stimulated for 2 h in the same medium according
to the figure legends. Control stimulations were performed with
equivalent volumes of PBS, 1 M NaCl, 1% CHAPS, hereafter referred
to as control stimulation. Cells were washed twice in PBS and lysed by
addition of 200 lL of 1% sodium dodecyl sulphate, 10% glycerol and
0.1 M Tris-Cl (pH 7.4).
Gel electrophoresis and immunoblotting
Fractions of the HA-Wnt-5a purification and SN4741 cell lysates
denatured with Laemmli buffer were analysed by sodium dodecyl
sulphate–polyacrylamide gel electrophoresis. Silver staining was performed
according to the Blum silver staining protocol. For immunoblotting,
proteins were transferred to polyvinylidene difluoride
membranes (Immobilon P). Detection of proteins was performed with
the following primary antibodies: anti-HA; anti-Wnt-5a; anti-Dvl3,
active b-catenin; b-catenin, phospho-b-catenin and appropriate horseradish
peroxidase-conjugated secondary antibodies. Signals were detected
with the ECLplus system.
Results and Discussion
We have previously reported that partially purified conditioned medium
from HA-Wnt-5a-expressing fibroblasts promotes the differentiation of
dopaminergic precursors into tyrosine hydroxylase-positive neurones
(Castelo-Branco et al. 2003). To ascertain the effects of pure Wnt-5a and
investigate the mechanism by which Wnt-5a promotes the differentiation
of ventral midbrain precursors into dopaminergic neurones, we set out to
purify HA-Wnt-5a. The purification protocol was adapted from the
recently published report by the group of Roel Nusse (Willert et al.
2003), with minor modifications. Subsequent analysis of HA-Wnt-5aconditioned
media and the fractions collected after each purification step
revealed an increasing concentration and purity of HA-Wnt-5a (final
concentration $10 lg/mL), as detected by immunoblotting with anti-HA
tag and anti-Wnt-5a antibodies (Fig. 1a). MALDI-TOF analysis of an in
gel trypsin-digested sample from a Coomassie-stained gel containing the
HA-positive bands confirmed the identity of Wnt-5a (data not shown).
Post-heparin fractions only contained minor trace contaminants. HAWnt-5a
migrated in 10% sodium dodecyl sulphate–polyacrylamide gel
electrophoresis at a size of $48 kDa. This slow migration was probably
attributable to heavy glycosylation as shedding of the glycosylation with
N-glycosidase F resulted in a shift in mobility to $40 kDa, reflecting the
expected molecular weight of the HA-tagged Wnt-5a (Fig. 1b). The
concentration of the final HA-Wnt-5a fractions eluted from the heparin
column was determined by comparing the immunoblot signal obtained
from anti-Wnt-5a antibody staining with dilution series of mouse nontagged
Wnt-5a. The three-step purification process resulted in an HAWnt-5a
fraction that was tested for biological activity. Treatment of rat
ventral midbrain E14.5 precursor cultures for 3 days with either control
buffer (elution buffer from the heparin column; PBS, 1 M NaCl, 1%
CHAPS) or the final HA-Wnt-5a fraction increased the number of
tyrosine hydroxylase-positive cells by about 2.8-fold compared with
control treated cells (Fig. 1d). Thus, our results confirm that the effects
of partially purified conditioned media from HA-Wnt-5a-expressing
fibroblasts (Castelo-Branco et al. 2003) are indeed due to the presence of
biologically active HA-Wnt-5a. These results are in agreement with
those obtained by others (Shimizu et al. 1997; Jo¨nsson and Andersson
2001; Mericskay et al. 2004), indicating that HA-Wnt-5a is biologically
active in different applications and assays.
We next decided to investigate the intracellular signalling pathways
activated by HA-Wnt-5a in dopaminergic neurones. For this purpose we
utilized the SN4741 immortalized cell line that is derived from an E13.5
mouse tyrosine hydroxylase-positive substantia nigra dopaminergic
neurone (Son et al. 1999). This cell line is a suitable model for the
investigation of biochemical changes induced by Wnts in immature
dopaminergic cells as it expresses both lipoprotein-related protein 5/6
Wnt-5a effects on dopaminergic precursors 1551
Ó 2005 International Society for Neurochemistry, J. Neurochem. (2005) 92, 1550–1553
and several of the frizzled receptors (Fz 1, 2 and 4–9), as assessed by
RT-PCR (unpublished results). To investigate intracellular signalling
upon Wnt stimulation, we examined the stabilization of b-catenin as well
as the phosphorylation and dephosphorylation status of b-catenin using a
pan-b-catenin, a phospho-specific b-catenin and the dephospho active
b-catenin antibodies, respectively. Wnt-3a treatment, which is known to
activate canonical signalling (Willert et al. 2003), led to a strong
dephosphorylation of b-catenin and a slight increase in total b-catenin
levels in the SN4741 dopaminergic cell line. In contrast, treatment with
Wnt-5a did not modify the levels of b-catenin or its phosphorylation
state (Fig. 2a). Compared with b-catenin dephosphorylation, the phospho-specific
b-catenin antibody revealed an inverted pattern, showing a
decrease in labelling upon Wnt-3a stimulation, while Wnt-5a treatment
did not affect b-catenin phosphorylation. Wnt-5a treatment did not affect
the basal expression and basal phosphorylation pattern of b-catenin
(Fig. 2a). Thus, in our system, unlike in the report of Topol et al. (2003),
Wnt-5a cannot block canonical signalling.
Recent studies show that Dvl becomes hyperphosphorylated
upon activation of either the canonical or non-canonical pathway
(a) (b)
(c)
(d)
HA-Wnt-5a
160 kDa
105 kDa
75 kDa
50 kDa
35 kDa
- +
N-glycosidase F
HA-Wnt-5a
TH / Hoechst
conditionedmedium
Bluesepharose
Heparin
Superdex
anti-HA
anti-Wnt-5a
silver stain
control
Fig. 1 Purification of hemagglutinin (HA)-tagged Wnt-5a and its effects on
maturation of dopaminergic cells. (a) Summary of the three purification
steps of HA-Wnt-5a. Immunoblots show the presence of HA-Wnt-5a in the
fractions collected after each step. Purification was monitored by either
anti-HA antibody, anti-Wnt-5a antibody or silver stain (a). HA-Wnt-5a
migrated at a molecular weight of $48 kDa. Deglycosylation with N-glycosidase
F resulted in a mobility shift giving a signal at the expected
molecular weight of $40 kDa (b). Treatment of rat E14.5 VM precursor
cultures with HA-Wnt-5a (100 ng/mL) led to an increase in the number of
tyrosine hydroxylase (TH)-positive cells after 3 days of treatment as assessed
by immunocytochemistry (c and d). (c) HA-Wnt-5a and control
treated rat E14.5 VM precursor cultures immunostained with anti-TH and
the nuclear counterstain Hoechst-33342. (d) Three independent experiments
performed in duplicate. Values were normalized to number of
TH-positive cells/Hoechst-33342 in control treated cells (*p < 0.05). Error
bars give SEM.
P-β-catenin
Dvl3
dephospho
β-catenin
control
Wnt-3a
HA-Wnt-5a
β-catenin
Dvl3
control
HA-Wnt-5a,4°C
HA-Wnt-5a,-80°C
Wnt-5a
Wnt-5a
Wnt-3a
APT-1 - - +
- + +
- + +
APT-1 - - +
Dvl3
Dvl3
(a)
(b)
(c)
Fig. 2 (a) Wnt signalling in SN4741 cells. Dephosphorylation, phosphorylation
and stabilization of b-catenin and phosphorylation of dishevelled
(Dvl)3 upon Wnt (100 ng/mL) stimulation were analysed by immunoblotting.
(b) Removal of the lipid modification(s) with APT-1 abolished the capability
of Wnt-5a and Wnt-3a to activate signalling. (c) Comparison of haemagglutinin
(HA)-tagged Wnt-5a stored at 4 and )80°C and the non-tagged
Wnt-5a with regard to their capability to phosphorylate Dvl3. For each
panel, one experiment out of at least three is shown.
1552 G. Schulte et al.
Ó 2005 International Society for Neurochemistry, J. Neurochem. (2005) 92, 1550–1553
(Gonza´lez-Sancho et al. 2004). Indeed, both Wnt-3a and HA-Wnt-5a
induced a shift of fast-migrating unphosphorylated Dvl to slower
migrating phosphorylated Dvl as detected by immunoblotting with an
anti-Dvl3 antibody (Fig. 2a). A remaining open question is whether Dvl
is differentially phosphorylated by Wnt-3a and Wnt-5a. It has been
shown recently that differential phosphorylation of Dvl by casein kinase
e might either lead to stabilization of b-catenin or activation of jun-Nterminal
kinase (Cong et al. 2004). However, our initial screen for
possible downstream targets of non-canonical Wnt signalling in SN4741
cells using diverse phospho-specific antibodies (P-c-jun, P-JNK, P-PKC,
P-ERK1/2, P-CaMKII, P-PKB/Akt, P-p38 and P-glycogen synthase
kinase 3) has not given positive results (data not shown) but restricted
the number of possible downstream signalling components. Thus, our
results show that HA-Wnt-5a is biologically active and capable of
phosphorylating Dvl but does not regulate b-catenin levels or phosphorylation.
These results suggest that Wnt-5a works on dopaminergic
cells by activating non-canonical pathways rather than canonical Wnt
signalling.
In order to investigate whether the biological activity of Wnt-5a is
dependent on post-translational lipid modification, we treated Wnt-5a
with APT-1, an enzyme that removes lipid moieties in proteins and has
been previously reported to result in the loss of biological activity of
Wnt-3a (Willert et al. 2003). We found that the shedding of the lipid
modification of Wnt-3a or Wnt-5a abolished the capacity of both Wnts to
induce Dvl phosphorylation in SN4741 cells (Fig. 2b), suggesting that
the palmitolate is essential for the biological activity of Wnts in
dopaminergic cells. Finally, we examined the stability of the HA-Wnt-5a
protein and compared its ability to induce Dvl3 phosphorylation with
non-HA-tagged Wnt-5a. Interestingly, we found that the presence of the
HA tag or storage at 4 or )80°C did not reduce the activity of Wnt-5a
(Fig. 2c).
In summary, we report for the first time the purification of biologically
active and stable HA-Wnt-5a from fibroblast-conditioned media. The
purified protein induced the differentiation of dopaminergic precursors
and activated intracellular signalling pathways in dopaminergic cells by
a mechanism requiring the integrity of the lipid modification of Wnt-5a.
Moreover, our data indicate that Wnt-5a, unlike Wnt-3a, does not
activate the Wnt canonical signalling pathway, suggesting that the effects
of Wnt-5a on dopaminergic neurones are mediated by non-canonical
pathways. In agreement with this, it has been reported that Wnt-5a
signals in other systems via non-canonical pathways (Ku¨hl et al. 2000;
Ishitani et al. 2003). Our results identify dopaminergic neurones as a
useful model for studying and understanding cell signalling by Wnts.
Future studies will aim to identify the receptors and pathway(s) activated
by Wnt-5a in dopaminergic neurones and the mechanisms by which Dvl
distinguishes between and mediates both canonical and non-canonical
signalling pathways.
Acknowledgements
We wish to thank Drs Jawed Shafqat, Hans Jo¨rnvall, Carina Palmberg and Tomas
Bergman for fruitful discussions, advice and help in the purification and
sequencing of HA-Wnt-5a; Dr J.H. Son for providing SN4741 cells; Patricia
Kelly (R & D Systems) for providing Wnt-5a; Dr Anita Hall for critical reading of
the manuscript and Lena Amaloo and Claudia Tello for additional assistance.
Financial support was obtained from the Swedish Foundation for Strategic
Research, Swedish Royal Academy of Sciences, Knut and Alice Wallenberg
Foundation, European Commission, Swedish MRC, Karolinska Institutet and Lars
Hiertas Minnesfond. GS was supported by a post-doctoral fellowship from the
Swedish Society for Medical Research. GC-B was supported by the Praxis XXI
programme of the Portuguese Fundac¸a˜o para a Cieˆncia e Tecnologia/European
Social Fund, the Karolinska Institute and Calouste Gulbenkian Foundation.
References
Castelo-Branco G., Wagner J., Rodriguez F. J., Kele J., Sousa K., Rawal N., Pasolli
H. A., Fuchs E., Kitajewski J. and Arenas E. (2003) Differential regulation
of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a, and Wnt-
5a. Proc. Natl Acad. Sci. USA 100, 12 747–12 752.
Chen W., ten Berge D., Brown J., Ahn S., Hu L. A., Miller W. E., Caron M. G.,
Barak L. S., Nusse R. and Lefkowitz R. J. (2003) Dishevelled 2 recruits
b-arrestin 2 to mediate Wnt5A-stimulated endocytosis of Frizzled 4. Science
301, 1391–1394.
Cong F., Schweizer L. and Varmus H. (2004) Casein kinase I e modulates the
signaling specificities of dishevelled. Mol. Cell Biol. 24, 2000–2011.
Gonza´lez-Sancho J. M., Brennan K. R., Castelo-Soccio L. A. and Brown A. M.
(2004) Wnt proteins induce dishevelled phosphorylation via an LRP5/6independent
mechanism, irrespective of their ability to stabilize beta-catenin.
Mol. Cell Biol. 24, 4757–4768.
Hsieh J. C. (2004) Specificity of WNT–receptor interactions. Front. Biosci. 9,
1333–1338.
Huelsken J. and Behrens J. (2002) The Wnt signalling pathway. J. Cell Sci. 115,
3977–3978.
Ishitani T., Kishida S., Hyodo-Miura J., Ueno N., Yasuda J., Waterman M., Shibuya
H., Moon R. T., Ninomiya-Tsuji J. and Matsumoto K. (2003) The
TAK1-NLK mitogen-activated protein kinase cascade functions in the Wnt-
5a/Ca2+
pathway to antagonize Wnt/b-catenin signaling. Mol. Cell Biol. 23,
131–139.
Jo¨nsson M. and Andersson T. (2001) Repression of Wnt-5a impairs DDR1
phosphorylation and modifies adhesion and migration of mammary cells.
J. Cell Sci. 114, 2043–2053.
Ku¨hl M., Sheldahl L. C., Malbon C. C. and Moon R. T. (2000) Ca(2+)/calmodulindependent
protein kinase II is stimulated by Wnt and Frizzled homologs
and promotes ventral cell fates in Xenopus. J. Biol. Chem. 275, 12 701–
12 711.
Malbon C. C. (2004) Frizzleds: new members of the superfamily of G-proteincoupled
receptors. Front. Biosci. 9, 1048–1058.
Mericskay M., Kitajewski J. and Sassoon D. (2004) Wnt5a is required for proper
epithelial–mesenchymal interactions in the uterus. Development 131, 2061–
2072.
Nelson W. J. and Nusse R. (2004) Convergence of Wnt, beta-catenin, and cadherin
pathways. Science 303, 1483–1487.
Nusse R. (2003) Wnts and Hedgehogs: lipid-modified proteins and similarities in
signaling mechanisms at the cell surface. Development 130, 5297–5305.
Riddle R. and Pollock J. D. (2003) Making connections: the development of
mesencephalic dopaminergic neurons. Brain Res. Dev. Brain Res. 147, 3–21.
Shimizu H., Julius M. A., Giarre´ M., Zheng Z., Brown A. M. and Kitajewski J.
(1997) Transformation by Wnt family proteins correlates with regulation of
b-catenin. Cell Growth Differ. 8, 1349–1358.
Son J. H., Chun H. S., Joh T. H., Cho S., Conti B. and Lee J. W. (1999) Neuroprotection
and neuronal differentiation studies using substantia nigra dopaminergic
cells derived from transgenic mouse embryos. J. Neurosci. 19,
10–20.
Topol L., Jiang X., Choi H., Garret-Beal L., Carolan P. J. and Yang Y. (2003) Wnt-
5a inhibits the canonical Wnt pathway by promoting GSK-3-independent
b-catenin degradation. J. Cell Biol. 162, 899–908.
Wang H. Y. and Malbon C. C. (2004) Wnt-frizzled signaling to G-protein-coupled
effectors. Cell Mol. Life Sci. 61, 69–75.
Willert K., Brown J. D., Danenberg E., Duncan A. W., Weissman I. L., Reya T.,
Yates J. R. and Nusse R. (2003) Wnt proteins are lipid-modified and can act
as stem cell growth factors. Nature 423, 448–452.
Wnt-5a effects on dopaminergic precursors 1553
Ó 2005 International Society for Neurochemistry, J. Neurochem. (2005) 92, 1550–1553
Vítězslav Bryja, 2014    Attachments 
 
 
#2 
 
 
Bryja  V1
,  Schulte  G1
,  Arenas  E  (2007):  Wnt‐3a  utilizes  a  novel  low  dose  and  rapid 
pathway  that  does  not  require  casein  kinase  1‐mediated  phosphorylation  of  Dvl  to 
activate ‐catenin. Cell. Signal. 19: 610‐616.  
1
 equal contribution 
 
 
Impact factor (2007): 4.305 
Times cited (without autocitations, WoS, Feb 21st 2014): 20 
Significance: Identification of an alternative Wnt‐3a‐induced pathway activating beta‐
catenin. This pathway (restricted to some cell types) is rapid, sensitive and does 
not lead to an apparent activation of Dishevelled phosphorylation shift. 
Contibution of the author/author´s team: Together with Gunnar Schulte full design, 
performance and interpretation of the experiments. 
 
 
   
 
 
 
Wnt-3a utilizes a novel low dose and rapid pathway that does not require
casein kinase 1-mediated phosphorylation of Dvl to activate β-catenin
Vítězslav Bryja 1
, Gunnar Schulte 1,2
, Ernest Arenas ⁎
Karolinska Institutet, Department Medical Biochemistry and Biophysics, Laboratory Molecular Neurobiology, S-171 77 Stockholm, Sweden
Received 18 May 2006; received in revised form 21 August 2006; accepted 21 August 2006
Available online 30 August 2006
Abstract
The current view of canonical Wnt signalling is that following Wnt binding to its receptors (Frizzled-Lrp5/6), dishevelled (Dvl) becomes
hyperphosphorylated, and the signal is transduced to the APC-GSK3β-axin-β-catenin multiprotein complex, which subsequently dissociates. Asa result
β-catenin is not phosphorylated, escapes proteosomal degradation and activates its target genes after translocation to the nucleus. Here, we analyzed the
importance of the Wnt-3a-induced phosphorylation and shift in electrophoretic migration of Dvl (PS-Dvl) for the activation of β-catenin. Analysis of
Wnt-3a time- and dose-responses in a dopaminergic cell line showed that β-catenin is activated rapidly (within minutes) and at a low dose of Wnt-3a
(1 ng/ml). Surprisingly, PS-Dvl appeared only after 30 min and at greater doses (≥20 ng/ml) of Wnt-3a. Moreover, we found that a casein kinase 1
inhibitor (D4476) or siRNA for casein kinase 1 δ/ε (CK1δ/ε) blocked the Wnt-3a-induced PS-Dvl. Interestingly, CK1 inhibition or siRNA for CK1δ/ε
did not ablate the activation of β-catenin by Wnt-3a, indicating that there is a PS-Dvl-independent path to activate β-catenin. The increase in β-catenin
activation by Wnt-3a (PS-Dvl-dependent or -independent) were blocked by Dickkopf1 (Dkk1), suggesting that the effect of Wnt-3a is in both cases
mediated by Lrp5/6 receptors. Thus, our results show that Wnt-3a rapidly induce a partial activation of β-catenin in the absence of PS-Dvl at low doses,
while at high doses induce a full activation of β-catenin in a PS-Dvl-dependent manner.
© 2006 Elsevier Inc. All rights reserved.
Keywords: Wnt-3a; Dishevelled; Dopaminergic cells; Casein kinase 1; Activation of β-catenin; Canonical Wnt signalling
1. Introduction
The Wnt signaling pathway is one of the most evolutionary
conserved biochemical signalling pathways and is involved in a
vast array of processes including embryonic development, adult
tissue homeostasis and cancer (for review see [1–3]). The Wnts
are secreted glyco-lipoproteins that bind to their membrane
receptors (Frizzleds) and their co-receptors (Lrp5/6). The primary
signalling components that transduce the Wnt signal are
cytoplasmic proteins such as Dishevelled (Dvl), and the degradation
complex, formed by Axin, APC, and GSK3β. Upon Wnt
stimulation, Dvl is phosphorylated and the degradation complex
is inhibited leading to the stabilization of β-catenin. β-catenin
can then act in the cytosol, or in the nucleus, by binding to TCF/
LEF and regulating transcription (for additional information see
Wnt homepage [4]).
The current view of Wnt signalling is that canonical Wnt
binds to Frizzled-Lrp5/6 containing receptor complexes, Dvl
becomes hyperphosphorylated, and then the signal is transduced
to the GSK3β-axin-β-catenin complex, which dissociates and
consequently β-catenin is not phosphorylated and becomes
activated. Intriguingly, some crucial details of the molecular
pathways induced by Wnts in mammalian cells are still not fully
understood. One of the most elusive parts of the pathway is the
link between phosphorylated Dvl and GSK3β inhibition
resulting in the activation and stabilization of β-catenin. It was
shown previously in mammalian cells that canonical Wnts are
able to induce the phosphorylation of Dvl and the activation of
β-catenin [5]. However, the mutual link between these two
signalling events induced by canonical Wnts was not investigated
in detail.
We previously found that dopaminergic neurons respond to
Wnt signalling [6,7] and we now take advantage of the SN4741
dopaminergic neuronal cell line [8] as a model system. SN4741
Cellular Signalling 19 (2007) 610–616
www.elsevier.com/locate/cellsig
⁎ Corresponding author. Tel.: +46 8 52487663; fax: +46 8 34 1960.
E-mail address: ernest.arenas@ki.se (E. Arenas).
1
both authors contributed equally to this work.
2
present address: Karolinska Institutet, Dept. Physiology and Pharmacology,
Receptor Biology and Signaling, S-17177 Stockholm, Sweden.
0898-6568/$ - see front matter © 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.cellsig.2006.08.011
cells, as midbrain dopaminergic neurons [9,10], express a complex
battery of Wnt signaling components (N. Rawal and G.
Schulte, unpublished) and constitute a good model to study
molecular mechanisms of the Wnt signalling [9,10]. We hereby
report that Wnt-3a induces an unexpectedly rapid activation of
β-catenin that requires Lrp5/6 and low doses of Wnt-3a, but
does not require the casein kinase-1-mediated Dvl phosphorylation.
However, at late time points and at high doses, Wnt-3a
potentiated the initial activation of β-catenin by a Dvl phosphorylation-dependent
mechanism. Thus our findings suggest
that β-catenin can be activated by two subsequent mechanisms
that are independent or dependent of casein kinase 1 activity
and PS-Dvl.
2. Materials and methods
2.1. Cell culture and treatments
SN4741 cells were generously provided by Dr. J. H. Son [8] and grown in
DMEM, 10% FCS, L-glutamine (2 mM), penicillin (50 U/ml), streptomycin
(50 U/ml), glucose (0.6%) (all from Gibco Life Sciences). For analysis of
intracellular signaling, 40,000 cells/well were seeded in 24 well plates, grown
overnight in the absence of serum and in the same medium stimulated with
recombinant mouse Wnt-3a (R&D Systems) for 2 h according to the figure
legends. Control stimulations were done with equivalent volumes of PBS, 1%
CHAPS. Treatment of SN4741 cells with poorly cell-permeable D4476 was
performed in the presence of 1 μl of FuGENE 6 Transfection Reagent (Roche)
per 200 μl of culture media.
2.2. Western blotting
For Western blot analysis, cell samples were prepared as follows: Cells on
culture dish were washed with PBS (pH 7.4) and lysed in 1× Laemmli buffer. Equal
amounts of cell lysate were subjected to 7.5% SDS PAGE, electrotransferred onto
Hybond-P membrane, immunodetected using appropriate primary and secondary
antibodies, and visualized by ECL+Plus reagent according to manufacturer′s
instructions (Amersham). When required, membranes were stripped in 62.5 mM
Tris/HCl (pH 6.8), 2% SDS, and 100 mM β-mercaptoethanol, washed, and
reblotted with another antibody. When required, the intensities of signals were
assessed by densitometry using Scion Image Beta 4.02 software (Scion
Corporation). After immunodetection, each membrane was stained by amidoblack
to confirm equal protein loading. The antibodies used were as follows: anti-Dvl1
(sc-7397), anti-Dvl2 (sc-13974), anti-Dvl3 (sc-8027), anti-Myc (sc-40) and antiCK1ε
(sc-6471); anti-β-catenin was from BD Bioscences; anti-active-β-catenin
(anti-ABC) was from Upstate Biotechnology; anti-β-actin (Ab6276) was from
Abcam; anti-phospho-β-catenin (Ser33/37/Thr41) and anti-phospho-β-catenin
(Thr41/Ser45) were from Cell Signaling Technology and anti-phospho-β-catenin
(Ser45) was from Biosource.
2.3. RNA interference and cell transfections
SN4741 cells were transfected with siRNA using neofection (Ambion).
siRNAs against individual isoforms of mouse CK1 were purchased from AmbionCK1δ
(#88298) and CK1ε (II #188528). Silencer® Negative Control siRNA
(#4635, Ambion) was used as a negative control. For transfection into SN4741 cell,
siRNAs (0.75 μl of 20 μM) were mixed with Lipofectamine 2000 (2 μl;
Invitrogene) and OptiMEM (47.25 μl; Gibco).incubated for 20 min at RT, and the
mixture (50 μl) was added to a freshly trypsinized suspension of 25 000 cells in
500 μl of complete media (in 24-well plates). The final concentration of the siRNA
in each well was 30 nM. The culture media was exchanged after 5 h and 48 h post
transfection the cells were treated with Wnt-3a and collected for further analyses.
The efficiency of the silencing was assessed by Western blotting. For plasmid
transfection 40000–60000 cells/well were seeded (in 24 well plates) and grown
overnight. SN4741 cells were transfected with 1 μg of DNA and 2 μl of
Lipofectamine 2000 (Invitrogen) per well under serum-free conditions, according
to manufacturer′s recommendations. Medium was changed 4 h post transfection
and cells were grown in complete culture medium for another 24 h for further
analysis by Western Blotting.
3. Results
3.1. Wnt-3a induces activation of β-catenin and phosphorylation
of Dvl
In order to characterize the pathways activated by Wnt-3a in
dopaminergic cells we treated SN4741 cells with Wnt-3a
(100 ng/ml) for 2 h. To monitor the activation of canonical
Wnt-signaling we have used antibodies recognizing different
phosphorylation states of β-catenin: a) active β-catenin (ABC)
antibody [11] specific to forms of β-catenin dephosphorylated
on GSK3β target sites (Ser37 or Thr41); and b) phospho-βcatenin
(p-β-catenin) antibody specific to the forms of β-catenin
targeted for degradation by GSK3β-mediated phosphorylation
at Ser33, Ser37, or Thr41. As shown in Fig. 1A, 2 h treatment
with Wnt-3a induced an increase in active β-catenin (ABC) and
a decrease in phosphorylated β-catenin. However, activation of
β-catenin did not lead to any detectable change in the level of
total β-catenin after 2 h. Treatment with Wnt-3a also lead to the
phosphorylation of Dvl, which is detected as a mobility shift of
the protein on SDS-PAGE [5,12]. As other phosphorylation
events may not result in a mobility shift of Dvl, in the rest of the
manuscript we will refer to the slowly migrating form of Dvl as
PS-Dvl (phosphorylated and shifted Dvl). As shown in Fig. 1B
all three Dvl isoforms (Dvl1, Dvl2, Dvl3) become phosphorylated
following Wnt-3a treatment. However, although all Dvl1,
Dvl2 and Dvl3 are expressed in SN4741 cells, the amount of
Dvl1 is just above Western blotting detection limit and is thus
difficult to detect. In further work we therefore analyzed Dvl1
only in the experiments where information about all three Dvl
isoforms was needed for the conclusions. In order to confirm that
non-phosphorylated β-catenin also results in the stabilization of
β-catenin, we analyzed later time points up to 24 h post stimulation.
A significant increase in total β-catenin levels was
detected after 6 h, the time at which the levels of active β-catenin
also peaked (Fig. 1C). β-catenin levels remained high for up to
24 h, demonstrating that Wnt-3a induces not only increased
levels of dephosphorylated β-catenin but also leads to the
stabilization of β-catenin.
3.2. The activation of β-catenin precedes the phosphorylationdependent
Dvl mobility shift
We next examined in more detail the temporal dynamics of
the Dvl phosphorylation mobility shift and the β-catenin
activation by 100 ng/ml Wnt-3a. As we show in Fig. 2A,
Wnt-3a was able to induce active β-catenin within few minutes
and the amount of active β-catenin gradually increased during
the 2 h of treatment (Fig. 2B). Importantly, all three Dvl
isoforms showed the same characteristic phosphorylationdependent
mobility shift, which was first detected at 30 min
and peaked by 1–2 h of treatment (Fig. 2B). These data are
611V. Bryja et al. / Cellular Signalling 19 (2007) 610–616
compatible with the current Wnt signaling model in which Dvl
phosphorylation mediates β-catenin activation, since the Dvl
mobility shift and the second increase in active β-catenin
coincide in time. However, our findings also showed that Wnt-
3a could also induce a rapid activation β-catenin at an earlier
time-point by a mechanism that did not involve PS-Dvl.
3.3. The activation of β-catenin occurs at lower doses of Wnt-
3a than the phoshorylation-dependent Dvl mobility shift
As a second parameter we examined whether the stimulation
of SN4741 cells for 2 h resulted in a dose dependent activation
of β-catenin and/or phosphorylation-dependent Dvl mobility
shift. As shown in Fig. 2C, Wnt-3a induced non-phosphorylated
active β-catenin (ABC) at very low doses (0.3–1 ng/ml).
Activation of β-catenin reached a plateau at a dose of 1 ng/ml
that was maintained up to a dose of 10 ng/ml. However, the
activation of β-catenin only reached maximal levels by
increasing the dose to at least 30 ng/ml of Wnt-3a. Importantly
only this higher dose of Wnt-3a leads to a phosphorylationdependent
Dvl mobility shift of all three Dvl isoforms (Dvl1,
Dvl2, Dvl3). Quantification of active β-catenin in the dose
response experiment showed a clear two step activation pattern
(Fig. 2D). These experiments, together with the time-course
analysis suggested that Wnt-3a could perhaps activate β-catenin
by two separate mechanisms: A) rapid (1–15 min) and/or low
dose (0.3–3 ng/ml) Wnt-3a that does not involve the
phosphorylation-dependent Dvl mobility, and B) a second one
that requires a longer activation (≥30 min) and/or higher Wnt-
3a dose (N10 ng/ml) and involves PS-Dvl. We therefore decided
to examine whether Wnt-3a-induced β-catenin activation
requires PS-Dvl.
3.4. CK1δ/ε is required for Wnt-3a-induced PS-Dvl
It has been previously shown that endogenous casein kinase
1 (CK1) mediates the phosphorylation of Dvl in response to
canonical Wnts [13–15]. We thus wanted to identify whether
CK1 was also responsible for the Wnt-3a-induced PS-Dvl in
SN4741 cells. Using an RNAi approach we blocked CK1δ and
CK1ε, the two isoforms of CK1 that phosphorylate Dvl and
positively regulate canonical Wnt signalling [13,16,17]. As we
show in Fig. 3, RNAi mediated knockdown of CK1δ/ε
significantly reduced the level of PS-Dvl2 in response to
Wnt-3a, suggesting that CK1δ/ε is necessary for PS-Dvl
induction in response to Wnt-3a. Similar results were observed
for Wnt-5a (VB, GS and EA, unpublished). Importantly,
although CK1δ/ε siRNAs clearly attenuated the induction of
PS-Dvl2 by Wnt-3a, there was no effect on the activation of βcatenin,
as measured by ABC antibody (Fig. 3). This result
suggested that PS-Dvl and CK1δ/ε might be dispensable for the
activation of β-catenin by Wnt-3a. However, since PS-Dvl was
only partially blocked by CK1δ/ε siRNA we used pharmacological
inhibitors to block the function of CK1 and determine
the function PS-Dvl.
3.5. D4476, a casein kinase 1 (CK1) inhibitor, blocks the
phosphorylation-dependent mobility shift of endogenous Dvl
(PS-Dvl) but allows the activation of β-catenin by Wnt-3a
Since Dvl has been previously identified as an upstream
regulator of β-catenin, we sought to determine the relative contribution
of PS-Dvl to the activation of β-catenin. We therefore
examined whether a known CK1δ inhibitor, D4476 (4-[4-(2,3-
dihydro-benzo[1,4]dioxin-6-yl)-5-pyridin-2-yl-1H-imidazol-2yl]benzamide)
[18], also inhibited the effects of CK1δ/ε on PSDvl.
We utilized an experimental system based on the overexpression
of CK1ε and Dvl2-Myc. We found that CK1 induced a
phosphorylation-dependent mobility shift of Dvl2-Myc (Fig. 4A,
compare lanes 1 and 3). When D4476 is added (lanes 2 and 4) the
effect of CK1ε on Dvl2-Myc is efficiently inhibited, demonstrating
that D4476 is able to block CK1ε-mediated phosphorylation
of Dvl. These data demonstrate that D4476 is an efficient inhibitor
of CK1δ/ε activity and can thus serve as useful and specific tool
for the analysis of the role of PS-Dvl in β-catenin activation.
We therefore blocked Wnt-3a-induced PS-Dvl formation
Fig. 1. Wnt-3a activates β-catenin and Dvl in SN4741 cells. (A, B) SN4741 cells were treated with Wnt-3a (100 ng/ml) or with control solution, and were lysed after
2 h of stimulation. The activation of β-catenin (A) was determined by Western blotting using antibodies against active (Ser33/37-dephosphorylated) (ABC),
phosphorylated (phospho Ser33/37/Thr41) (p-β-catenin) and total β-catenin. (B) The phosphorylation of Dvl isoforms was detected as phosphorylation-dependent
mobility shift of total Dvl1, Dvl2 and Dvl3 using Dvl isoform-specific antibodies. The position of dephosphorylated (full triangle) or phosphorylated and shifted Dvl
(PS-Dvl, open triangle) are indicated. (C) SN4741 cells were treated with Wnt-3a (100 ng/ml) and were lysed after 0, 3, 6, 12 and 24 h. The level of ABC, total
β-catenin and the phosphorylation of Dvl2 were determined as in part A and B. Data in A–C are representative of at least three independent replicates.
612 V. Bryja et al. / Cellular Signalling 19 (2007) 610–616
pharmacologically using D4476. As shown in Fig. 4B, D4476
dose-dependently inhibited both basal and Wnt-3a-induced
phosphorylation-dependent Dvl mobility shifts. However, under
the conditions shown in Fig. 4B (50 ng/ml Wnt-3a for 2 h), the
efficiency of the inhibition of Dvl-phosphorylation was incomplete
(see lanes 7 and 8) even at high doses of D4476. Since our
findings indicated that the shift of Dvl was dose-dependent and
maximal at already 30 ng/ml (Fig. 2D), we lowered the dose of
Wnt-3a to 20 ng/ml for 2 h and found that the Wnt-3a-induced
Dvl2 and Dvl3 phosphorylation-dependent mobility shift was
now efficiently blocked by 100 μM D4476 (Fig. 4C).
CK1 was previously shown to be involved not only in Dvl
phosphorylation but also in the phosphorylation of β-catenin.
Importantly, CK1α was found to be a kinase for β-catenin that
phosphorylates its Ser45 residue thereby priming β-catenin for
subsequent phosphorylation by GSK3β [19–21] and degradation.
Importantly, we found that under the conditions described
above (20 ng/ml Wnt-3a for 2 h), D4476 completely blocked
both basal as well as Wnt-3a-induced phosphorylation of all
three Dvl isoforms — Dvl 1, Dvl2, and Dvl3, but still allowed
the activation of β-catenin by Wnt-3a (Fig. 4D). This was
shown by the high levels of ABC (non-phosphorylated Ser37/
Thr41β-catenin) and the low signal by anti-phospho-Ser33/37/
Thr41-β-catenin antibodies after Wnt-3a stimulation. As we
further show by phosphospecific antibodies against phosphoSer45-and
phospho-Thr41/Ser45-β-catenin, the phosphorylation
at the CK1α target site of β-catenin (Ser45) is significantly
decreased following D4476 treatment suggesting that CK1α is
efficiently inhibited by D4476 (Fig. 4D). Importantly the level
of CK1α-dependent phosphorylation of β-catenin at Thr41/
Ser45 is not changed by Wnt-3a in the presence of D4476,
indicating that the blocking is not at the level of β-catenin. The
Fig. 2. Time-course and dose-response of the activation of β-catenin and Dvl by
Wnt-3a. (A) SN4741 cells were treated with Wnt-3a (100 ng/ml) and were lysed
after 0, 1, 5, 10, 15, 30, 60 and 120 min. (B) Quantification of ABC signal from
the time response experiment. The signal was quantified using densitometry and
the intensity of the signal at 120 min was normalized to 1. (C) SN4741 cells were
treated with increasing doses of Wnt-3a, and were lysed after 2 h of stimulation.
(D) Quantification of ABC signal from dose response experiments (n=3). The
intensity of the signal in the sample treated with 300 ng/ml Wnt-3a was
normalized to 1. In A, C the activation of β-catenin was determined by Western
blotting using antibodies against active (Ser33/37-dephosphorylated) β-catenin
(ABC). The phosphorylation of Dvl1, Dvl2 and Dvl3 was detected as
phosphorylation-dependent mobility shift with anti-Dvl1-, anti-Dvl2- and antiDvl3-specific
antibodies. The position of dephosphorylated (full triangle) and
phosphorylated (PS-Dvl, open triangle) Dvl is indicated. Data are representative
of at least three independent replicates.
Fig. 3. CK1δ/ε induces PS-Dvl in response to Wnt-3a. SN4741 cells were
transfected with control siRNA and a mixture of siRNAs against CK1δ and
CK1ε and treated with control, 10 and 20 ng/ml of Wnt-3a. The phosphorylation
of Dvl isoforms was detected as phosphorylation-dependent mobility shift of
total Dvl2. The position of non-phosphorylated (PS-Dvl, full triangle) and
phosphorylated Dvl (open triangle) is indicated. The activation of β-catenin was
determined by Western blotting using antibodies against active (Ser33/37dephosphorylated)
β-catenin (ABC). The level of CK1ε and β-actin were
determined to confirm the efficiency of the knockdown and protein loading,
respectively. The experiment was performed three times with comparable
results.
613V. Bryja et al. / Cellular Signalling 19 (2007) 610–616
expression level of CK1ε was also not modulated by Wnt-3a
and D4476 treatment. In summary, these results indicate that the
two events, the Dvl phosphorylation shift and activation of βcatenin
can occur independently even at higher Wnt-3a doses.
Thus, our results suggest that Wnt-3a can activate β-catenin in
the absence or the presence of PS-Dvl. We therefore set to
determine whether the activation of β-catenin in the absence or
the presence of PS-Dvl required the participation of Lrp5/6 and
was therefore blocked by Dkk1.
3.6. Dkk1 blocks the activation of β-catenin by Wnt-3a in the
absence or the presence of PS-Dvl
In order to further characterize the mechanism by which Wnt-
3a activates β-catenin, we treated SN4741 cells with Dkk1 — an
inhibitor of canonical Wnt signaling [22], which blocks the
signaling activity of Lrp5 and Lrp6 co-receptors [23,24]. Dkk1
efficiently reduced the activation of β-catenin, leaving the
phosphorylation-dependent mobility shift of Dvl by Wnt-3a
intact (Fig. 5A). These data suggested that Dkk1 can inhibit the
activation of β-catenin by Wnt-3a in the presence of PS-Dvl. We
next examined whether Dkk1 can block active β-catenin by in the
absence of the Dvl mobility shift, in the presence of the CK1
inhibitor, D4476 (100 μM). Interestingly, we found that Dkk1
dose-dependently blocked the activation of β-catenin by 20 ng/ml
Wnt-3a (Fig. 5B). These results indicated that the regulation of
active β-catenin depends on signalling via the Lrp5/6 coreceptors
but occurred independently PS-Dvl. Finally, we examined
whether the Dkk1-sensitive and CK1-dependent Wnt-3a-induced
pathways cooperate in the activation of β-catenin. Treatment of
SN4741 cells with either Dkk1 or D4476 induced a modest
reduction in the activation of β-catenin by 50 ng/ml Wnt-3a
(Fig. 5C and D). However, their effects were additive and
combined treatment with Dkk1 and D4476 induced a greater
Fig. 4. CK1 inhibition efficiently blocks Wnt-3a-induced phosphorylation of Dvl. (A) CK1 inhibitor, D4476 (100 μM) blocks the phosphorylation dependent shift of
Dvl2-Myc induced by overexpression of CK1ε in SN4741 cells. The position of non-phosphorylated (full triangle) and phosphorylated (open triangle) Dvl2 is
indicated. (B) SN4741 cells were treated with control or Wnt-3a (50 ng/ml) for 2 h in the presence or absence of increasing doses of D4476. (C) SN4741 cells were
treated with control solution, 100 ng/ml of Wnt-3a or 20 ng/ml of Wnt-3a for 2 h in the presence or absence of D4476 (100 μM). In B, C cells were lysed and the
phosphorylation of Dvl2 and Dvl3 was detected as phosphorylation-dependent mobility shift. (D) SN4741 cells were treated with control solution or Wnt-3a (20 ng/
ml) for 2 h in the presence or absence of D4476 (100 μM). Cells were lysed and phosphorylation of β-catenin was determined by Western blotting using specific
antibodies against active (Ser33/37- dephosphorylated) β-catenin (ABC), phosphoSer33/37/Thr41, phosphoSer45, phosphoThr41/Ser45 and total β-catenin. The
phosphorylation of Dvl1, Dvl2 and Dvl3 was detected as phosphorylation dependent mobility shift. Presence of CK1ε was confirmed using a CK1ε specific antibody.
The position of dephosphorylated (full triangle) and phosphorylated (PS-Dvl, open triangle) Dvl is indicated. Data in A–D are representative of at least three
independent replicates.
614 V. Bryja et al. / Cellular Signalling 19 (2007) 610–616
decrease in active β-catenin. These results suggest that CK1mediated
Dvl phosphorylation and Dkk1-mediated pathways
cooperate to regulate the activation of β-catenin by Wnt-3a.
4. Discussion
Canonical Wnts (e.g. Wnt-3a) transduce their signal into the
cell by inducing the phosphorylation of Dvl, which in turn
results in inhibition of GSK3β preventing thus the phosphorylation
of β-catenin. Although the precise mechanism connecting
Dvl phosphorylation with GSK3β inhibition is not known
(for review see e.g. [25,26]), these events are considered to be
sequential. Here we show using siRNA and pharmacological
inhibitors that Wnt-3a-induced PS-Dvl is dependent on CK1δ/ε.
Using these approaches we analyzed the role the role of PS-Dvl
in β-catenin activation. Our findings suggest that Wnt-3a induces
the activation of β-catenin in a PS-Dvl-dependent manner.
However, we also found that β-catenin can also be activated
by Wnt-3a by a mechanism that is independent from the CK1δ/
ε-mediated phosphorylation of Dvl and from PS-Dvl. This
pathway is activated very rapidly (in 1 minute) at high doses of
Wnt-3a (100 ng/ml) or by constant exposure to low doses of
Wnt-3a (0.3–3 ng/ml for 2 h), two modalities of Wnt signalling
that are likely to be very relevant in vivo.
Interestingly, this rapid/low Wnt-3a dose PS-Dvl-independent
pathway, is potentiated by a mechanism involving PS-Dvl
that is activated with a slow time course and with high Wnt-3a
doses. We also found that both PS-Dvl dependent and independent
pathways are sensitive to Lrp5/6 inhibitor Dkk1 [22], a
finding that is consistent with the idea that canonical Wnts (e.g.
Wnt-1 or Wnt-3a) bind Lrp5/6 [27,28]. Moreover, Dvlindependent
pathways have been previously found to be dependent
on Lrp5/6 containing receptor complexes [5,29–31].
As we demonstrate for Wnt-3a, canonical Wnts have been
found to activate β-catenin directly with high potency but low
efficacy, by a PS-Dvl-independent mechanism that is Dkk1
sensitive and most likely requires Lrp5/6 and Axin [32,33]. On
the other hand canonical Wnts act through Frizzled receptors in
an Lrp5/6 independent manner [5, present data] to activate
CK1δ/ε [15], which in turn results in PS-Dvl (present results).
Our data show that high doses of Wnt-3a lead to the activation
of CK1/Dvl, which then potentiates the Lrp6-dependent activation
of β-catenin. Thus, a high level of canonical Wnt might
be necessary to bring together Lrp5/6 and Frizzled [27], mediate
their oligomerization at the membrane [31] and potentiate βcatenin
signalling (present results). Indeed, phosphorylation of
Dvl by CK1ε specifically enhances the interaction of Lrp5/6
with some binding proteins e.g. Frat-1 [34,35] that can then
Fig. 5. Effects of Dkk1 on Wnt-3a-induced signalling. (A) SN4741 cells were treated with Wnt-3a (20 ng/ml) for 2 h in the presence or absence of 500 ng/ml of
rmDkk1 (B) SN4741 cells were treated with control solution or with indicated combinations of D4476 (100 μM) and Wnt-3a (20 ng/ml) in presence of increasing
doses of Dkk1 (100, 250, 500 and 1000 ng/ml). (C) SN4741 cells were pretreated with control solution, Dkk1 (500 ng/ml), D4476 (100 μM) or Dkk1+D4476, and
then treated with Wnt-3a (50 ng/ml) or left untreated for 2 h. (A–C) After lysis the activation of β-catenin was determined by Western blotting using an antibody
against active (Ser33/37-dephosphorylated) β-catenin (ABC). The phosphorylation of Dvl2 and/or Dvl3 was detected as phosphorylation-dependent mobility shift
with the anti-Dvl2-specific antibody. The position of dephosphorylated (full triangle) and phosphorylated (PS-Dvl, open triangle) Dvl2 is indicated. (D) Quantification
of active β-catenin signal from the experiment described in C (n=3). The signal was quantified using densitometry and the intensity of Wnt-3a only treated sample was
normalized to 1. Statistical differences in Wnt-3a treated samples were tested by Student's t-test and the significant differences from control are indicated by asterisks
(⁎pb0.05, ⁎⁎pb0.01).
615V. Bryja et al. / Cellular Signalling 19 (2007) 610–616
either directly or indirectly (e.g. via Axin) stabilize the Wntinduced
Lrp5/6-Frizzled dimer intracellularly. In summary, our
data are compatible with the idea that the reinforcement of βcatenin
activation by high Wnt-3a doses could result from the
oligomerization of Lrp5/6 and Frizzled and the recruitment of
phosphorylated Dvl to the molecular machinery transducing the
signal to β-catenin [31].
Our results also show that depending on the level of canonical
Wnt, the cells may utilize PS-Dvl for signaling or not. The
PS-Dvl independent, Dkk1 sensitive and Lrp5/6-mediated
pathway is utilized mainly in the presence of low doses of
canonical Wnt and also immediately after stimulation. Although
molecular details of this pathway remain to be identified, the
dynamics and other properties resemble recently reported G
protein-dependent pathway leading to GSK3β inhibition in
response to Wnt-3a [36]. In contrast, at higher doses of Wnt-3a
and more than 30 min after stimulation, Dvl becomes
concomitantly activated and potentiates β-catenin signalling.
A high dose of canonical Wnt has been found to be required to
mediate the recruitment of Lrp5/6 and Frizzled [31]. This type
of mechanism is thought to result in the involvement of phosphorylated
Dvl and the activation of β-catenin. One interesting
question raised by this model is whether PS-Dvl-dependent or
PS-Dvl-independent canonical signalling induced by high or
low Wnt concentration, could differ in the activation of βcatenin
not only quantitatively but also qualitatively, by regulating
distinct functions. This possibility remains to be tested.
In conclusion, our analysis of Wnt-3a action in SN4741 cells
shows that Wnt-3a activates canonical β-catenin signalling by
at least two mechanisms: by a CK1δ/ε and PS-Dvl-independent
pathway that is rapid and can be activated by low doses of Wnt,
and a PS-Dvl-dependent pathway that is slow and requires high
doses of Wnt.
Acknowledgments
Financial support was obtained from the Swedish Foundation
for Strategic Research, Swedish Royal Academy of Sciences,
Knut and Alice Wallenberg Foundation, European Commission,
Swedish MRC, Karolinska Institutet and Lars Hiertas Minnesfond.
G.S. was supported by a post-doctoral fellowship from the
Swedish Society for Medical Research (SSMF).
We would like to thank Claudia Tello, Johny Söderlund and
Annika Käller for technical and secretarial assistance and the
members of Arenas lab for stimulating discussions.
References
[1] J. Huelsken, W. Birchmeier, Curr. Opin. Genet. Dev. 11 (2001) 547.
[2] T.P. Yamaguchi, Curr. Biol. 11 (2001) R713.
[3] A. Patapoutian, L.F. Reichardt, Curr. Opin. Neurobiol. 10 (2000) 392.
[4] R. Nusse, (1 December 2004, revision date).
[5] J.M. Gonzalez-Sancho, K.R. Brennan, L.A. Castelo-Soccio, A.M. Brown,
Mol. Cell Biol. 24 (2004) 4757.
[6] G. Castelo-Branco, J. Wagner, F.J. Rodriguez, J. Kele, K. Sousa, N.
Rawal, H.A. Pasolli, E. Fuchs, J. Kitajewski, E. Arenas, Proc. Natl. Acad.
Sci. U. S. A. 100 (2003) 12747.
[7] G. Castelo-Branco, N. Rawal, E. Arenas, J. Cell Sci. 117 (2004) 5731.
[8] J.H. Son, H.S. Chun, T.H. Joh, S. Cho, B. Conti, J.W. Lee, J. Neurosci. 19
(1999) 10.
[9] G. Schulte, V. Bryja, N. Rawal, G. Castelo-Branco, K.M. Sousa, E. Arenas,
J. Neurochem. 92 (2005) 1550.
[10] N. Rawal, G. Castelo-Branco, K.M. Sousa, J. Kele, K. Kobayashi, H.
Okano, E. Arenas, Exp. Cell Res. (2006).
[11] M. van Noort, J. Meeldijk, R. van der Zee, O. Destree, H. Clevers, J. Biol.
Chem. 277 (2002) 17901.
[12] J.S. Lee, A. Ishimoto, S. Yanagawa, J. Biol. Chem. 274 (1999) 21464.
[13] J.M. Peters, R.M. McKay, J.P. McKay, J.M. Graff, Nature 401 (1999) 345.
[14] R.M. McKay, J.M. Peters, J.M. Graff, Dev. Biol. 235 (2001) 388.
[15] W. Swiatek, I.C. Tsai, L. Klimowski, A. Pepler, J. Barnette, H.J. Yost, D.M.
Virshup, J. Biol. Chem. 279 (2004) 13011.
[16] J. Liu, A.G. Bang, C. Kintner, A.P. Orth, S.K. Chanda, S. Ding, P.G. Schultz,
Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 1927.
[17] M. Kishida, S. Hino, T. Michiue, H. Yamamoto, S. Kishida, A. Fukui, M.
Asashima, A. Kikuchi, J. Biol. Chem. 276 (2001) 33147.
[18] G. Rena, J. Bain, M. Elliott, P. Cohen, EMBO Rep. 5 (2004) 60.
[19] C. Liu, Y. Li, M. Semenov, C. Han, G.H. Baeg, Y. Tan, Z. Zhang, X. Lin, X. He,
Cell 108 (2002) 837.
[20] S. Amit, A. Hatzubai, Y. Birman, J.S. Andersen, E. Ben-Shushan, M.
Mann, Y. Ben-Neriah, I. Alkalay, Genes Dev. 16 (2002) 1066.
[21] H. Matsubayashi, S. Sese, J.S. Lee, T. Shirakawa, T. Iwatsubo, T. Tomita,
S. Yanagawa, Mol. Cell Biol. 24 (2004) 2012.
[22] A. Glinka, W. Wu, H. Delius, A.P. Monaghan, C. Blumenstock, C. Niehrs,
Nature 391 (1998) 357.
[23] B. Mao, W. Wu, Y. Li, D. Hoppe, P. Stannek, A. Glinka, C. Niehrs, Nature
411 (2001) 321.
[24] A. Bafico, G. Liu, A. Yaniv, A. Gazit, S.A. Aaronson, Nat. Cell Biol. 3
(2001) 683.
[25] C.Y. Logan, R. Nusse, Annu. Rev. Cell Dev. Biol. 20 (2004) 781.
[26] J. Huelsken, J. Behrens, J. Cell Sci. 115 (2002) 3977.
[27] K. Tamai, M. Semenov, Y. Kato, R. Spokony, C. Liu, Y. Katsuyama, F.
Hess, J.P. Saint-Jeannet, X. He, Nature 407 (2000) 530.
[28] G. Liu, A. Bafico, V.K. Harris, S.A. Aaronson, Mol. Cell Biol. 23 (2003)
5825.
[29] K. Brennan, J.M. Gonzalez-Sancho, L.A. Castelo-Soccio, L.R. Howe, A.M.
Brown, Oncogene 23 (2004) 4873.
[30] L. Li, J. Mao, L. Sun, W. Liu, D. Wu, J. Biol. Chem. 277 (2002) 5977.
[31] F. Cong, L. Schweizer, H. Varmus, Development 131 (2004) 5103.
[32] K. Tamai, X. Zeng, C. Liu, X. Zhang, Y. Harada, Z. Chang, X. He, Mol.
Cell 13 (2004) 149.
[33] N.S. Tolwinski, M. Wehrli, A. Rives, N. Erdeniz, S. DiNardo, E.
Wieschaus, Dev. Cell 4 (2003) 407.
[34] E. Hay, C. Faucheu, I. Suc-Royer, R. Touitou, V. Stiot, B. Vayssiere, R.
Baron, S. Roman-Roman, G. Rawadi, J. Biol. Chem. 280 (2005) 13616.
[35] S. Hino, T. Michiue, M. Asashima, A. Kikuchi, J. Biol. Chem. 278 (2003)
14066.
[36] X. Liu, J.S. Rubin, A.R. Kimmel, Curr. Biol. 15 (2005) 1989.
616 V. Bryja et al. / Cellular Signalling 19 (2007) 610–616
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#3 
 
 
Bryja  V1
,  Schulte 
G1
,  Rawal  N,  Grahn  A,  Arenas  E  (2007):  Wnt‐5a  induces  Dishevelled 
phosphorylation  and  dopaminergic  differentiation  via  a  CK1‐dependent  mechanism.  J.  Cell 
Sci. 120: 586‐595.  
1
 equal contribution 
 
 
Impact factor (2007): 6.247 
Times cited (without autocitations, WoS, Feb 21st 2014): 40 
Significance:  This  work  for  the  first  time  identified  a  kinase  –  casein  kinase  1 
delta/epsilon – which is responsible for phosphorylation of Dishevelled in the non‐
canonical Wnt pathway. Till today, CK1‐controlled Dvl shift represent one of the 
most  commonly  used  readouts  of  the  non‐canonical  Wnt  pathway.  Nowadays 
commonly  used  term  –  PS‐Dvl  (phosphorylated  and  shifted  Dvl)  has  been 
introduced in this study. 
Contibution of the author/author´s team:  Together with Gunnar Schulte identification 
of CK1 as the kinase acting downstream of Wnt5a. Biochemical and functional 
validation of the significance. 
 
 
   
 
 
 
586 Research Article
Introduction
The Wnt signalling pathway is a highly conserved biochemical
pathway that is involved in a vast array of processes in both
embryonic development and adult tissue homeostasis (for
reviews, see Huelsken and Birchmeier, 2001; Patapoutian and
Reichardt, 2000; Yamaguchi, 2001). Moreover, key molecular
players of the Wnt pathway have been found to regulate
midbrain development (McMahon and Bradley, 1990; Pinson
et al., 2000; Thomas and Capecchi, 1990; Wang et al., 2002)
and various aspects of dopaminergic neuron (DN) development
(McMahon and Bradley, 1990; Pinson et al., 2000; Thomas and
Capecchi, 1990; Wang et al., 2002; Arenas, 2005; CasteloBranco
et al., 2003; Prakash et al., 2006).
We have shown that Wnt-5a – a non-canonical Wnt,
classified by its inability to activate ␤-catenin (Shimizu et al.,
1997) – plays a pivotal role in the ventral midbrain DN
differentiation (Castelo-Branco et al., 2006; Castelo-Branco et
al., 2003). To date, the underlying molecular mechanism of
action of Wnt-5a and the signalling pathways activated in DN
as well as in other mammalian cells is still largely unknown
(Veeman et al., 2003). Several molecular players have been
implicated, including the Wnt receptors of the Frizzled family
and the downstream signalling phosphoprotein Dishevelled
(Dvl) (Gonzalez-Sancho et al., 2004; Hsieh, 2004; Wallingford
and Habas, 2005; Wharton, Jr, 2003).
Here, we examined the mechanism through which Wnt-5a
activates Dvl in dopaminergic cells. We report the
identification of casein kinase 1 (CK1) ␦ and CK1⑀ (hereafter
referred to as CK1␦/⑀) as kinases phosphorylating Dvl2 and
Dvl3 in response to Wnt-5a. We show that Wnt-5a-induced
CK1⑀-mediated phosphorylation of Dvl2 results in changes of
the cytoplasmic distribution of Dvl2. Finally, we report that
activity of endogeneous CK1 is crucial for the prodifferentiation
function of Wnt-5a in dopaminergic precursors.
Thus, we hereby identify CK1 as a positive regulator of DN
development.
Results
Wnt-5a phosphorylates Dvl in a dopaminergic neuronal
cell line
To characterise the pathways activated by Wnt-5a in
dopaminergic cells, we treated SN4741 cells with Wnt-5a and
used Wnt-3a (a canonical Wnt) for comparison. Treatment with
either Wnt form (at 100 ng/ml) lead to the phosphorylation of
Dvl2 and Dvl3, as shown previously by a mobility shift of the
protein on SDS-PAGE (Gonzalez-Sancho et al., 2004; Lee et
al., 1999; Schulte et al., 2005; Bryja et al., 2007). Both Dvl2
and Dvl3 showed the first visible signs of phosphorylation at
30 minutes of treatment and a clear phosphorylation shift after
1 hour (Fig. 1A). Maximal effects were detected after 2 hours
and, hence, this time point was used subsequently unless
otherwise specified. Whereas both Wnt-3a and Wnt-5a induced
Dvl phosphorylation (Fig. 1A), only Wnt-3a induced ␤-catenin
activation (Fig. 1B), as assessed by an antibody recognizing
Previously, we have shown that Wnt-5a strongly regulates
dopaminergic neuron differentiation by inducing
phosphorylation of Dishevelled (Dvl). Here, we identify
additional components of the Wnt-5a-Dvl pathway in
dopaminergic cells. Using in vitro gain-of-function and
loss-of-function approaches, we reveal that casein kinase 1
(CK1) ␦ and CK1⑀ are crucial for Dvl phosphorylation by
non-canonical Wnts. We show that in response to Wnt-5a,
CK1⑀ binds Dvl and is subsequently phosphorylated.
Moreover, in response to Wnt-5a or CK1⑀, the distribution
of Dvl changed from punctate to an even appearance within
the cytoplasm. The opposite effect was induced by a CK1⑀
kinase-dead mutant or by CK1 inhibitors. As expected,
Wnt-5a blocked the Wnt-3a-induced activation of ␤catenin.
However, both Wnt-3a and Wnt-5a activated Dvl2
by a CK1-dependent mechanism in a cooperative manner.
Finally, we show that CK1 kinase activity is necessary for
Wnt-5a-induced differentiation of primary dopaminergic
precursors. Thus, our data identify CK1 as a component of
Wnt-5a-induced signalling machinery that regulates
dopaminergic differentiation, and suggest that CK1␦/⑀mediated
phosphorylation of Dvl is a common step in both
canonical and non-canonical Wnt signalling.
Key words: Casein kinase 1␦/⑀, Dishevelled, Wnt-5a, Dopaminergic
neurons, Non-canonical Wnt signalling, siRNA
Summary
Wnt-5a induces Dishevelled phosphorylation and
dopaminergic differentiation via a CK1-dependent
mechanism
Vítezslav Bryja*,‡
, Gunnar Schulte*,§
, Nina Rawal¶
, Alexandra Grahn¶
and Ernest Arenas§
Laboratory of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, S-171 77 Stockholm, Sweden
*,¶
These authors contributed equally to this work
‡
Present address: Laboratory of Cytokinetics, Institute of Biophysics AS CR, 61265, Brno, Czech Republic
§
Present address: Section of Receptor Biology and Signaling, Department of Physiology and Pharmacology, Karolinska Institutet, S-171 77 Stockholm, Sweden
§
Author for correspondence (e-mail: ernest.arenas@ki.se)
Accepted 1 December 2006
Journal of Cell Science 120, 586-595 Published by The Company of Biologists 2007
doi:10.1242/jcs.03368
JournalofCellScience
587CK1 mediates Wnt-5a action
active ␤-catenin (ABC, the form of ␤-catenin
dephosphorylated on Ser37 and Thr41) (van Noort et al.,
2002). To confirm that the observed signalling was specific to
Wnts, we treated SN4741 cells with the broad-spectrum
inhibitor of Wnt signalling, soluble Fz8-CRD (the cysteinerich
domain of Frizzled 8 that competes with Frizzled receptors
for Wnt binding) (Hsieh et al., 1999). Pre-treatment with Fz8CRD
blocked both basal and Wnt-induced Dvl
phosphorylation and ␤-catenin activation (Fig. 1C), indicating
that the effects observed were specifically induced by Wnts.
CK1␦/⑀ mediate Wnt-5a-induced phosphorylation of Dvl
A large number of kinases have been implicated in Wnt
signalling; however, it remains unclear which kinase(s) are
responsible for Dvl phosphorylation, leading to its
electrophoretic mobility shift after Wnt-5a stimulation. To
identify the relevant signalling pathways leading to the
phosphorylation-dependent mobility shift of Dvl, we analysed
a panel of small molecule compounds for their ability to block
or reduce the Wnt-5a-induced mobility shift of Dvl2 that takes
place after phosphorylation (Gonzalez-Sancho et al., 2004).
Twenty five pharmacological compounds interfering with
heterotrimeric G proteins, protein kinase C, protein kinase A,
MEK1/2, PI3K, p38, JNK, CamKII, GSK3, cAMP signalling,
EPAC, adenylyl cyclase, Src-like kinases, EGFR,
phospholipase C, CK1 or Ser/Thr kinases were tested (see
Table 1). Only D4476, an inhibitor of CK1 (Rena et al., 2004),
was able to block the Wnt-5a-induced phosphorylationdependent
mobility shift of Dvl2. Interestingly, D4476
reduced both basal and also Wnt-5a-induced phosphorylation
of Dvl2 and Dvl3 (Fig. 2A). It should be noticed that our
Fig. 1. Wnt-5a and Wnt-3a activate Dvl in dopaminergic cells.
(A) Time course of Wnt-5a- and Wnt-3a-induced activation of Dvl2
and Dvl3. SN4741 cells, treated with Wnt-3a (100 ng/ml) or Wnt-5a
(100 ng/ml), were lysed after 0, 1, 5, 10, 15, 30, 60 and 120 minutes.
(B) Both Wnt-5a and Wnt-3a activated Dvl2 and Dvl3, but only Wnt-
3a activated ␤-catenin after 2 hours of stimulation. (C) The effects of
Wnt-5a or Wnt-3a (100 ng/ml) on Dvl were blocked by Fz8-CRDconditioned
medium. (A-C) Phosphorylation of Dvl isoforms were
detected as phosphorylation-dependent mobility shifts of total Dvl2
and Dvl3. The position of dephosphorylated (᭣) and phosphorylated
Dvl (᭠) is indicated. The activation of ␤-catenin was determined by
western blotting using antibodies against active (Ser33-Thr41dephosphorylated)
␤-catenin (ABC). Data are representative of at
least three independent replicates.
Table 1. Screening of compounds for the ability to
interfere with the Wnt-induced shift of Dvl
Compound Target Concn Activity
PTX Gi/o 100 ng/ml No
PDBu PKC activator 1 ␮M No
Wortmannin PI3K 50 nM No
LY294002 PI3K 50 ␮M No
PD98059 MEK1/2 10 ␮M No
UO126 MEK1/2 10 ␮M No
SB203580 p38 10 ␮M No
JNKII inhib JNK 6 ␮M No
Genistein PKC 50 ␮M No
Chelerythrine PKC 10 ␮M No
Ro-31 8220 PKC 1 ␮M No
BIM I PKC 500 nM No
KN93 CaMKII 10 ␮M No
I3M GSK-3 2 ␮M No
Kenpaullone GSK-3 6 ␮M No
H89 PKA 10 ␮M No
8-Br-cAMP cAMP pathway activator 10 ␮M No
8CPT-2Me-cAMP EPAC activator 30 ␮M No
SQ22536 Adenylyl cyclase 100 ␮M No
MDL12330 Adenylyl cyclase 10 ␮M No
PP2 Src-like 10 ␮M No
AG1276 EGFR 10 ␮M No
ET-18-OCH3 PLC 10 ␮M No
D4476 Casein kinase 1 100 ␮M Yes
Staurosporine Ser/Thr kinases, PKC 2 ␮M No
Gi/o, heterometric G protein (inhibitory); PTX, pertussis toxin; PDBu,
phorboldibutyrate; PKC, Ca2+
-dependent protein kinase; PI3K,
phosphatidylinositol-3Ј-kinase; LY294002, 2-(4-morpholino)-8-phenyl-4H-1benzopyran-4-one;
PD98059, 2Ј-amino-3Ј-methoxyflavone; MEK1/2, MAPK
and ERK kinase1/2; UO126, 1,4-diamino-2,3-dicyano-1,4-bis(2aminophenylthio)-butadiene;
SB203580, 4-[5-(4-fluorophenyl)-2-[4(methylsulfonyl)phenyl]-1H-imidazol-4-yl]pyridine;
p38, stress-activated
protein kinase p38; JNK, c-jun N-terminal kinase; Ro-318220,
bisindolylmaleimide IX; BIM I, bisindolmaleimide I; KN93, 2-[N-(2-
hydroxyethyl)]-N-(4-methoxybenzenesulfonyl)]amino-N-(4-chlorocinnamyl)N-methylbenzylamine);
CaMKII, Ca2+
/calmodulin-dependent kinase II; I3M,
indirubin-3-monoxime; GSK-3, glycogen synthase kinase 3; H89, N-[2-(pbromocinnamylamino)ethyl]-5-isoquinolinesulfonamide;
PKA, cAMPdependent
protein kinase; 8-Br-cAMP, 8-bromo-cyclic AMP; 8CPT-2MecAMP,
8-(4-chloro-phenylthio)-2Ј-O-methyladenosine-3Ј,5Ј-cyclic
monophosphate; SQ22536, 9-(tetrahydro-2-furanyl)-9H-purin-6-amine;
MDL12330, cis-N-(2-phenylcyclopentyl)azacyclotridec-1-en-2-amine; PP2,
4-Amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine; AG1478,
4-(3-chloroanillino)-6,7-dimethoxyquinazoline; EGFR, epidermal growth
factor receptor; ET-18-OCH3, rac-2-methyl-1-octadecyl-glycero-(3)phosphocholine;
PLC, phospholipase C; D4476, 4-(4-(2,3-
dihydrobenzo[1,4]dioxin-6-yl)-5-pyridin-2-yl-1H-imidazol-2-yl)benzamide.
JournalofCellScience
588
results do not exclude the possibility that other
phosphorylation events exist that were not detected in the
mobility shift assay.
Journal of Cell Science 120 (4)
CK1 has previously been shown to be involved in various
steps of Wnt signal transduction (Davidson et al., 2005;
Kishida et al., 2001; Price, 2006; Zeng et al., 2005).
Importantly, CK1␣ was shown to phosphorylate ␤-catenin at
Ser45, priming ␤-catenin for subsequent phosphorylation by
GSK3␤ (Fig. 2B) (Amit et al., 2002; Liu et al., 2002;
Matsubayashi et al., 2004). By contrast, CK1␦ and CK1⑀ lack
the ability to phosphorylate ␤-catenin (Liu et al., 2002; Peters
et al., 1999), but are known to bind and phosphorylate Dvl in
the canonical Wnt signalling pathway (Cong et al., 2004;
Kishida et al., 2001; McKay et al., 2001a; Peters et al., 1999;
Swiatek et al., 2004). To test which CK1 subtype is inhibited
by D4476, we analysed the effect of D4476 on the level of
CK1␣-mediated phosphorylation of the Ser45 residue of ␤catenin.
As shown by phosphorylation-specific antibodies, the
phosphorylation of ␤-catenin at Ser45 was not affected by
Wnt-5a but was significantly decreased following the
application of D4476 (Fig. 2A), suggesting that CK1␣ can be
inhibited by D4476. To elucidate which CK1 isoforms are
responsible for Dvl2 phosphorylation, we used the more
specific CK1 inhibitor IC261. IC261 has previously been
reported to efficiently inhibit CK1␦/⑀ at low micromolar doses
(in vitro IC50=1 ␮M) but not CK1␣ (in vitro IC50=16 ␮M)
(Mashhoon et al., 2000). Despite being less efficient than
D4476, IC261 (10 ␮M) inhibited Wnt-5a-induced Dvl2
phosphorylation (Fig. 2C). However, in contrast to D4476,
IC261 did not reduce the levels of ␤-catenin phosphorylated at
Ser45, indicating that CK1␦/⑀, but not CK1␣, kinase activity
was inhibited. The levels of active ␤-catenin, as well as total
␤-catenin levels, were unchanged by Wnt-5a, D4476 or IC261
treatment (Fig. 2A). These experiments suggested that CK1␦/⑀,
rather than CK1␣, phosphorylate Dvl2 and Dvl3 in response
to Wnt-5a.
To confirm that CK1⑀ phosphorylates Dvl2, gain-of- and
loss-of-function experiments were performed in SN4741 cells
transiently transfected with plasmids encoding Dvl2-Myc (Lee
et al., 1999), CK1⑀ or the CK1⑀ (K>R) mutant (a kinase-dead
form of CK1⑀) (Fish et al., 1995). We found that CK1⑀, but
not CK1⑀ (K>R), phosphorylated Dvl2-Myc (Fig. 2D). Similar
data were obtained with Dvl2-GFP (not shown), demonstrating
that the kinase activity of CK1⑀ is required for Dvl2
phosphorylation in the overexpression system.
To analyse the role of endogenous CK1 in the Wnt-5ainduced
phosphorylation of Dvl2, we performed gene
knockdown of CK1␣, CK1␦ and CK1⑀ using small interfering
RNAs (siRNA). Three independent siRNAs, each designed
against the various CK1 isoforms, were tested for their
efficiency in silencing endogenous CK1 in SN4741 cells.
Efficiency of gene knockdown was analysed by western
blotting for CK1⑀ (Fig. 3A) and by quantitative reverse
transcriptase (RT)-PCR for CK1␣ and CK1␦ (not shown),
where subtype-specific antibodies failed to detect endogenous
CK1␣ and CK1␦. At least one siRNA against each CK1
isoform provided a strong gene knockdown of more than 50%,
as assessed by western blotting (CK1⑀, Fig. 3A) and
quantitative RT-PCR for CK1␦ and CK1␣ (data not shown).
The most efficient siRNAs – CK1␣III, CK1␦III and/or CK1⑀II
were then transfected into SN4741 that were stimulated with
increasing doses of Wnt-5a. The compound knockdown of
CK1␦ and CK1⑀ resulted in a significant reduction of the Wnt-
5a-induced phosphorylation of Dvl2, whereas the CK1␣
Fig. 2. CK1 inhibition blocks Wnt-5a-induced phosphorylation of
Dvl2 and Dvl3. SN4741 cells were treated with vehicle (control) or
Wnt-5a (100 ng/ml) for 2 hours in the presence or absence of D4476
(100 ␮M) (A) or IC261 (10 ␮M) (C). Western blot analysis was
performed as in Fig. 1. The position of dephosphorylated (᭣) and
phosphorylated (᭠) Dvl is indicated. Antibodies against phosphoSer45-␤-catenin
(CK1␣ target site), against active (Ser37-Thr41dephosphorylated)
␤-catenin (ABC) and total ␤-catenin were used.
(B) Scheme of phosphorylation sites of ␤-catenin. Ser45 is a CK1␣
target site, which serves as a priming for sequential phosphorylation
of Thr41, Ser37 and Ser33 by GSK3␤. (D) SN4741 cells were
transfected with plasmids encoding Dvl2-Myc and either CK1⑀ or
kinase-dead CK1⑀ (K>R) mutant. Phosphorylation of Dvl2-Myc was
detected as a phosphorylation-dependent mobility shift by Myc- and
Dvl2-specific antibodies. CK1⑀ levels were monitored with a CK1⑀
specific antibody. Data in A, C and D are representative of at least
three independent replicates.
JournalofCellScience
589CK1 mediates Wnt-5a action
siRNA had no effect compared with control (Fig. 3B).
Although one cannot exclude the possibility that lack of the
effect of CK1␣ siRNA was due to incomplete knockdown, our
data suggest that CK1␦/⑀, rather than CK1␣, are responsible
for Wnt-5a-mediated phosphorylation of Dvl2. Interestingly,
knockdown of CK1⑀ alone, or together with less efficient CK1
(␦I and ␦II) siRNAs, was not sufficient to reduce the effects of
Wnt-5a on Dvl2 (not shown), suggesting that CK1␦ and CK1⑀
are to some extent redundant in their function. To confirm that
CK1␦III does not act by an off-target mechanism but rather that
a joint knockdown of CK1␦ and CK1⑀ is necessary, we treated
SN4741 cells with control RNA, CK1␦III or CK1⑀II, or the
combination of the siRNAs. As we show in Fig. 3C, CK1␦III
or CK1⑀II alone were not able to block Wnt-5a-mediated
phosphorylation of Dvl, whereas their combination blocked
phosphorylation of endogenous Dvl2 very efficiently. Taken
together, these experiments demonstrate that CK1␦ and CK1⑀,
rather than CK1␣, phosphorylate Dvl2 in response to Wnt-5a.
Wnt-5a induces the activation of endogenous CK1⑀
kinase that interacts with Dvl2
To examine whether Wnt-5a induces the kinase activity of
endogenous CK1⑀, we tested and confirmed that CK1⑀ can be
immunoprecipitated in SN4741 cells (Fig. 4A). Using myelin
basic protein (MBP, a general substrate of Ser/Thr kinases) as
a substrate in an in vitro CK1⑀ kinase assay, we found that
treatment of SN4741 cells with either Wnt-5a or Wnt-3a
clearly upregulates CK1⑀ activity (Fig. 4B), which is an effect
previously shown only for canonical Wnts (Swiatek et al.,
2004). This demonstrates that Wnt-5a, as well as Wnt-3a,
activates endogenous CK1⑀ in dopaminergic SN4741 cells.
Additionally, we examined whether Dvl2 and CK1⑀ physically
interact in SN4741 cells, as it has been shown previously in
other cellular models (Peters et al., 1999; Sakanaka et al.,
1999), and found that Dvl2-Myc binds both overexpressed
CK1⑀ (Fig. 4C, lane 2) and endogenous CK1⑀ (Fig. 4D). Please
notice that endogenous CK1⑀ was only clearly detected when
beads coupled to antibody where used to enhance the signal
above background. Importantly, the lack of kinase activity in
CK1⑀ (K>R) does not prevent the interaction with Dvl2 (Fig.
4C, lane 3). These results suggest that the kinase activity of
CK1⑀ is not needed for binding to Dvl2, but it is required for
the phosphorylation of Dvl2.
CK1⑀ and Wnt-5a change the subcellular localization of
Dvl2
The subcellular distribution of Dvl was examined after
transfection of SN4741 cells with a Dvl2-Myc plasmid. Dvl2Myc
was detected by immunocytochemistry in the cytoplasm
and found either in a diffuse and even pattern, or in punctae
that represent large multiprotein complexes (Schwarz-Romond
et al., 2005; Smalley et al., 2005). Based on the presence of
Dvl2-Myc punctae and their size, cells were sorted into four
different categories (Fig. 5A): (1) even distribution (no punctae
detected), (2) punctae of small size (small dot-like punctae on
the background of still detectable even cytoplasmic staining),
(3) punctae of intermediate size (distinct punctae strongly
contrasting with the negative staining of the remaining
cytoplasm) or, (4) punctae of large size (individual punctae
already fused that form large doughnut-like structures).
Interestingly, the distribution of Dvl2-Myc was dramatically
regulated by transfection of the CK1⑀ constructs (Fig. 5B).
Both CK1⑀ and CK1⑀ (K>R) showed a homogeneous
cytoplasmatic distribution when transfected alone and stained
with an anti-CK1⑀-specific antibody (not shown). Upon
coexpression of CK1⑀ with Dvl2-Myc, the distribution of
Dvl2-Myc changed from punctate 70% in the control to an
even distribution in 65% of the cells (Fig. 5B,C); a finding
similar to what has previously been shown in HEK293 cells
(Cong et al., 2004). Conversely, CK1⑀ (K>R) promoted the
punctate localization of Dvl2-Myc in 95% of the cells by
predominantly increasing intermediate puncta (Fig. 5B,C). In
all cases, we found that CK1⑀ (wt or K>R) colocalises with
Dvl2-Myc, suggesting that CK1⑀ controls the distribution of
Dvl.
Fig. 3. Gene knockdown of CK1␦/⑀ reduces the phosphorylation of
Dvl2 induced by Wnt-5a. (A) SN4741 cells were transfected with
control siRNA and three independent siRNAs against CK1⑀ isoform.
The efficiency of gene knockdown induced by individual siRNAs
against CK1⑀ was quantified in western blots. A non-specific protein,
resulting in a band recognised by anti-CK1⑀ antibody served as a
loading control. Quantification (normalised to loading control) is
shown below. (B,C) SN4741 cells were transfected with the indicated
combinations of siRNAs, and treated with control, 50 and 100 ng/ml
of Wnt-5a. The phosphorylation of Dvl isoforms was detected as
phosphorylation-dependent mobility shift of total Dvl2. Data are
representative of three (B) or two (C) independent experiments. The
position of dephosphorylated (᭣) and phosphorylated Dvl (᭠) is
indicated. The levels of CK1⑀ and ␤-actin were also determined to
confirm the efficient gene knockout and the equal protein loading.
JournalofCellScience
590 Journal of Cell Science 120 (4)
When the CK1 inhibitor D4476 was added after
transfection, it significantly reduced CK1⑀-mediated
phosphorylation of Dvl2-Myc (Fig. 5D, lanes 6, 8 and 10)
confirming that this CK1 inhibitor specifically blocks the
action of CK1⑀ on Dvl2 in a dose-dependent manner.
Interestingly, when the cells were transfected with Dvl2-Myc
alone and treated with the CK1 inhibitor D4476, Dvl2-Myc
phosphorylation was prevented (Fig. 5D, lane 4) and the
localization of Dvl2-Myc changed from an even distribution
in 50% of the cells to a punctate pattern in 85% of the cells
(Fig. 5E). Similar results were obtained using the CK1␦/⑀specific
inhibitor IC261 (Fig. 5F). To directly test whether
activation of endogenous CK1␦/⑀ by Wnt-5a resulted in a
relocalization of Dvl2-Myc similar to the one induced by
overexpressed CK1, we treated Dvl2-Myc-overexpressing
SN4741 cells with Wnt-5a. Wnt-5a treatment resulted in a
statistically significant increase in the number of cells with
even distribution of Dvl2-Myc at the expense of the cells with
Dvl2-Myc in punctae (Fig. 5G). When using 100 ng/ml of
Wnt-3a and an identical experimental setup as for Wnt-5a, we
failed to detect similar changes in cytoplasmic distribution of
Dvl2-Myc induced by Wnt-3a (not shown), suggesting that
Wnt-induced relocalization of Dvl is an effect specific for
non-canonical Wnts. In summary, these results demonstrate
that Wnt-5a has an effect similar to that of CK1⑀ and suggest
that endogenous CK1␦/⑀ regulate the phosphorylation and
cellular localization of Dvl2 in response to Wnt-5a.
Combined, our results indicate that active CK1⑀, either
overexpressed or endogenous (activated by Wnt-5a),
phosphorylates Dvl2 and induces a diffuse cytoplasmic
distribution of phosphorylated Dvl2 that can be blocked by
either CK1 inhibition or the kinase-dead CK1⑀ (K>R).
Wnt-5a cooperates with Wnt-3a in the phosphorylation
of Dvl, but antagonises Wnt-3a in the activation of ␤-
catenin
Given that D4476 is a reversible competitive inhibitor of the
ATP binding site in CK1, we examined whether the inhibition
of Dvl2 phosphorylation by D4476 is modulated by increasing
doses of Wnt-5a. Increased amounts of Wnt-5a dose
dependently overcame the D4476-mediated inhibition and lead
to a phosphorylation-dependent mobility shift of Dvl2 (Fig.
6A). We next explored whether Wnt-5a and Wnt-3a
phosphorylates Dvl by similar mechanisms and, if so, whether
their effects are additive. SN4741 cells were pre-treated with
Wnt-5a (100 ng/ml) or Wnt-3a (20 ng/ml), the lowest doses
leading to the efficient phosphorylation of Dvl2 and Dvl3 (data
not shown); then, increasing doses of Wnt-3a (50, 100 and 200
ng/ml) or Wnt-5a (100, 200 and 500 ng/ml) were applied. The
results showed that both Wnt-3a and Wnt-5a activate Dvl
phosphorylation (Fig. 5B and C, respectively). Moreover, Wnt-
3a and Wnt-5a cooperated in the phosphorylation of Dvl in the
absence of D4476 (as monitored by the disappearance of the
non-shifted band of Dvl2). When the additive effects of Wnts
were tested in the presence of D4476, Wnt-3a rescued the
D4476-mediated block of Wnt-5a-induced phosphorylation of
Dvl2 and vice versa (Fig. 6C,D). Not surprisingly, active ␤catenin
was induced when Wnt-3a was added to Wnt-5a pretreated
cells (Fig. 6B,D). By contrast, when Wnt-5a was added
to cells pre-treated with Wnt-3a, it significantly and dose
dependently reduced the activation of ␤-catenin, irrespective of
Fig. 4. CK1⑀ is activated by Wnt-5a and binds Dvl2 in
dopaminergic cells. (A) SN4741 cell lysates were
immunoprecipitated with a control IgG or a CK1⑀-specific antibody
and endogenous or overexpressed CK1⑀ and detected by western
blotting. (B) Wnt-3a and Wnt-5a increased the phosphorylation of
MBP as detected by western blotting using a specific antibody
against phosphorylated serine. Cell lysates from control (1%
CHAPS), Wnt-3a or Wnt-5a treated (100 ng/ml) SN4741 cells were
immunoprecipitated with a CK1⑀-specific antibody and subjected to
kinase assay using MBP as a substrate. (C) Dvl2-Myc interacts with
either CK1⑀ (lane 2) or a kinase-dead CK1⑀ (K>R) (lane 3) mutant
in SN4741 cells, as assessed by immunoprecipitation and western
blotting with Myc- and CK1⑀-specific antibodies. Co-precipiated
CK1⑀ by the Myc antibody is indicated by ᭣. For all other panels:
᭠, phosphorylated Dvl2-Myc; ᭣, unphosphorylated Dvl2-Myc.
(D) Dvl2-Myc interacts with endogenous CK1⑀ as assessed by
immunoprecipitation of SN4741 cells transfected with Dvl2-Myc
only, by using Myc antibody-conjugated agarose beads (control, Gprotein-conjugated
beads). Data are representative of three
independent replicates.
JournalofCellScience
591CK1 mediates Wnt-5a action
the presence of D4476 (Fig. 6D,E). Combined, these data
suggests that Wnt-3a and Wnt-5a phosphorylate Dvl in
SN4741 cells by a similar or even identical mechanism
involving the activation of CK1␦/⑀. Moreover, we show that,
although Wnt-3a and Wnt-5a cooperate in the phosphorylation
of Dvl, Wnt-5a can antagonise Wnt-3a-mediated induction of
␤-catenin. These results suggest that phosphorylated Dvl
serves different functions when recruited to pathways activated
by Wnt-3a or Wnt-5a.
CK1 inhibitors block the biological effects of Wnt-5a on
dopaminergic precursors
To determine whether CK1 is also part of the signalling
machinery mediating the pro-differentiation activity of Wnt-
5a on dopaminergic precursors (Castelo-Branco et al., 2003;
Schulte et al., 2005), we analysed the consequences of CK1
inhibition in rat embryonic day14.5 (E14.5) primary ventral
midbrain precursor cultures. Cells were treated with Wnt-5a
(100 ng/ml) with or without increasing concentrations of
D4476. D4476 had no effect on the total cell number (not
shown) and, in agreement with our previous results (Schulte
et al., 2005), the number of tyrosine-hydroxylase-positive
(TH+
) cells per field increased after Wnt-5a treatment.
Importantly, we found that this effect was reduced in a dosedependent
manner upon addition of D4476 (Fig. 7). Thus, our
results suggest that CK1 activity is necessary for the biological
effects of Wnt-5a on primary dopaminergic cells.
Discussion
We have previously shown that Wnt-5a induces the
differentiation of dopaminergic progenitors (Castelo-Branco et
al., 2003; Schulte et al., 2005). This present study identifies
another component mediating the function of Wnt-5a in DA
neurons (DN) development. After testing a panel of smallmolecule
drugs and performing loss-of-function (CK1␦/⑀specific
inhibitors and siRNA) as well as gain-of-function
experiments, we identified CK1␦/⑀ as the relevant kinases
hyperphosphorylating Dvl in response to Wnt-5a. Our findings
place CK1␦/⑀ in a signalling pathway activated by a noncanonical
Wnt and show for the first time that CK1 activity is
Fig. 5. CK1⑀ and Wnt-5a mediate the
changes in phosphorylation and
cytoplasmic distribution of Dvl2.
(A) The subcellular distribution of
Dvl2-Myc in transfected SN4741
cells was assessed through an antiMyc
antibody by confocal
microscopy. Four patterns were
detected: (1) even distribution, and
punctae of (2) small, (3) intermediate
or, (4), large size. For a detailed
description see the results section.
(B) Co-transfection of Dvl2-Myc and
CK1⑀ or the kinase-dead CK1⑀ (K>R)
mutant resulted in a predominant even
or punctate distribution of Dvl2-Myc,
respectively. The arrow points to a
cell transfected with Dvl2-Myc (Cy3,
red) with no or low levels of
exogenous CK1⑀ (Cy2, green),
serving as an internal control of the
experiment. (C) Quantification of
changes in the intracellular
localization of Dvl2-Myc upon
coexpression of CK1⑀ or CK1⑀
(K>R) as described in A and B.
(D) D4476 (100 ␮M) blocks the
phosphorylation dependent shift of
Dvl2-Myc induced by different
amounts (ng/well) of transfected
CK1⑀ in SN4741 cells. The position
of dephosphorylated (᭣) and
phosphorylated (᭠) Dvl2 is indicated.
Data are representative of at least
three independent replicates.
(E-G) SN4741 cells were transfected
with Dvl2-Myc and treated as
indicated: (E) The general CK1
inhibitor D4476 (100 ␮M) and (F) the
CK1␦/⑀-specific inhibitor IC261 (20
␮M) changed the subcellular localization of Dvl2-Myc to a predominant punctate distribution. This is in contrast with Wnt-5a treatment (100
ng/ml) (G), which leads to a more even distribution of Dvl2-Myc than in control. Data in C,E,F,G (nу3) were statistically evaluated, Data
represent the mean ± s.d., one-way ANOVA with Bonferroni post-tests (*P<0.05, **P<0.01, ***P<0.001).
JournalofCellScience
592
required for a biological process induced by a non-canonical
Wnt.
CK1␦/⑀ have previously been reported to be a DvlJournal
of Cell Science 120 (4)
phosphorylating kinase acting in the ␤-catenin pathway (Gao
et al., 2002; Kishida et al., 2001; McKay et al., 2001a; Peters
et al., 1999; Swiatek et al., 2004). A recent report (Cong et al.,
2004) describes that overexpression of CK1⑀ potentiates
canonical Wnt signalling and diminishes JNK activation
induced by Dvl1 overexpression. This finding led to the
suggestion that CK1⑀ modulates the signalling specificity of
Dvl towards ␤-catenin (Cong et al., 2004). Here, we report that
CK1␦/⑀ also mediate non-canonical signalling, suggesting that
canonical or non-canonical specificities are not determined by
CK1⑀ but rather by the ligand. Moreover, the findings reported
by Cong et al. could be alternatively explained by the fact that
CK1⑀-mediated phosphorylation diminishes the activity of
axin in the MEKK1-JNK pathway at the expense of its function
in canonical Wnt signalling (Zhang et al., 2002). Although the
involvement of CK1␦/⑀ in the signal transduction of a noncanonical
Wnt has not been demonstrated to date, a role of
CK1␦/⑀ in other biological processes driven by non-canonical
Wnts has been described. These include convergent extension
movements in Xenopus (McKay et al., 2001b) and functions
regulated by planar cell polarity pathway in Drosophila (Klein
et al., 2006; Strutt et al., 2006). Thus, our data, together with
published reports, support the notion that CK1⑀ mediates noncanonical
Wnt signalling. Interestingly, a recent report by
Fig. 6. Wnt-5a cooperates with Wnt-3a in the phosphorylation of
Dvl2, but inhibits Wnt-3a-induced activation of ␤-catenin.
(A) Increasing doses of Wnt-5a (50, 100, 300, 500, 1000 ng/ml)
increase Dvl2 phosphorylation in vehicle (DMSO)-treated SN4741
cells and compete in the blockade of CK1 by D4476. (B-E) SN4741
cells were pretreated with 100 ng/ml of Wnt-5a (B,D) or 20 ng/ml of
Wnt-3a (C,E) in the presence (D,E) or absence (B,C) of D4476 (100
␮M) for 5 minutes. Subsequently, Wnt-3a (50, 100 and 200 ng/ml) or
Wnt-5a (100, 200 and 500 ng/ml), was added for 2 hours. In A-E the
phosphorylation of Dvl2 was detected by western blotting as
phosphorylation-dependent mobility shift (dephosphorylated, ᭣ ;
phosphorylated, ᭠). In B-E the activation of ␤-catenin (ABC) was
determined using an antibody against Ser33/37-dephosphorylated ␤catenin.
Results shown in B-E were quantified using densitometry
and either normalised to untreated control for ABC or shown as a
ratio of phosphorylated:dephosphorylated for Dvl2. Duplicate
experiments showed comparable results.
Fig. 7. CK1 inhibitors block the effects of Wnt-5a on dopaminergic
differentiation. (A) Wnt-5a (100 ng/ml) increased the number of
tyrosine-hydroxylase-positive (TH+
) neurons in rat E14.5 ventral
midbrain precursor cultures. However, addition of increasing doses
of the chemical inhibitor of CK1 (D4476) reduced the numbers of
TH+
neurons. (B) Double TH-Hoechst33258 immunostaining shows
an increase in the number of TH immunoreactive neurons after
treatment with Wnt-5a (100 ng/ml). Addition of 25 ␮M D4476 to
Wnt-5a-treated cultures decreases the number of TH+
neurons after 3
days. Bar, 25 ␮m.
JournalofCellScience
593CK1 mediates Wnt-5a action
Takada et al. suggests that, in Drosophila cells another CK1
isoform, CK1␣ is playing a similar role to the one described
here for CK1␦/⑀ in Wnt-5a-driven phosphorylation of Dvl
(Takada et al., 2005). Thus, it remains to be investigated
whether the involvement of individual CK1 isoforms in Dvl
phosphorylation differs among species.
Our results clearly show that both canonical Wnt-3a and
non-canonical Wnt-5a induce the phosphorylation of Dvl by a
common mechanism, involving the activation of CK1␦/⑀. This
conclusion is based on the following lines of evidence: (1) the
position of hyperphosphorylated Dvl bands in Wnt-3a- and
Wnt-5a-treated samples is indistinguishable; (2) the time
course of Dvl phosphorylation is identical when induced by
either Wnt-3a or Wnt-5a; (3) the phosphorylation of Dvl by
both Wnt-5a (this study) and Wnt-3a (Bryja et al., 2007) can
be blocked by CK1␦/⑀ siRNAs; (4) both Wnt-3a- and Wnt-5ainduced
phosphorylation of Dvl is CK1 inhibition sensitive; (5)
the block of Wnt-3a-induced phosphorylation of Dvl by CK1
inhibitors can be rescued by Wnt-5a and vice versa; and (6)
both Wnt-5a and Wnt-3a directly induce activation of CK1⑀
kinase. Thus, our results comply with the possibility that Wnt-
3a- and Wnt-5a-induced Dvl phosphorylation are mediated by
activation of similar or identical signalling complex(es)
including CK1␦/⑀. The CK1␦/⑀-mediated phosphorylation of
Dvl is necessary for Dvl to interact with other pathway specific
components – as demonstrated for the interaction of Dvl with
Frat-1 in the canonical Wnt signalling (Hino et al., 2003). This
view is supported by our findings, demonstrating the effects of
Wnt-5a and CK1⑀ on the localization of Dvl2. On the basis of
previous studies (Schwarz-Romond et al., 2005; Smalley et al.,
2005) one can expect that Dvl2 puncta are formed
predominantly by Dvl multimers. The ability of Wnt-5a and
CK1⑀ to promote a more even localization or, in other words,
to dissolve the puncta may then reflect a decrease in affinity of
Dvl-Dvl interaction (Angers et al., 2006) following CK1␦/⑀mediated
phosphorylation of Dvl. Such release of monomeric
Dvl from Dvl aggregates might be a necessary step for the
interaction of phosphorylated Dvl with other downstream
components of Wnt pathway(s).
It is important to notice that, although Wnt-3a and Wnt-5a
cooperate in Dvl phosphorylation, Wnt-5a diminished Wnt-3ainduced
activation of ␤-catenin. Previously, Wnt-5a has been
shown to antagonise canonical signalling and different
mechanisms were implicated in this process (Maye et al., 2004;
Topol et al., 2003; Weidinger and Moon, 2003; Westfall et al.,
2003). Our data support this concept but leave the question
open of how the signal is redirected from Dvl to the final
targets of canonical and non-canonical Wnt signalling
pathways. It has been suggested that specific co-receptors play
a role in directing the signals into different pathways and our
data, demonstrating common signalling unit of canonical and
non-canonical Wnt signalling, are well compatible with the
crucial role of co-receptors (schematised in Fig. 8). In addition
to their common cognate receptors of the Frizzled family,
canonical Wnts bind to low-density lipoprotein receptor
(LDLR)-related protein 5/6 (Lrp5/6) (Liu et al., 2003; Tamai
et al., 2000), whereas non-canonical Wnts interact with the
atypical receptor kinase Ror2 (Hikasa et al., 2002; Oishi et al.,
2003) or membrane proteoglycan Knypek (Topczewski et al.,
2001). A very recent report, showing that a Wnt-5a-Dkk2 CRD
fusion can bind Lrp5/6 and activate canonical signalling (Liu
et al., 2005), strongly supports a key role of co-receptors in
directing canonical versus non-canonical Wnt-signalling.
Our results in primary precursor cultures further confirm the
importance of CK1 activity for the biological effects of noncanonical
Wnts. We demonstrate that CK1 activity is required
for the effect of Wnt-5a on the differentiation of dopaminergic
precursors into DNs. Thus, our findings argue that CK1 is an
essential component of the Wnt-5a-induced signalling pathway
not only in a suitable cell line but also in a more complex and
biologically relevant system. This finding might also have
implications in other areas of biology, such as tumour biology.
Wnt-5a is known as a factor promoting cell migration,
epithelial mesenchymal transition and increased cancer
invasiveness (Taki et al., 2003; Weeraratna et al., 2002). Our
findings, linking Wnt-5a to activation of CK1␦/⑀ and showing
that CK1␦/⑀ mediate the effects of Wnt-5a, correlate well with
the emerging role of CK1␦/⑀ in tumour development (for a
review, see Knippschild et al., 2005). The generation and
analysis of CK1␦- and/or CK1⑀-deficient mice will certainly
help to define how widespread the involvement of CK1␦/⑀ is
in vertebrate non-canonical Wnt-signalling.
Materials and Methods
Cell culture and transfection
SN4741 cells were generously provided by J. H. Son (Son et al., 1999) and grown
in DMEM, 10% FCS, L-glutamine (2 mM), penicillin (50 U/ml), streptomycin (50
U/ml), glucose (0.6%) (all purchased from Invitrogen). For transfections, 40,000-
60,000 cells/well were seeded in 24-well plates and grown overnight. Cells were
transfected under serum-free conditions using Lipofectamine 2000 (Invitrogen)
Wnt-5aWnt-3a
Dvl
CK1δ/ε
Lrp5/6
?
P
P
P
DvlCK1δ/ε
P
P
P
non-canonical
signalling
3a
5a
β-catenin
canonical
signaling
Fig. 8. Schematic model illustrating the role of CK1␦/⑀ in the
activation of Dvl by Wnt-3a and Wnt-5a. Both Wnt-3a and Wnt-5a
bind Frizzled that by unknown mechanism activates CK1␦/⑀, which
in turn phosphorylates Dvl. The interaction of Dvl with additional
pathway-specific signalling components (including co-receptors),
would direct downstream signalling. In case of Wnt-3a the coreceptor
might be Lrp5/6, whereas Ror2 or Knypek might be the coreceptors
for Wnt-5a. This model predicts that, when both Wnt-3a
and Wnt-5a are present, Frizzled and phosphorylated Dvl will
compete for binding and activation of additional signalling
components. The prevalent signalling direction would thus be
determined by the recruitment of the additional signalling units by
phosphorylated Dvl.
JournalofCellScience
594
according to manufacturer’s instructions. In total, 1 ␮g of DNA encoding Dvl2Myc,
CK1⑀ or CK1⑀ (K>R), or their combinations, and 2 ␮l of Lipofectamine 2000
were used per well. Medium was changed 4 hours post transfection and cells were
grown in complete culture medium for another 24 hours prior to analysis by western
blot or immunocytochemistry.
Cell treatments
For analysis of intracellular signalling, 40,000 cells/well were seeded in 24-well
plates, grown overnight without serum and subsequently stimulated with
recombinant mouse Wnt-3a or Wnt-5a (R&D Systems) for 2 hours. Control
stimulations were done with equivalent volumes of 0.1% BSA-1% CHAPS-PBS.
To screen for compounds that reduce Dvl-mobility, the cells were treated with the
various chemical inhibitors (Table 1) for 15 minutes and subsequently stimulated
with Wnt. (Note: PTX and PDBu, were added overnight as a pre-stimulus.)
Appropriate solvent was used as a control. All compounds were tested in duplicate.
The cells were also exposed to FuGENE 6 transfection reagent (Roche, 1 ␮l
FuGENE per 200 ␮l of culture media) to enhance the penetration of poorly cellpermeable
compounds (D4476 and IC261) into SN4741 cells. Control (DMSOtreated)
and experimental conditions were both treated with FUGENE. PTX, PDBu,
wortmannin, genistein, chelerythrin, BIM I, SQ22536, MDL12330, AG1278, ET-
18-OCH3 and staurosporine were purchased from Sigma; LY294002 and SB203580
from Tocris; PD98059 and UO126 from Cell Signaling Technology; Ro-31 8220,
H89, 8-Br-cAMP, PP2, D4476 and IC261 from Calbiochem and KN93, I3M and
kenpaullone from Alexis Biotechnology. 8CPT-2Me-cAMP was a kind gift from J.
L. Bos (University of Utrecht, Netherlands).
Precursor cultures
Embryonic day 14.5 (E14.5) ventral mesencephala obtained from time-mated
Sprague-Dawley rats (ethical approval for animal experimentation was granted by
Stockholm Norra Djurförsöks Etiska Nämnd) were dissected, mechanically
dissociated and plated on plates coated with poly-D-lysine (10 ␮M) at a final density
of 1ϫ105
cells/cm2
. Serum-free N2 medium was added, consisting of a mixture of
F12 and MEM with N2 supplement, 15 mM HEPES buffer, 1 mM glutamine, 5
mg/ml Albumax (all purchased from Invitrogen) and 6 mg/ml glucose (Sigma).
Recombinant Wnt-5a and D4476 (Calbiochem) were added and the cells were
cultured for 3 days in a 37°C, 5% CO2 incubator. Cells were fixed for
immuncytochemistry in ice-cold 4% paraformaldehyde for 15-20 minutes and
washed in PBS. The following primary and secondary antibodies were used: rabbit
anti-tyrosine hydroxylase specific antibody (1:100 dilution, Pel-Freez Biologicals)
and rhodamine-coupled goat anti-rabbit IgG (1:200; Jackson Laboratories). Cultures
were subsequently incubated with Hoechst 33258 reagent for 10 minutes. Images
were acquired from stained cells using a Zeiss Axioplan 100M microscope (LD
Achroplan 40ϫ, 0.60 Korr PH2 8 0-2) and collected with a Hamamatsu camera
C4742-95 (with QED imaging software). TH-immunoreactive cells from two
independent experiments, three wells per condition, nine non-overlapping fields per
well were counted independently by two researchers. The numbers of TH+
cells
represent the mean values ± s.d. and are expressed as percentage change compared
with control.
Western blotting
Western blot analysis and protein samples were prepared as described previously
(Bryja et al., 2004). The antibodies used were: anti-Dvl2 (sc-13974), anti-Dvl3 (sc-
8027) and anti-c-Myc (sc-40) (Santa Cruz Biotechnology); anti-␤-catenin (BD
Bioscences); anti-active-␤-catenin (anti-ABC, Upstate Biotechnology); antiphospho-␤-catenin
(S45, Biosource) anti-phospho-serin (AB1603, Chemicon
International) and anti-MBP (Dako).
Immunoprecipitation and kinase assay
For kinase assays, total protein from the cells (cultured in 10-cm dishes) was
extracted and processed using Protein G Sepharose fast-flow beads (Amersham
Biosciences) as described previously (Bryja et al., 2005). Rabbit polyclonal
antibody against Myc (sc-789), mouse agarose-conjugated antibody against Myc
(sc-40 AC) and goat polyclonal antibody against CK1⑀ (sc-6471) were used in the
immunoprecipitation studies (Santa Cruz Biotechnology). CK1⑀ kinase reactions
were carried out for 15 minutes at room temperature in a 40-␮l volume of kinaseassay
buffer (50 mM HEPES pH 7.5, 10 mM MgCl2, 10 mM MnCl2, 20 mM ␤glycerolphosphate,
5 mM NaF) supplemented with 100 ␮g/ml MBP (M1831,
Sigma) and 100 ␮M ATP. Reactions were terminated by addition of 5ϫ Laemmli
sample buffer. Each reaction mix was then subjected to SDS-PAGE.
RNA interference and quantitative RT-PCR
SN4741 cells were transfected with siRNA using neofection according to
manufacturer’s instructions (Ambion). In brief, siRNAs (0.75 ␮l of 20 ␮M siRNA)
were mixed with Lipofectamine 2000 (2 ␮l; Invitrogen) and OptiMEM (47.25 ␮l;
Gibco) and incubated for 20 minutes at room temperature. The transfection mixture
(50 ␮l) was added to the 24-well plate and mixed with a suspension of freshly
trypsinised SN4741 cells (25,000 cells/well in 500 ␮l of complete media) resulting
in the final concentration of 30 nM siRNA. When a combination of two different
Journal of Cell Science 120 (4)
siRNAs was used, each siRNA was used at 30 nM and the control siRNA at 60 nM.
The transfection was terminated after 5 hours by changing culture media. At 48
hours post transfection, cells were stimulated with Wnt-5a and collected for further
analyses. siRNAs against individual isoforms of mouse CK1 were purchased from
Ambion; CK1␣ (I, cat. no. 176063; II, cat. no. 176062; III, cat. no. 176061), CK1␦
(I, cat. no. 88202; II, cat. no. 88309; III, cat. no. 88298) and CK1⑀ (I, cat. no.188527;
II, cat. no. 188528, III , cat. no. 188529). Silencer®
Negative Control siRNA (cat.
no. 4635, Ambion) was used as a negative control. The efficiency of the silencing
was assessed by western blotting or real time RT-PCR. Quantitative RT-PCR was
performed as described previously (Castelo-Branco et al., 2006) The following
primers were used (DNA Technology A/S, Aarhus, Denmark): CK1␣for 5ЈTTTGAGGAAGCTCCGGATTACAT-3Ј,
CK1␣rev 5Ј-TCGTCCAATCAAACGTGTAGTCAT-3´,
CK1␦for 5Ј-ACATCTATCTCGGTACGGACATTG-3Ј, CK1␦rev 5Ј-
GAGGATGTTTGGTTTTGACACATTC-3Ј.
Confocal imaging
SN4741 cells (20,000-40,000 cells/well) were grown overnight on glass coverslips
and transfected with the indicated plasmids. Treatment with chemical inhibitors or
Wnt-5a was performed at 4 hours or 9 hours post transfection. 24 hours post
transfection cells were fixed in 4% paraformaldehyde for 15 minutes. For
immunodetection cells were washed three times in PBS and blocked with 1% BSA,
0.1% Triton X-100 in PBS for 1 hour. The primary antibodies (see western blotting
section) were incubated for 3 hours at room temperature and subsequently the
appropriate secondary antibodies coupled to Cy3 or Cy2 (1:500, Jackson
Immunoresearch) were applied for 2 hours at room temperature. After washing,
coverslips were mounted on slides using glycerol gelatine-mounting medium
(Sigma-Aldrich). Fluorescent labelling was examined using a Zeiss LSM510
confocal system including a Zeiss Axioplan2 microscope equipped with filters for
the detection of Cy2 and Cy3.
Financial support was obtained from the Swedish Foundation for
Strategic Research, Swedish Royal Academy of Sciences, Knut and
Alice Wallenberg Foundation, European Commission, Swedish MRC,
Karolinska Institutet, Svenska Läkaresällskapet and Lars Hiertas
Minnesfond. G.S. was supported by a post-doctoral fellowship from
the Swedish Society for Medical Research (SSMF). We thank J. H.
Son for SN4741 cells, G. Castelo-Branco for Fz8-CRD conditioned
media and J. L. Bos (University of Utrecht, Netherlands) for 8CPT-
2Me-cAMP. We also thank S. Yanagawa (Kyoto University, Japan),
R. J. Lefkowitz (HHMI, Durham, NC) and J. M. Graff (University of
Texas, Dallas, TX) for expression vectors encoding Dvl2-Myc, CK1⑀
and CK1⑀ (K>R), respectively; B. B. Fredholm (Karolinska Institutet,
Sweden) for assistance with microscopy; Clare Parish and G. CasteloBranco,
Emma Andersson, and Kyle Sousa for critical reading of the
manuscript. Thank you to Claudia Tello, Johny Söderlund and Annika
Käller for technical and secretarial assistance, and to the members of
E.A.’s lab for stimulating discussions.
References
Amit, S., Hatzubai, A., Birman, Y., Andersen, J. S., Ben-Shushan, E., Mann, M., BenNeriah,
Y. and Alkalay, I. (2002). Axin-mediated CKI phosphorylation of betacatenin
at Ser 45, a molecular switch for the Wnt pathway. Genes Dev. 16, 1066-1076.
Angers, S., Thorpe, C. J., Biechele, T. L., Goldenberg, S. J., Zheng, N., MacCoss, M.
J. and Moon, R. T. (2006). The KLHL12-Cullin-3 ubiquitin ligase negatively regulates
the Wnt-␤-catenin pathway by targeting Dishevelled for degradation. Nat. Cell Biol.
8, 348-357.
Arenas, E. (2005). Engineering a dopaminergic phenotype in stem/precursor cells: role
of Nurr1, Glia-derived signals, and Wnts. Ann. N. Y. Acad. Sci. 1049, 51-66.
Bryja, V., Pachernik, J., Soucek, K., Horvath, V., Dvorak, P. and Hampl, A. (2004).
Increased apoptosis in differentiating p27-deficient mouse embryonic stem cells. Cell.
Mol. Life Sci. 61, 1384-1400.
Bryja, V., Cajanek, L., Pachernik, J., Hall, A. C., Horvath, V., Dvorak, P. and Hampl,
A. (2005). Abnormal development of mouse embryoid bodies lacking p27Kip1 cell
cycle regulator. Stem Cells 23, 965-974.
Bryja, V., Schulte, G. and Arenas, E. (2007). Wnt-3a utilizes a novel low dose and rapid
pathway that does not require casein kinase 1-mediated phosphorylation of Dvl to
activate ␤-catenin. Cell. Signal. 19, 610-616.
Castelo-Branco, G., Wagner, J., Rodriguez, F. J., Kele, J., Sousa, K., Rawal, N.,
Pasolli, H. A., Fuchs, E., Kitajewski, J. and Arenas, E. (2003). Differential
regulation of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a, and Wnt-
5a. Proc. Natl. Acad. Sci. USA 100, 12747-12752.
Castelo-Branco, G., Sousa, K. M., Bryja, V., Pinto, L., Wagner, J. and Arenas, E.
(2006). Ventral midbrain glia express region-specific transcription factors and regulate
dopaminergic neurogenesis through Wnt-5a secretion. Mol. Cell. Neurosci. 31, 251-
262.
Cong, F., Schweizer, L. and Varmus, H. (2004). Casein kinase Iepsilon modulates the
signaling specificities of dishevelled. Mol. Cell. Biol. 24, 2000-2011.
JournalofCellScience
595CK1 mediates Wnt-5a action
Davidson, G., Wu, W., Shen, J., Bilic, J., Fenger, U., Stannek, P., Glinka, A. and
Niehrs, C. (2005). Casein kinase 1 gamma couples Wnt receptor activation to
cytoplasmic signal transduction. Nature 438, 867-872.
Fish, K. J., Cegielska, A., Getman, M. E., Landes, G. M. and Virshup, D. M. (1995).
Isolation and characterization of human casein kinase I epsilon (CKI), a novel member
of the CKI gene family. J. Biol. Chem. 270, 14875-14883.
Gao, Z. H., Seeling, J. M., Hill, V., Yochum, A. and Virshup, D. M. (2002). Casein
kinase I phosphorylates and destabilizes the beta-catenin degradation complex. Proc.
Natl. Acad. Sci. USA 99, 1182-1187.
Gonzalez-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A. and Brown, A. M.
(2004). Wnt proteins induce dishevelled phosphorylation via an LRP5/6- independent
mechanism, irrespective of their ability to stabilize beta-catenin. Mol. Cell. Biol. 24,
4757-4768.
Hikasa, H., Shibata, M., Hiratani, I. and Taira, M. (2002). The Xenopus receptor
tyrosine kinase Xror2 modulates morphogenetic movements of the axial mesoderm and
neuroectoderm via Wnt signaling. Development 129, 5227-5239.
Hino, S., Michiue, T., Asashima, M. and Kikuchi, A. (2003). Casein kinase I epsilon
enhances the binding of Dvl-1 to Frat-1 and is essential for Wnt-3a-induced
accumulation of beta-catenin. J. Biol. Chem. 278, 14066-14073.
Hsieh, J. C. (2004). Specificity of WNT-receptor interactions. Front. Biosci. 9, 1333-
1338.
Hsieh, J. C., Rattner, A., Smallwood, P. M. and Nathans, J. (1999). Biochemical
characterization of Wnt-frizzled interactions using a soluble, biologically active
vertebrate Wnt protein. Proc. Natl. Acad. Sci. USA 96, 3546-3551.
Huelsken, J. and Birchmeier, W. (2001). New aspects of Wnt signaling pathways in
higher vertebrates. Curr. Opin. Genet. Dev. 11, 547-553.
Kishida, M., Hino, S., Michiue, T., Yamamoto, H., Kishida, S., Fukui, A., Asashima,
M. and Kikuchi, A. (2001). Synergistic activation of the Wnt signaling pathway by
Dvl and casein kinase Iepsilon. J. Biol. Chem. 276, 33147-33155.
Klein, T. J., Jenny, A., Djiane, A. and Mlodzik, M. (2006). CKIvarepsilon/discs
overgrown promotes both Wnt-Fz/beta-catenin and Fz/PCP signaling in Drosophila.
Curr. Biol. 16, 1337-1343.
Knippschild, U., Gocht, A., Wolff, S., Huber, N., Lohler, J. and Stoter, M. (2005). The
casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell.
Signal. 17, 675-689.
Lee, J. S., Ishimoto, A. and Yanagawa, S. (1999). Characterization of mouse dishevelled
(Dvl) proteins in Wnt/Wingless signaling pathway. J. Biol. Chem. 274, 21464-21470.
Liu, C., Li, Y., Semenov, M., Han, C., Baeg, G. H., Tan, Y., Zhang, Z., Lin, X. and
He, X. (2002). Control of beta-catenin phosphorylation/degradation by a dual-kinase
mechanism. Cell 108, 837-847.
Liu, G., Bafico, A., Harris, V. K. and Aaronson, S. A. (2003). A novel mechanism for
Wnt activation of canonical signaling through the LRP6 receptor. Mol. Cell. Biol. 23,
5825-5835.
Liu, G., Bafico, A. and Aaronson, S. A. (2005). The mechanism of endogenous receptor
activation functionally distinguishes prototype canonical and noncanonical wnts. Mol.
Cell. Biol. 25, 3475-3482.
Mashhoon, N., DeMaggio, A. J., Tereshko, V., Bergmeier, S. C., Egli, M., Hoekstra,
M. F. and Kuret, J. (2000). Crystal structure of a conformation-selective casein kinase-
1 inhibitor. J. Biol. Chem. 275, 20052-20060.
Matsubayashi, H., Sese, S., Lee, J. S., Shirakawa, T., Iwatsubo, T., Tomita, T. and
Yanagawa, S. (2004). Biochemical characterization of the Drosophila wingless
signaling pathway based on RNA interference. Mol. Cell. Biol. 24, 2012-2024.
Maye, P., Zheng, J., Li, L. and Wu, D. (2004). Multiple mechanisms for Wnt11mediated
repression of the canonical Wnt signaling pathway. J. Biol. Chem. 279,
24659-24665.
McKay, R. M., Peters, J. M. and Graff, J. M. (2001a). The casein kinase I family in
Wnt signaling. Dev. Biol. 235, 388-396.
McKay, R. M., Peters, J. M. and Graff, J. M. (2001b). The casein kinase I family: roles
in morphogenesis. Dev. Biol. 235, 378-387.
McMahon, A. P. and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogene is required
for development of a large region of the mouse brain. Cell 62, 1073-1085.
Oishi, I., Suzuki, H., Onishi, N., Takada, R., Kani, S., Ohkawara, B., Koshida, I.,
Suzuki, K., Yamada, G., Schwabe, G. C. et al. (2003). The receptor tyrosine kinase
Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells 8, 645-
654.
Patapoutian, A. and Reichardt, L. F. (2000). Roles of Wnt proteins in neural
development and maintenance. Curr. Opin. Neurobiol. 10, 392-399.
Peters, J. M., McKay, R. M., McKay, J. P. and Graff, J. M. (1999). Casein kinase I
transduces Wnt signals. Nature 401, 345-350.
Pinson, K. I., Brennan, J., Monkley, S., Avery, B. J. and Skarnes, W. C. (2000).
An LDL-receptor-related protein mediates Wnt signalling in mice. Nature 407, 535-
538.
Prakash, N., Brodski, C., Naserke, T., Puelles, E., Gogoi, R., Hall, A., Panhuysen,
M., Echevarria, D., Sussel, L., Weisenhorn, D. M. et al. (2006). A Wnt1-regulated
genetic network controls the identity and fate of midbrain-dopaminergic progenitors in
vivo. Development 133, 89-98.
Price, M. A. (2006). CKI, there’s more than one: casein kinase I family members in Wnt
and Hedgehog signaling. Genes Dev. 20, 399-410.
Rena, G., Bain, J., Elliott, M. and Cohen, P. (2004). D4476, a cell-permeant inhibitor
of CK1, suppresses the site-specific phosphorylation and nuclear exclusion of
FOXO1a. EMBO Rep. 5, 60-65.
Sakanaka, C., Leong, P., Xu, L., Harrison, S. D. and Williams, L. T. (1999). Casein
kinase I epsilon in the wnt pathway: regulation of beta-catenin function. Proc. Natl.
Acad. Sci. USA 96, 12548-12552.
Schulte, G., Bryja, V., Rawal, N., Castelo-Branco, G., Sousa, K. M. and Arenas, E.
(2005). Purified Wnt-5a increases differentiation of midbrain dopaminergic cells and
dishevelled phosphorylation. J. Neurochem. 92, 1550-1553.
Schwarz-Romond, T., Merrifield, C., Nichols, B. J. and Bienz, M. (2005). The Wnt
signalling effector Dishevelled forms dynamic protein assemblies rather than stable
associations with cytoplasmic vesicles. J. Cell Sci. 118, 5269-5277.
Shimizu, H., Julius, M. A., Giarre, M., Zheng, Z., Brown, A. M. and Kitajewski, J.
(1997). Transformation by Wnt family proteins correlates with regulation of betacatenin.
Cell Growth Differ. 8, 1349-1358.
Smalley, M. J., Signoret, N., Robertson, D., Tilley, A., Hann, A., Ewan, K., Ding, Y.,
Paterson, H. and Dale, T. C. (2005). Dishevelled (Dvl-2) activates canonical Wnt
signalling in the absence of cytoplasmic puncta. J. Cell Sci. 118, 5279-5289.
Son, J. H., Chun, H. S., Joh, T. H., Cho, S., Conti, B. and Lee, J. W. (1999).
Neuroprotection and neuronal differentiation studies using substantia nigra
dopaminergic cells derived from transgenic mouse embryos. J. Neurosci. 19, 10-20.
Strutt, H., Price, M. A. and Strutt, D. (2006). Planar polarity is positively regulated by
casein kinase ivarepsilon in Drosophila. Curr. Biol. 16, 1329-1336.
Swiatek, W., Tsai, I. C., Klimowski, L., Pepler, A., Barnette, J., Yost, H. J. and
Virshup, D. M. (2004). Regulation of casein kinase I epsilon activity by Wnt signaling.
J. Biol. Chem. 279, 13011-13017.
Takada, R., Hijikata, H., Kondoh, H. and Takada, S. (2005). Analysis of combinatorial
effects of Wnts and Frizzleds on beta-catenin/armadillo stabilization and Dishevelled
phosphorylation. Genes Cells 10, 919-928.
Taki, M., Kamata, N., Yokoyama, K., Fujimoto, R., Tsutsumi, S. and Nagayama, M.
(2003). Down-regulation of Wnt-4 and up-regulation of Wnt-5a expression by
epithelial-mesenchymal transition in human squamous carcinoma cells. Cancer Sci. 94,
593-597.
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F.,
Saint-Jeannet, J. P. and He, X. (2000). LDL-receptor-related proteins in Wnt signal
transduction. Nature 407, 530-535.
Thomas, K. R. and Capecchi, M. R. (1990). Targeted disruption of the murine int-1
proto-oncogene resulting in severe abnormalities in midbrain and cerebellar
development. Nature 346, 847-850.
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores, A., Lele, Z.,
Hammerschmidt, M., Postlethwait, J. and Solnica-Krezel, L. (2001). The zebrafish
glypican knypek controls cell polarity during gastrulation movements of convergent
extension. Dev. Cell 1, 251-264.
Topol, L., Jiang, X., Choi, H., Garrett-Beal, L., Carolan, P. J. and Yang, Y. (2003).
Wnt-5a inhibits the canonical Wnt pathway by promoting GSK-3-independent betacatenin
degradation. J. Cell Biol. 162, 899-908.
van Noort, M., Meeldijk, J., van der Zee, R., Destree, O. and Clevers, H. (2002). Wnt
signaling controls the phosphorylation status of beta-catenin. J. Biol. Chem. 277,
17901-17905.
Veeman, M. T., Axelrod, J. D. and Moon, R. T. (2003). A second canon. Functions and
mechanisms of beta-catenin-independent Wnt signaling. Dev. Cell 5, 367-377.
Wallingford, J. B. and Habas, R. (2005). The developmental biology of Dishevelled: an
enigmatic protein governing cell fate and cell polarity. Development 132, 4421-4436.
Wang, Y., Thekdi, N., Smallwood, P. M., Macke, J. P. and Nathans, J. (2002). Frizzled-
3 is required for the development of major fiber tracts in the rostral CNS. J. Neurosci.
22, 8563-8573.
Weeraratna, A. T., Jiang, Y., Hostetter, G., Rosenblatt, K., Duray, P., Bittner, M. and
Trent, J. M. (2002). Wnt5a signaling directly affects cell motility and invasion of
metastatic melanoma. Cancer Cell 1, 279-288.
Weidinger, G. and Moon, R. T. (2003). When Wnts antagonize Wnts. J. Cell Biol. 162,
753-755.
Westfall, T. A., Brimeyer, R., Twedt, J., Gladon, J., Olberding, A., Furutani-Seiki,
M. and Slusarski, D. C. (2003). Wnt-5/pipetail functions in vertebrate axis formation
as a negative regulator of Wnt/beta-catenin activity. J. Cell Biol. 162, 889-898.
Wharton, K. A., Jr (2003). Runnin’ with the Dvl: proteins that associate with Dsh/Dvl
and their significance to Wnt signal transduction. Dev. Biol. 253, 1-17.
Yamaguchi, T. P. (2001). Heads or tails: Wnts and anterior-posterior patterning. Curr.
Biol. 11, R713-R724.
Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., Okamura, H., Woodgett,
J. and He, X. (2005). A dual-kinase mechanism for Wnt co-receptor phosphorylation
and activation. Nature 438, 873-877.
Zhang, Y., Qiu, W. J., Chan, S. C., Han, J., He, X. and Lin, S. C. (2002). Casein kinase
I and casein kinase II differentially regulate axin function in Wnt and JNK pathways.
J. Biol. Chem. 277, 17706-17712.
JournalofCellScience
Vítězslav Bryja, 2014    Attachments 
 
 
#4 
 
 
Bryja V, Čajánek L, Grahn A, Schulte G (2007): Inhibition of endocytosis blocks Wnt 
signalling to ‐catenin by promoting dishevelled degradation. Acta Physiol.(Oxford) 190 
(1): 53‐59 
 
 
Impact factor (2007): 2.455 
Times cited (without autocitations, WoS, Feb 21st 2014): 13 
Significance: Here we described that block of endocytosis in several cell types leads to 
complete  depletion  of  endogenous  Dvl  in  cells.  This  observation  demonstrated 
that Dvl has a rapid turnover and that its physiological levels has to be actively 
maintained. 
Contibution of the author/author´s team: Identification and biochemical description of 
the role of endocytosis in the regulation of Dvl levels. 
 
 
   
 
 
 
Inhibition of endocytosis blocks Wnt signalling to b-catenin
by promoting dishevelled degradation
V. Bryja,1,2
L. Cˇ aja´nek,1
A. Grahn,1
and G. Schulte3
1 Department of Medical Biochemistry & Biophysics, Molecular Neurobiology, Karolinska Institutet, Stockholm, Sweden
2 Institute of Experimental Biology, Faculty of Science, Masaryk University Brno and Department of Cytokinetics, Academy of Sciences
of the Czech Republic, Kralovopolska, Czech Republic
3 Department of Physiology & Pharmacology, Karolinska Institutet, Sec. Receptor Biology & Signalling, Stockholm, Sweden
Received 29 September 2006,
revision requested 23 October
2006,
revision received 1 November
2006,
accepted 3 November 2006
Correspondence: G. Schulte, PhD,
Department of Physiology &
Pharmacology, Karolinska
Institutet, Sec. Receptor Biology &
Signalling, Nanna Svartz va¨g 2,
S-17177 Stockholm, Sweden.
E-mail: gunnar.schulte@ki.se
Abstract
Aim: The Wnt/Frizzled signalling pathway is highly conserved through
evolution. Frizzled, the receptors for Wnts, have the topology of seven
transmembrane spanning domain receptors. An important means of regulation
of these receptors is internalization and desensitization through clathrinmediated
endocytosis. Therefore, we investigated the effects of endocytosis
inhibition on Frizzled4-green fluorescent protein (FZD4-GFP) localization,
dishevelled levels and Wnt-3a signalling to b-catenin.
Methods: Experiments were performed in the mouse neuronal cell line
SN4741 that has previously proven to be valuable for the investigation of
Wnt/Frizzled signalling. FZD4-GFP distribution has been examined using
confocal laser scanning microscopy. Dishevelled protein expression levels
and the activation of b-catenin upon treatment with endocytosis inhibitors
(hyperosmolaric sucrose and K+
depletion), kinase inhibitors and Wnt-3a
were analysed by immunoblotting.
Results: Hyperosmotic sucrose and K+
depletion increased the membrane
localization of FZD4-GFP, and in parallel triggered fast (1–2 h) and almost
complete (approx. 95%) degradation of endogenous dishevelled, which was
independent of Wnt-induced, CK1-mediated phosphorylation of dishevelled.
In addition, dishevelled depletion induced by endocytosis inhibition completely
prevented canonical signalling by Wnt-3a to b-catenin even when
osmotic conditions and endocytosis were reverted to normal.
Conclusions: The data provide evidence for a molecular mechanism that
could be a basis for a novel negative feedback loop within the Wnt/Frizzled
pathway depending on dishevelled degradation. The identification of
molecular details of regulatory mechanisms for the Wnt/Frizzled signalling
pathway increases our understanding of pathway regulation, which might be
of special physiological significance for embryonic development, cancer and
neurological disorders.
Keywords b-catenin, clathrin-mediated endocytosis, desensitization,
dishevelled, Dvl, frizzled, sucrose, Wnt signalling.
Cellular communication via the Wnt/Frizzled (FZD)
signalling pathway is highly conserved through evolution
(Huelsken & Birchmeier 2001). This pathway
appears to be of crucial importance during embryonic
development, for the regulation of appropriate cell
proliferation, the biology of cancer, neurological
Acta Physiol 2007, 190, 55–61
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x 55
disorders and other diseases (Logan & Nusse 2004,
Nusse 2005). The Wnts are lipoglycoproteins (Nusse
2003) that bind to their cognate seven transmembranespanning
receptors, the Frizzled family of receptors
(Malbon 2004), which belong to the class of G proteincoupled
receptors (GPCRs) (Foord et al. 2005). Historically,
Wnt signalling was divided into canonical, i.e.
b-catenin-dependent signalling and non-canonical signalling.
Non-canonical pathways are independent of
b-catenin, e.g. the polar cell polarity pathway or the
Ca2+
pathway (Logan & Nusse 2004). Even though
molecular details in the Wnt signalling pathway are still
waiting for a complete understanding, basic concepts
are established. Wnt binding to Frizzleds and
co-receptors, e.g. the low density lipoprotein-related
protein (LRP) family, namely LRP5 and 6, induces the
activation of the important signalling relay dishevelled
(Dvl; Malbon & Wang 2006). Activation of Dvl in the
b-catenin pathway results in inhibition of a constitutive
destruction complex for b-catenin consisting of Adenomatous
Polyposis Coli (APC), axin and glycogen synthase
kinase 3b (GSK3b). This in turn prevents
proteasomal degradation of b-catenin, leading to cytoplasmatic
stabilization of the protein and a final
translocation to the nucleus. There it will exert gene
transcriptional modulation in cooperation with TCF/
Lef family transcription factors (for more information
see also the Wnt homepage http://www.stanford.edu/
$rnusse/wntwindow.html).
It has been shown that endocytosis and especially
clathrin-mediated endocytosis is of importance for the
Wnt/Frizzled pathway: the b-arrestin-dependent receptor
internalization through clathrin-coated pits is a
hallmark of classical GPCRs. It has been shown to
occur in the Wnt-5a-induced activation of Frizzled4green
fluorescent protein (FZD4-GFP) (Chen et al.
2003). That study presented the phosphoprotein Dvl
as an important link between FZD and the endocytotic
machinery, especially b-arrestin2. Furthermore, Wnt
internalization was reported to be important for
creating Wnt gradients for proper embryonic development
(Seto & Bellen 2006) and very recently, Blitzer &
Nusse (2006) described canonical b-catenin signalling
being dependent on Wnt-3a internalization through
clathrin-coated pits. Furthermore, caveolin-dependent
endocytosis of the Wnt co-receptor LRP6 was shown to
be necessary for Wnt-3a induced b-catenin signalling
(Yamamoto et al. 2006).
It appears that endocytosis is an important feature
of Wnt signalling and the regulation of this essential
way of cellular communication (Kikuchi & Yamamoto,
2007). However, the importance of endocytosis and the
consequences of inhibition of endocytosis have not been
investigated yet on the level of the Dvl. A signalling
relay station such as Dvl, which serves as a central
crossroads of Wnt/Frizzled signalling to canonical and
non-canonical pathways needs to be tightly regulated to
allow fine-tuning of the signalling system (Malbon &
Wang 2006). Modulation of Dvl is achieved by posttranslational
modifications such as activating phosphorylation
through a variety of kinases, e.g. casein kinases
1 and 2 and protein kinase C (for a summary, see e.g.
Wharton 2003). Furthermore, Dvl ubiquitination mediates
proteosomal degradation (Miyazaki et al. 2004,
Simons et al. 2005, Angers et al. 2006).
Here, we show that inhibition of endocytosis by
hyperosmolar sucrose or K+
depletion resulted in the
redistribution of overexpressed FZD4-GFP from predominantly
cytoplasmic localization to the cell membrane.
In parallel, the block of clathrin-mediated
endocytosis induced a rapid degradation of Dvl, leading
to a nearly complete depletion of Dvl from the neuronal
dopaminergic cell line SN4741. In addition, we show
that the lack of Dvl in these cells after inhibition of
endocytosis blocked Wnt-3a-induced signalling to
b-catenin. Thus, we identify a novel molecular mechanism
in the Wnt/FZD signalling pathway with all the
properties of a negative feedback mechanism based on
the degradation of the central signalling module Dvl.
Material and methods
Cell culture, treatments and transfection
The mouse neuron-like, dopaminergic cell line SN4741
was provided by Dr J.H. Son (Son et al. 1999) and
grown in Dulbecco’s modified Eagle’s medium
(DMEM), 10% FCS, l-glutamine (2 mm), penicillin
(50 U mL)1
), streptomycin (50 U mL)1
), glucose (0.6%)
(all purchased from Invitrogen, San Diego, CA, USA).
For inhibition of endocytosis, cells were incubated
either in growth medium containing 0.45 m sucrose
for 2 h or depleted of K+
according to a protocol
described previously (Larkin et al. 1983): cells were pretreated
with hypotonic medium (DMEM : water 1 : 1)
for 5 min and then incubated in isotonic K+
-free buffer
[50 mm N-2-hydroxyethylpiperazine-N¢-2-ethane sulphonic
acid (HEPES), 100 mm NaCl] for the indicated
times. Casein kinase 1 inhibitors (from Calbiochem,
Nottingham, UK) D4476 (100 lm) and IC261 (50 lm)
were applied 2 h before sucrose treatment, control
stimulation was performed with DMSO. Cells were
stimulated with Wnt-3a (from R&D Systems, Abingdon,
UK) at 100 ng mL)1
. For imaging, cells were
seeded on sterile coverslips in 24 well plates, grown
overnight and transfected under serum-free conditions
using Lipofectamine 2000 (Invitrogen) according to
manufacturer’s instructions. Medium was changed 4 h
post-transfection and cells were grown in complete
culture medium for another 24 h before fixation with
56
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x
Rapid Dvl degradation by endocytosis block ÆV Bryja et al. Acta Physiol 2007, 190, 55–61
4% paraformaldehyde. For imaging of GFP expression
cells were washed three times in phosphate-buffered
saline and coverslips were mounted on slides using
glycerol gelatine-mounting medium (Sigma-Aldrich,
Stockholm, Sweden). Fluorescence was examined using
a Zeiss LSM510 confocal system including a Zeiss
Axioplan2 (Zeiss, Jena, Germany) microscope equipped
with filters for the detection of GFP.
Immunoblotting
Immunoblot analysis and protein samples were prepared
as described previously (Bryja et al. 2004). In
brief, samples were subjected to polyacrylamide gel
electrophoresis (PAGE), transferred to a polyvinylidene
difluoride (PVDF) membrane and the following
antibodies were used for protein detection: anti-Dvl2
(sc-13974), anti-Dvl3 (sc-8027) (from Santa Cruz
Biotechnology, Santa Cruz, CA, USA). Anti-b-catenin
(BD Biosciences, Stockholm, Sweden); anti-active-bcatenin
(anti-ABC, Upstate Biotechnology, Cambridge,
UK); anti-actin from (Abcam, Hampshire, UK).
Results
We were interested in the effects of inhibition of
endocytosis on the regulation of FZDs and the central
Wnt signalling module Dvl in the dopaminergic neuronal
cell line SN4741 that we have characterized
extensively with regard to Wnt signalling (Schulte et al.
2005, Bryja et al. 2007a,b). To prevent clathrin-coated
pits formation and thereby the budding and internalization
of clathrin-coated vesicles, we applied hyperosmolaric
(0.45 m) sucrose (Heuser & Anderson 1989) or
K+
depletion (Larkin et al. 1983, 1986) for indicated
times. We were using overexpression of green-fluorescent
protein-tagged FZD4 (FZD4-GFP) to monitor the
effect of endocytosis inhibition on the receptor localization.
In the dopaminergic cell line SN4741 (Son et al.
1999) FZD4-GFP overexpression resulted in a predominantly
cytoplasmatic labelling with very little FZD4GFP
in the plasma membrane (Fig. 1a). This implicates a
continuous receptor uptake into the cell. The inhibition
of endocytosis by 0.45 m sucrose or potassium depletion
altered the picture and we detected mainly membranous
FZD4-GFP signal (Fig. 1b). This strengthened the
assumption that cytoplasmatic receptors represent
receptors that have been inserted in the membrane and
subsequently incorporated by endocytosis. Furthermore,
we conclude that FZD4-GFP embedding in the membrane
was not impaired by, e.g. overexpressing the
tagged receptor. We suggest that constitutive internalization
might, e.g. be due to receptor overexpression or
autocrine stimulation of the receptor due to endogenously
expressed Wnts (G. Schulte, unpublished data).
These data indicate that the treatments with endocytosis
blockers were suitable for the purpose of the study as
they promoted membranous localization of presumably
internalized FZD4-GFP.
In parallel, inhibition of endocytosis for 2 h led to a
strong downregulation of endogenous Dvl2 and 3
(Fig. 1c), the main isoforms of the Dvl family expressed
in SN4741 cells (Bryja et al. 2007a). Other cell types
were used to test whether the rapid and efficient
degradation of Dvl in response to inhibition of endocytosis
is a more general phenomenon and takes places
in non-neuronal cells as well. We treated mouse
embryonic fibroblast (MEF) and human embryonic
kidney cells (Hek293) with 0.45 m sucrose and
obtained similar results (Fig. 1d). This suggests that
No endocytosisctrl
FZD4-GFP
10 µm
cFZD4-GFP
Dvl2
Sucrose K+ depletion
Actin
Dvl3
– + – +
Dvl2
Sucrose
– +
MEFs Hek293
Sucrose
– +
Dvl2
ERK1
(a) (b)
(c)
(d)
Figure 1 Confocal images showing SN4741 cells overexpressing
FZD4-GFP. Cells were untreated (ctrl, a) or treated
(b) with 0.45 m sucrose (insert in b: K+
-depletion) to prevent
clathrin-coated pit-mediated endocytosis. Bar ¼ 10 lm.
Dishevelled levels are reduced upon blockade of endocytosis by
hyperosmolaric sucrose or K+
-depletion. Fig. 1c shows immunoblotting
detection of Dvl2 and 3 isoforms as well as actin as
a loading control in SN4741 after 2 h of either sucrose
(0.45 m) treatment or K+
depletion. Fig. 1d shows the detection
of Dvl2 (filled arrowheads) in mouse embryonic fibroblasts
(MEFs) and human embryonic kidney cells (Hek293) in the
presence or absence of 0.45 m sucrose. In MEFs the Dvl-2
antibody shows an unspecific band at lower molecular weight,
serving as an internal loading control. Detection of ERK1 was
shown for Hek293 cells.
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x 57
Acta Physiol 2007, 190, 55–61 V Bryja et al. ÆRapid Dvl degradation by endocytosis block
this mechanism is general rather than being a cell-line
specific phenomenon.
In addition, we noted-especially after sucrose treatment-that
Dvl degradation was preceded by the formation
of a higher molecular weight Dvl resulting in a
rapid change in electrophoretic mobility at 10 min
(Fig. 2). The changes in electrophoretic mobility of
Dvl2 and Dvl3 indicate the existence of post-translational
modification of Dvl preceding its degradation.
This modification is most likely ubiquitination, which
was described to mediate Dvl degradation in other
cellular contexts (Miyazaki et al. 2004, Simons et al.
2005, Angers et al. 2006). Inhibition of endocytosis by
K+
depletion clearly reduced levels of Dvl (Fig. 1D) but
did not show the same fast and dramatic kinetics as
sucrose, although higher molecular forms of Dvl were
also detectable (Fig. 2).
Previously, we have shown that canonical and noncanonical
Wnts induce the phosphorylation-dependent
electrophoretic mobility shift of Dvl (PS-Dvl) in a casein
kinase 1d/e-dependent manner through similar if not
identical mechanisms (Bryja et al. 2007a,b). To examine
whether the CK1-dependent phosphorylation of Dvl
precedes the degradation we used the casein kinase 1
inhibitors D4476 (Rena et al. 2004) and IC261 (Mashhoon
et al. 2000). As shown in Figure 3a, these two
different CK1 inhibitors, both prevented the formation
of the PS-Dvl. Interestingly, in combination with
hyperosmolaric sucrose, neither inhibition of CK1 with
D4476 nor with IC261 could block the rapid Dvl
degradation (Fig. 3b). Therefore, we conclude that Dvl
is degraded independently of its activity status and that
PS-Dvl formation is not necessary for Dvl to be prone
to a rapid degradation induced by inhibition of endo-
cytosis.
Next, we investigated whether endocytosis inhibition
associated with rather complete depletion of Dvl in
SN4741 might affect Wnt-3a-induced canonical signalling.
Pre-treatment with either hyperosmolaric sucrose
(2 h; Fig. 4a) or K+
-depletion (2 h; Fig. 4b) led to a
strong downregulation of Dvl2 expression as assessed
by immunoblotting. Basal b-catenin phosphorylation
was not affected by endocytosis inhibition as measured
with the ABC antibody, recognizing the active, dephosphorylated
form of b-catenin. However, the strong
increase in ABC observed under control conditions after
2 h treatment with Wnt-3a (100 ng mL)1
) was completely
blocked when endocytosis was inhibited, indicating
that canonical signalling was not functional
when (i) endocytosis was blocked, and/or (ii) the cells
are depleted of Dvl.
The experimental set-up of inhibition of endocytosis
leading to the downregulation of Dvl did not allow us to
distinguish between these two possibilities. Therefore,
we aimed at designing conditions where Dvl levels are
low but endocytosis is allowed. This could be achieved
by washing out the sucrose from the cells after sufficient
Dvl depletion and subsequent stimulation with Wnt-3a
under osmotically normal conditions. Therefore, we
changed the experimental paradigm: initial sucrose pretreatment
led to a downregulation of Dvl levels and
subsequent washing re-established physiologically normal
osmotic conditions allowing endocytosis. Under
these conditions, levels of Dvl are very low in comparison
with control (Fig. 5). Importantly, Wnt-3a stimuMin
0 10 30 60 120
Sucrose
Dvl2
Dvl3
0 10 30 60 240
K+ depletion
Actin
120
Figure 2 Dishevelled dynamics upon inhibition of endocytosis
over time. Time course of both sucrose treatment (a) and K+
depletion, (b) presenting protein levels of Dvl2/3 and actin.
Dvl2
CTRL
D4476
IC261
CTRL D4476 IC261
Min 0 10 60 0 10 60 0 10 60
Dvl2
Dvl3
Actin
Sucrose
(a)
(b)
Figure 3 The degradation of Dvl induced by block of endocytosis
is independent of phosphorylation via casein kinases 1.
The casein kinase 1 inhibitors D4476 and IC261 block the
formation of the slow-migrating Dvl2 band in SN4741 cells
(a). (b) shows immunoblotting detection of Dvl2/3 and actin as
a loading control in the presence of D4476 (100 lm) or IC261
(50 lm) and 0, 10 and 60 min of sucrose treatment.
58
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x
Rapid Dvl degradation by endocytosis block ÆV Bryja et al. Acta Physiol 2007, 190, 55–61
lation for 2 h either 4 or 6 h after washing out 0.45 m
sucrose did not induce b-catenin activation (ABC)
compared with the control cells, which showed normal
Dvl levels (Fig. 5). These data demonstrate that depletion
of Dvl induced by endocytosis block is sufficient to
block completely the Wnt-3a-mediated signal to bcatenin,
even when endocytosis processes are
functional. This suggests that Dvl itself and not
clathrin-mediated endocytosis per se, is critical for
transduction of the Wnt-induced signal to b-catenin.
Discussion
Endocytosis of receptors has been described both as a
means of terminating signalling but also of propagating
intracellular signalling according to the so-called endosome
signalling hypothesis (Howe & Mobley 2004,
Reiter & Lefkowitz 2006). Recently, a role for clathrinmediated
endocytosis has been established for the Wnt/
Frizzled signalling pathway (Chen et al. 2003, Blitzer &
Nusse 2006, Marois et al. 2006, Rives et al. 2006, Seto
& Bellen 2006). By studying the role of endocytosis in
the b-catenin Wnt signalling, we now provide evidence
for a mechanism based on the regulation of Dvl levels,
which fulfils all criteria for a possible negative feedback
loop in the Wnt/FZD signalling pathway.
SN4741 cells endogenously express different isoforms
of FZDs and an elaborate Wnt/FZD signalling machinery
(G. Schulte, unpublished results, see also Schulte
et al. 2005, Bryja et al. 2007a,b). In those cells, we
investigated the effects of endocytosis inhibition on Dvl,
which is known to be regulated by phosphorylation and
polyubiquitination (Miyazaki et al. 2004, Simons et al.
2005, Angers et al. 2006, Malbon & Wang 2006).
Previous experiments with the protein synthesis inhibitor
cycloheximide (Miyazaki et al. 2004, Simons
et al. 2005) were performed to investigate the half-life
of Dvl, showing a T1/2 (Dvl) in the range of several
hours (estimated 8–12 h). Our results, showing a
complete degradation of Dvl after just 2 h of sucrose
treatment implicate therefore an active degradation
process being triggered by the block of endocytosis.
FZD4-GFP, which we used to visualize the behaviour of
FZDs, was localized intracellularly in the basal state. In
response to hyperosmolaric sucrose or K+
depletion (It
should be noted that the treatments used for blocking
endocytosis might have unspecific side effects on, e.g.
cytoskeleton and actin polymerisation or protein distribution
in the membrane, which might be of some
importance but were not studied here.), FZD4-GFP
Dvl2
ABC
Actin
– +– +
–
– –
+ – +Sucrose
Wnt-3a
+ +
++
– –
K+
depl.
Wnt-3a
Dvl2
ABC
Actin
(a)
(b)
Figure 4 Inhibition of endocytosis blocks Wnt-3a-induced
canonical signalling. Dvl depletion from SN4741 cells after
hyperosmolaric sucrose (a) or K+
depletion (b) prevented the
Wnt-3a-induced (100 ng mL)1
, 2 h) activation of b-catenin as
assessed by immunoblotting using the anti-active-b-catenin
antibody (ABC) recognizing the active, dephosphorylated form
of b-catenin. Actin was used as a loading control.
Dvl2
ABC
Actin
+ +
++
+
+ +
+
– –
–
– –
–––
4 h after wash
Wnt-3a
6 h after wash
Sucrose
Figure 5 Lack of Dvl rather than block of endocytosis per se is
the reason for impairment of Wnt-3a signalling. After sucrose
treatment, leading to Dvl2 downregulation, cells were washed
in order to re-establish normal osmotic conditions allowing
endocytosis. The figure shows the levels of Dvl2 and the activation
of b-catenin by Wnt-3a (100 ng mL)1
, 4 and 6 h after
washing out the sucrose) under conditions allowing endocytosis.
Actin was used as a loading control.
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x 59
Acta Physiol 2007, 190, 55–61 V Bryja et al. ÆRapid Dvl degradation by endocytosis block
shifted to the membrane as a result of endocytosis
block. This suggests that observed effects on degradation
of Dvl might depend on increased FZD surface
expression and increased autocrine signalling. In fact,
long-term retrovirus-mediated overexpression of Wnt-
3a in P0 neural stem cells reduced the expression of
Dvl2 and Dvl3 in a similar way (D. Kunke and V. Bryja,
unpublished results) supporting the suggestion that the
observed mechanism can be a part of a negative
feedback loop brought about by agonist stimulation.
Dvl has been shown previously to undergo posttranslational
modification in response to both canonical
and non-canonical Wnts (for a summary, see e.g.
Wharton 2003). We have recently shown that Wnt-3a
and Wnt-5a activate CK1, which in turn phosphorylates
Dvl (Bryja et al. 2007a,b) and contributes to the further
transduction of the signal. Interestingly, treatment with
the CK1 inhibitors D4476 and IC261 prevented the
phosphorylation and mobility shift, but did not affect
the degradation of Dvl after sucrose treatment. Therefore,
we conclude that Dvl is degraded independently of
its phosphorylation status on CK1-target sites. This
suggests that (i) Wnt-induced posttranslational modification
is not necessary for Dvl degradation induced
by blocking endocytosis, and that (ii) the block of
endocytosis activates (presumably by increased membranous
localization of FZD and increased autocrine
signalling) an unknown and CK1-independent pathway
devoted to shutting down signalling by removing Dvl
from the cell.
Recently, Blitzer & Nusse (2006) investigated the role
of endocytosis inhibition on Wnt-3a-induced canonical
signalling measured both by b-catenin stabilization and
TCF/Lef signalling. The authors concluded that Wntinternalization
through endocytosis and the formation
of clathrin-coated pits were important for the stabilization
of b-catenin. Furthermore, the crucial point of
cross-talk was suggested to be localized on the level of
APC and GSK-3. However, with our results in hand
mechanisms might become more defined. We identify
Dvl downregulation as the mechanism underlying the
impaired canonical signalling under endocytosis-inhibiting
conditions. Moreover, we show that Wnt-signalling
is abolished when the endocytotic machinery is
functional but Dvl is lacking due to increased degradation.
In contrast to previously published results (Blitzer
& Nusse 2006), this implies that not endocytosis per se
but sufficient Dvl levels are required for successful
signalling to b-catenin and raises the need for the
re-evaluation of previously published data.
Taken together, our data and results from others
shed new light on the regulatory events proximal to
the membrane being crucial for the transduction of the
Wnt signal as well as for the adaptation to long-term
and high-dose treatment. Our results point to the
cytoplasmatic protein Dvl as a possible central figure
for mediating homologous and heterologous desensitization
of Wnt/FZD signalling and strongly support the
idea that endocytosis plays an important regulatory
role in this signalling pathway. The discovery of
negative feedback mechanisms for signalling pathways,
such as the Wnt/Frizzled pathway, which regulates
many processes during embryonic development, cancerogenesis
and neurological disorders (Logan &
Nusse 2004, Nusse 2005) could provide insight into
the molecular basis of disease and possible novel
targets for therapy.
Conflict of interest
The authors declare that no conflict of interest exists.
We would like to thank Prof. Ernest Arenas for general
support, Prof. Robert J. Lefkowitz for valuable discussion and
expression vectors for FZD4-GFP, and Janet Holme´n for
proofreading the manuscript. Financial support was from
Karolinska Institutet, Junior Faculty, and the Foundation Lars
Hiertas Minne. G.S. received postdoctoral fellowships from the
Swedish Society for Medical Research (SSMF) and the Swedish
Brain Foundation (Hja¨rnfonden).
References
Angers, S, Thorpe, C.J, Biechele, T.L. et al. 2006. The
KLHL12-Cullin-3 ubiquitin ligase negatively regulates the
Wnt-beta-catenin pathway by targeting Dishevelled for
degradation. Nature Cell Biol 8, 348–357.
Blitzer, J.T. & Nusse, R. 2006. A critical role for endocytosis in
Wnt signaling. BMC Cell Biol 7, 28.
Bryja, V., Pachernı´k, J., Soucek, K., Horvath, V., Dvora´k, P. &
Hampl, A. 2004. Increased apoptosis in differentiating p27deficient
mouse embryonic stem cells. Cell Mol Life Sci 61,
1384–1400.
Bryja, V., Schulte, G. & Arenas, E. 2007a. Wnt-3a utilizes
a novel low dose and rapid pathway that does not require
casein kinase 1-mediated phosphorylation of Dvl to activate
b-catenin. Cell Signal 19, 610–616.
Bryja, V., Schulte, G., Rawal, N., Grahn, A. & Arenas, E.
2007b. Wnt-5a induces the phosphorylation of dishevelled
and the differentiation of dopaminergic neurons by a CK1dependent
mechanism. J Cell Sci 120, 586–595.
Chen, W., ten Berge, D., Brown, J. et al. 2003. Dishevelled 2
recruits beta-arrestin 2 to mediate Wnt5A-stimulated endocytosis
of Frizzled 4. Science 301, 1391–1394.
Foord, S.M., Bonner, T.I., Neubig, R.R. et al. 2005. International
union of pharmacology. XLVI. G protein-coupled
receptor list. Pharmacol Rev 57, 279–288.
Heuser, J.E. & Anderson, R.G. 1989. Hypertonic media inhibit
receptor-mediated endocytosis by blocking clathrin-coated
pit formation. J Cell Biol 108, 389–400.
Howe, C.L. & Mobley, W.C. 2004. Signaling endosome
hypothesis: a cellular mechanism for long distance communication.
J Neurobiol 58, 207–216.
60
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x
Rapid Dvl degradation by endocytosis block ÆV Bryja et al. Acta Physiol 2007, 190, 55–61
Huelsken, J. & Birchmeier, W. 2001. New aspects of Wnt
signaling pathways in higher vertebrates. Curr Opin Genet
Dev 11, 547–553.
Kikuchi, A. & Yamamoto, H. 2007. Regulation of Wnt signaling
by receptor-mediated endocytosis. J Biochem EPub
ahead of print (doi: 10.1093/jb/mvm061).
Larkin, J.M., Brown, M.S., Goldstein, J.L. & Anderson, R.G.
1983. Depletion of intracellular potassium arrests coated pit
formation and receptor-mediated endocytosis in fibroblasts.
Cell 33, 273–285.
Larkin, J.M., Donzell, W.C. & Anderson, R.G. 1986.
Potassium-dependent assembly of coated pits: new coated pits
form as planar clathrin lattices. J Cell Biol 103, 2619–2627.
Logan, C.Y. & Nusse, R. 2004. The Wnt signaling pathway
in development and disease. Ann Rev Cell Dev Biol 20,
781–810.
Malbon, C.C. 2004. Frizzleds: new members of the superfamily
of G-protein-coupled receptors. Front Biosci 9, 1048–1058.
Malbon, C.C. & Wang, H.Y. 2006. Dishevelled: a mobile
scaffold catalyzing development. Curr Top Dev Biol 72,
153–166.
Marois, E., Mahmoud, A. & Eaton, S. 2006. The endocytic
pathway and formation of the Wingless morphogen gradient.
Development 133, 307–317.
Mashhoon, N., DeMaggio, A.J, Tereshko, V. et al. 2000.
Crystal structure of a conformation-selective casein kinase-1
inhibitor. J Biol Chem 275, 20 052–20 060.
Miyazaki, K., Fujita, T., Ozaki, T. et al. 2004. NEDL1, a novel
ubiquitin-protein isopeptide ligase for dishevelled-1, targets
mutant superoxide dismutase-1. J Biol Chem 279, 11 327–
11 335.
Nusse, R. 2003. Wnts and Hedgehogs: lipid-modified proteins
and similarities in signaling mechanisms at the cell surface.
Development 130, 5297–5305.
Nusse, R. 2005. Wnt signaling in disease and in development.
Cell Res 15, 28–32.
Reiter, E. & Lefkowitz, R.J. 2006. GRKs and beta-arrestins:
roles in receptor silencing, trafficking and signaling. Trends
Endocrinol Metabol 17, 159–165.
Rena, G., Bain, J., Elliott, M. & Cohen, P. 2004. D4476, a cellpermeant
inhibitor of CK1, suppresses the site-specific
phosphorylation and nuclear exclusion of FOXO1a. EMBO
Rep 5, 60–65.
Rives, A.F., Rochlin, K.M., Wehrli, M., Schwartz, S.L. & DiNardo,
S. 2006. Endocytic trafficking of wingless and its
receptors, arrow and DFrizzled-2, in the Drosophila wing.
Dev Biol 293, 268–283.
Schulte, G., Bryja, V., Rawal, N., Castelo-Branco, G., Sousa,
K.M. & Arenas, E. 2005. Purified Wnt-5a increases differentiation
of midbrain dopaminergic cells and dishevelled
phosphorylation. J Neurochem 92, 1550–1553.
Seto, E.S. & Bellen, H.J. 2006. Internalization is required for
proper wingless signaling in Drosophila melanogaster. J Cell
Biol 173, 95–106.
Simons, M., Gloy, J., Ganner, A. et al. 2005. Inversin, the gene
product mutated in nephronophthisis type II, functions as a
molecular switch between Wnt signaling pathways. Nat
Genet 37, 537–543.
Son, J.H., Chun, H.S., Joh, T.H., Cho, S., Conti, B. & Lee,
J.W. 1999. Neuroprotection and neuronal differentiation
studies using substantia nigra dopaminergic cells derived
from transgenic mouse embryos. J Neurosci 19, 10–20.
Wharton, K.A. 2003. Runnin’ with the Dvl: proteins that
associate with Dsh/Dvl and their significance to Wnt signal
transduction. Dev Biol 253, 1–17.
Yamamoto, H., Komekado, H. & Kikuchi, A. 2006. Caveolin
is necessary for Wnt-3a-dependent internalization of LRP6
and accumulation of beta-catenin. Dev Cell 11, 213–223.
Ó 2007 The Authors
Journal compilation Ó 2007 Scandinavian Physiological Society, doi: 10.1111/j.1748-1716.2007.01688.x 61
Acta Physiol 2007, 190, 55–61 V Bryja et al. ÆRapid Dvl degradation by endocytosis block
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#5 
 
 
Bryja  V,  Gradl  D,  Schambony  A,  Arenas  E*,  Schulte  G*  (2007):  ‐arrestin  is  a  necessary 
component of Wnt/‐catenin signaling in vitro and in vivo. Proc. Natl. Acad. Sci. USA 104: 
6690‐6695.  
* corresponding authors 
 
 
Impact factor (2007): 9.380 
Times cited (without autocitations, WoS, Feb 21st 2014): 45 
Significance: Identification of β‐arrestin, a Dishevelled binding partner implicated in the 
signaling  via  seven‐transmembrane  receptor,  as  a  crucial  component  of  the 
Wnt/β‐catenin  pathway.  Positioning  of  β‐arrestin  into  canonical  Wnt  pathway 
pointed to the fact that Fzd receptors probably act upstream of Dishevelled and 
cooperate with trimeric G proteins. 
Contibution of the author/author´s team: All in vitro work. 
 
 
   
 
 
 
␤-Arrestin is a necessary component of
Wnt/␤-catenin signaling in vitro and in vivo
Vı´teˇzslav Bryja*†
, Dietmar Gradl‡
, Alexandra Schambony‡
, Ernest Arenas*§
, and Gunnar Schulte¶ʈ
*Laboratory of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics, and ¶Section of Receptor Biology and Signaling,
Department of Physiology and Pharmacology, Karolinska Institutet, S-171 77 Stockholm, Sweden; and ‡Zoologisches Institut II, Universita¨t
Karlsruhe (TH), Kaiserstrasse 12, D-76131 Karlsruhe, Germany
Edited by Robert J. Lefkowitz, Duke University Medical Center, Durham, NC, and approved March 1, 2007 (received for review December 20, 2006)
The Wnt/␤-catenin signaling pathway is crucial for proper embryonic
development and tissue homeostasis. The phosphoprotein
dishevelled (Dvl) is an integral part of Wnt signaling and has
recently been shown to interact with the multifunctional scaffolding
protein ␤-arrestin. Using Dvl deletion constructs, we found that
␤-arrestin binds a region N-terminal of the PDZ domain of Dvl,
which contains casein kinase 1 (CK1) phosphorylation sites. Inhibition
of Wnt signaling by CK1 inhibitors reduced the binding of
␤-arrestin to Dvl. Moreover, mouse embryonic fibroblasts lacking
␤-arrestins were able to phosphorylate LRP6 in response to Wnt-3a
but decreased the activation of Dvl and blocked ␤-catenin signaling.
In addition, we found that ␤-arrestin can bind axin and forms
a trimeric complex with axin and Dvl. Furthermore, treatment of
Xenopus laevis embryos with ␤-arrestin morpholinos reduced the
activation of endogenous ␤-catenin, decreased the expression of
the ␤-catenin target gene, Xnr3, and blocked axis duplication
induced by X-Wnt-8, CK1␧, or Dsh⌬DEP, but not by ␤-catenin. Thus,
our results identify ␤-arrestin as a necessary component for Wnt/
␤-catenin signaling, linking Dvl and axin, and open a vast array of
signaling avenues and possibilities for cross-talk with other ␤arrestin-dependent
signaling pathways.
canonical Wnt signaling ͉ dishevelled ͉ Frizzled ͉ G protein-coupled
receptor ͉ Xenopus
The Wnt/Frizzled pathway is a crucial element in cellular communication
(1), which is highly conserved through evolution (2)
and is required for both embryonic development and tissue homeostasis.
Dysfunction and deregulation of this pathway cause
different diseases, including cancer and developmental defects (3).
Wnts are secreted lipoglycoproteins (4) that bind to their cognate
receptors of the Frizzled family (FZD1–10) as well as their coreceptors
low-density lipoprotein receptor-related protein 5/6
(LRP5/6) (1). The phosphoprotein dishevelled (Dvl) is one of the
most upstream modules in this pathway (5). Dvl associates with
many different intracellular proteins and is phosphorylated by
different kinases (for reviews, see e.g., refs. 5 and 6). In response to
Wnt ligand, Dvl is phosphorylated and activated by kinases [as
casein kinase 1 (CK1)␦/␧; ref. 7], resulting in a electrophoretic
mobility shift (7, 8), hereafter referred to as PS-Dvl (phosphorylated
and shifted Dvl). In the Wnt/␤-catenin** signaling pathway,
Dvl activation is followed by an inhibition of a destruction complex
composed of axin, glycogen synthase kinase 3 and adenomatous
polyposis coli, which results in a stabilization of ␤-catenin, which is
now capable of regulating transcription by means of T cell factor
(TCF)/lymphoid enhancer factor (Lef) transcription factors (1).
Recently, the multifunctional scaffolding protein ␤-arrestin was
shown to interact with Dvl (9, 10). ␤-Arrestins are known to
regulate G protein-coupled receptor desensitization and internalization
as well as signaling (11). Initially, ␤-arrestin-mediated
endocytosis was seen as a means of desensitizing a receptor system.
However, recent findings point also to a role of ␤-arrestins as a
signaling scaffold for diverse signaling modules, including kinases,
phosphatases, small GTPases, phosphodiesterases, ubiquitin E3
ligases, and I␬B␣ (for review, see refs. 12 and 13). With regard to
Wnt signaling, ␤-arrestin1 was identified as a positive modulator of
the Wnt/␤-catenin pathway and ␤-arrestin2 as a mediator for the
agonist-induced internalization of FZD4 (9, 10). However, despite
the information from previous overexpression studies, the mechanism
of action and role of endogenous ␤-arrestin in Wnt signaling
are still unknown.
Here, we aimed at characterizing the nature of the Dvl–␤-arrestin
interaction and its importance for Wnt/␤-catenin signaling both in
vitro and in vivo. In mouse embryonic fibroblasts (MEFs) genetically
depleted of ␤-arrestin1 and/or 2, we show that endogenous
␤-arrestin is necessary for the Wnt-3a-induced activation of Dvl and
for signaling to ␤-catenin. We identify axin as a ␤-arrestin-binding
partner, and we suggest that ␤-arrestin forms a functional, trimeric
Dvl–␤-arrestin–axin complex. Moreover, loss-of-function experiments
in Xenopus laevis embryos further indicated that ␤-arrestin is
necessary during embryonic development for Wnt/␤-catenin signaling
in vivo.
Results
Based on previous findings on the interaction between ␤-arrestin
and Dvl (9, 10), we aimed at characterizing that interaction in more
detail. We first used as a model SN4741 cells (14), a dopaminergic
cell line in which Wnt signaling has been characterized (7, 15, 16).
We found that immunoprecipitation of either Myc-Dvl2 or HA-␤arrestin2,
in cells ectopically expressing Myc-Dvl2 and FLAG-␤arrestin2
(Fig. 1A) or FLAG-Dvl3 and HA-␤-arrestin2 (Fig. 1B),
resulted in the pulldown of FLAG-␤-arrestin2 and FLAG-Dvl3,
respectively. Furthermore, expression of ␤-arrestin2-GFP and MycDvl2
in SN4741 cells showed a strong colocalization of the two
proteins in characteristic punctate Dvl aggregates (17, 18), as
detected by immunocytochemistry and confocal laser scanning
microscopy (Fig. 1C). Similar results have been obtained with
Myc-Dvl2 and HA-␤-arrestin2 or FLAG-␤-arrestin2 (data not
Author contributions: V.B., D.G., A.S., E.A., and G.S. designed research; V.B., D.G., A.S., and
G.S. performed research; V.B., D.G., A.S., and G.S. analyzed data; and V.B., E.A., and G.S.
wrote the paper.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
Abbreviations: CK1, casein kinase 1; D4476, 4-[4-(2,3-dihydro-benzo[1,4]dioxin-6-yl)-5pyridin-2-yl-1H-imidazol-2-yl]benzamide;
⌬axin, aa1–477 axin; Dsh, Drosophila melanogaster
dishevelled; Dvl, mammalian dishevelled; FZD, Frizzled; KO, knockout; LEF, lymphoid
enhancer factor; MEF, mouse embryonic fibroblast lacking ␤-arrestin1 (␤-arr1KO), ␤-arrestin2
(␤-arr2KO), or both (␤-arr1/2dKO); MO, morpholino; PS-Dvl, phosphorylated and
shifted Dvl; TCF, T cell factor; XDsh, Xenopus dishevelled.
†Present address: Institute of Experimental Biology, Faculty of Science, Masaryk University
and Laboratory of Cytogenetics, Institute of Biophysics, Academy of Sciences of the Czech
Republic, 601 77 Brno, Czech Republic.
§To whom correspondence may be addressed. E-mail: ernest.arenas@ki.se.
ʈTo whom correspondence may be addressed. E-mail: gunnar.schulte@ki.se.
**Synonymous to the term ‘‘canonical signaling,’’ we rather use ‘‘Wnt/␤-catenin
signaling.’’
This article contains supporting information online at www.pnas.org/cgi/content/full/
0611356104/DC1.
© 2007 by The National Academy of Sciences of the USA
6690–6695 ͉ PNAS ͉ April 17, 2007 ͉ vol. 104 ͉ no. 16 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0611356104
shown), to ensure that the association of ␤-arrestin with Dvl
represents a true colocalization.
To narrow the interaction interface of ␤-arrestin2 with Dvl, we
used a set of deletion mutants of FLAG-Dvl3 (19) (Fig. 2A) and
FLAG-␤-arrestin2 (Fig. 2B) expressed in COS-7 cells. Coimmunoprecipitation
of HA-␤-arrestin2 in cells overexpressing also
FLAG-Dvl3 mutants revealed that HA-␤-arrestin2 can interact
with FLAG-Dvl3 mutants 1, 2, 5, 6, and 7 but not with 3 and 4
[supporting information (SI) Fig. 6A], which lack a region Nterminal
of the PDZ domain of Dvl (Fig. 2A). Immunoprecipitation
of Myc-Dvl2 resulted in the pulldown of full-length FLAG-␤arrestin2
(construct 1) as well as the deletion mutants 2, 3, 5 but not
4 (SI Fig. 6B). To confirm the weak interaction between ␤-arrestin2
construct 2 and Dvl2-Myc (SI Fig. 6B), we performed coimmunoprecipitation
of construct 2 with XDsh-Myc (20) and found a strong
interaction between them (SI Fig. 6C). Thus, our results identify the
region aa163–300 as the Dvl-interacting domain on ␤-arrestin2.
The small portion of Dvl that was found to bind ␤-arrestin,
N-terminal to the PDZ domain, was previously shown to contain
Ser/Thr residues recognized by CK1␧ (21) and PAR-1 (partitioning
defective mutant in C. elegans) (20, 22). Moreover, endogenous
CK1␦/␧ is induced by Wnt ligands (16, 23), phosphorylates Dvl, and
results in formation of active PS-Dvl (7, 16). To assess the importance
of CK1-mediated phosphorylation in the Dvl–␤-arrestin
interaction, we treated cells with the CK1-specific inhibitor D4476
(24), which interferes with the activation of Dvl. In cells overexpressing
Myc-Dvl2, treatment with D4476 reduced the formation of
PS-Myc-Dvl2 (16) and reduced the interaction of Myc-Dvl2 with
HA-␤-arrestin2 (Fig. 2C), suggesting that phosphorylation of Dvl
by CK1 increases the affinity for ␤-arrestin. We have shown
previously (16) that expression of CK1␧ in SN4741 cells promotes
an even cytosolic distribution of Myc-Dvl2, whereas a kinase-dead
mutant, CK1␧K3R, promotes the typical punctate Dvl appearance
in the cytosol. In triple-expression experiments using HA-␤arrestin2,
Myc-Dvl2, and CK1␧ or CK1␧K3R (Fig. 2D), we found
that HA-␤-arrestin2 follows the localization of CK1␧–Dvl. In the
presence of CK1␧, HA-␤-arrestin2, Myc-Dvl2, and CK1␧ were
distributed evenly throughout the cytoplasm, whereas in cells
expressing the kinase-dead mutant of CK1␧, the proteins adopted
a punctate distribution. This finding demonstrated that ␤-arrestin
overexpression does not affect the CK1␧-induced translocation of
Myc-Dvl2 and suggests that ␤arrestin probably acts downstream
from Dvl, phosphorylated by CK1. This finding also strengthens the
biochemical data of ␤-arrestin interaction with both Dvl and
PS-Dvl.
To examine whether endogenous ␤-arrestin is required for
Wnt-3a signaling, we examined whether MEFs lacking (knockout,
KO) ␤-arrestin1, ␤-arrestin2, or both (␤-arr1KO, ␤-arr2KO, ␤-arr1/
2dKO) respond to Wnt-3a stimulation (Fig. 3A and SI Figs. 7 and
8). The wild-type (WT) MEFs showed time courses and dose
responses of Dvl activation similar to those reported previously for
SN4741 cells (7). However, the ability of ␤-arr2KO or ␤-arr1/2dKO
MEFs to induce the formation of PS-Dvl in response to Wnt-3a was
delayed and severely reduced (Fig. 3 A and B and SI Fig. 7),
suggesting an important role of ␤-arrestin in Dvl activation and
PS-Dvl formation. Interestingly, complete ablation of ␤-arrestins
resulted in a higher basal level of PS-Dvl compared with the WT,
␤-arr1KO, and ␤-arr2KO, suggesting up-regulation of yet unknown
compensatory mechanisms. Moreover, endogenous ␤-arrestin2
seemed to be more important compared with ␤-arrestin1 because
the defects on PS-Dvl formation were more pronounced in MEFs
lacking ␤-arrestin2 compared with cells lacking ␤-arrestin1 (SI Fig.
8). Thus, our results suggest that ␤-arrestins are crucial components
of the molecular machinery mediating Dvl activation and formation
of PS-Dvl in response to Wnt-3a. Because the formation of PS-Dvl
at the 2-h time point studied here is necessary for the substantial
activation of ␤-catenin in response to Wnt-3a (7), we also investigated
dephosphorylation and stabilization of ␤-catenin. Moreover,
we also analyzed the activation and phosphorylation of Ser-1490 in
LRP6, using a phosphospecific antibody (25). Notably, LRP6
phosphorylation was strongly induced by Wnt-3a treatment but was
not affected by genetic deletion of arrestins (Fig. 3C). In contrast,
agonist-induced ␤-catenin signaling in ␤-arr2KO and ␤-arr1/2dKO
MEFs was almost completely abolished (Fig. 3C). ␤-arr1KO MEFs
showed a pattern of ␤-catenin dephosphorylation similar to that of
the Wnt-3a-stimulated WT MEFs (SI Fig. 8). Because dephosphorylated
␤-catenin is stabilized and leads to activation of transcription
in a TCF/Lef-dependent manner, we also investigated the role
of ␤-arrestin in Wnt-3a-induced activation of the TOPflash luciferase
reporter. Although WT MEFs strongly responded to Wnt-3a
stimulation with TCF/Lef reporter activity, the lack of both ␤-arrestins
completely inhibited this response (Fig. 3D). MEFs lacking
␤-arrestin2 showed a partially reduced response to Wnt-3a stimulation,
supporting the idea of redundancy between ␤-arrestin1 and
␤-arrestin2 in Wnt signaling. Again, depletion of ␤-arrestins 1 and
2 increased basal TCF/Lef signaling slightly, indicating the existence
of compensatory mechanisms. Thus, our in vitro data argue for an
important function of ␤-arrestin in Wnt signaling, in particular for
the Wnt-induced formation of PS-Dvl and subsequent activation of
the Wnt/␤-catenin pathway.
In addition, we sought to characterize further the potential
␤-arrestin-dependent mechanisms upstream and downstream from
Dvl. First, we investigated the role of ␤-arrestin in the FZD-induced
redistribution of Dvl to the plasma membrane (26). Overexpression
of FZD4-GFP together with Myc-Dvl2 in both WT and ␤-arr1/
2dKO MEFs, resulted in complete redistribution of Myc-Dvl2 from
cytoplasmic punctae to the plasma membrane (SI Fig. 9). Thus,
␤-arrestin is not crucial for the FZD4-induced Dvl2 translocation.
Second, we analyzed the interaction of axin with ␤-arrestin by
overexpression in COS-7 cells. As shown in Fig. 4A, a full-length
axin or a deletion mutant 1–477 axin (⌬axin) lacking the DIX
domain (27), which is necessary for the interaction with Dvl (28),
coimmunoprecipitated with ␤-arrestin. Thus, ␤-arrestin can interact
directly with axin, and such interaction is most likely not
mediated by Dvl. These data suggest that a trimeric Dvl–␤-arrestin–
axin complex might be central for the recruitment of Dvl to axin and
the subsequent dissociation of the destruction complex (27–29). To
test this possibility, we transfected in Fig. 4B the indicated combinations
of vectors encoding for Dvl (XDsh), ␤-arrestin, and full-
A
Dvl2-mycarr2-GFP merge
C
Myc-Dvl2
Flag- -arr2 -
+
WB: Flag
Flag
WB: Myc
IP:Myc-Dvl2
TCL:
+
+
-
+
B
TCL:
HA- arr2
Flag-Dvl3 -
+
WB: Flag
Flag
WB: HA
IP:HA-arr2
+
+
-
+
Fig. 1. Interaction and colocalization of Dvl and ␤-arrestin2. Expression of
Myc-Dvl2 and FLAG-␤-arrestin2 (A) or HA-␤-arrestin2 and FLAG-Dvl3 (B) in
SN4741 cells allowed coimmunoprecipitation of Myc-Dvl2 together with
FLAG-␤-arrestin2 (A) or of HA-␤-arrestin2 with FLAG-Dvl3 (B). Total cell lysates
(TCL) analyzed for the presence of transfected FLAG-tagged proteins by
immunoblotting. (C) SN4741 cells transfected with ␤-arrestin2-GFP (␤arr2GFP)
and Myc-Dvl2 show substantial colocalization (indicated in yellow in
merged picture) of those proteins in cytoplasmatic, nonvesicular punctae,
which are the typical subcellular distribution of Dvl as analyzed by confocal
microscopy. WB, Western blotting.
Bryja et al. PNAS ͉ April 17, 2007 ͉ vol. 104 ͉ no. 16 ͉ 6691
CELLBIOLOGY
length/⌬axin for coimmunoprecipitation. We found that ␤-arrestin,
XDsh, and axin are precipitated together and are, thus, likely to
form a trimeric complex. Interestingly, ⌬axin is also present in such
complexes, suggesting that it might be recruited to XDsh by
␤-arrestin. However, ␤-arrestin is not necessary for the XDsh–axin
interaction, at least not in an overexpression system, because
overexpressed XDsh interacts to a similar extent with axin in both
WT and ␤-arr1/2dKO MEFs (data not shown). In addition it
appears that axin could act as a stabilizing component of XDsh/
␤-arrestin binding because the association of XDsh and ␤-arrestin
is stronger when axin is coexpressed (compare lanes 3 and 4 with
lane 5, WB: XDsh, Fig. 4B).
D
A
B
+
1 163 300 410
1
2
3
4
5
FLAG
FLAG
FLAG
FLAG
FLAG
+
+
+
-
+
DEPPDZDIXFLAG
DEPPDZFLAG
DEPFLAG
FLAG
DIXFLAG
PDZDIXFLAG
DEPPDZDIXFLAG
1
2
3
4
5
6
7
+
+
-
-
+
+
1 71682 333 492
CKI
HA- arr2
Dvl2-Myc
merge
CKI K R
HA- arr2
Dvl2-Myc
merge
C
WB: Myc
WB: HA
WB: HA
IPMyc
Dvl2-Myc
HA- -arrestin
D4476 -
-
-
-
+
+
-
+
+
+
+
1.47 0.57
1.70 0.05
Fig. 2. Mapping of the interaction interfaces of ␤-arrestin2 and Dvl. Deletion
mutants of FLAG-Dvl3 (A; constructs 1–7; ref. 19) and of FLAG-␤-arrestin2 were
used in combination with HA-␤-arrestin2 and Myc-Dvl2, respectively, for coim-
munoprecipitation.ϩandϪindicateinteractionwith␤-arrestin(A)orDvl(B).For
detailed presentation of coimmunoprecipitation data, see SI Fig. 6. (C) ␤-Arrestin2
preferentially binds phosphorylated Dvl2. SN4741 cells expressing Dvl2-Myc
and HA-␤-arrestin2 were grown with and without the CK1 inhibitor D4476.
D4476 treatment prevents formation of PS-Dvl and decreases the amount of
HA-␤-arrestin2 that can be precipitated with Myc-Dvl2, suggesting a decreased
affinity of ␤-arrestin to unphosphorylated Dvl. Numbers represent OD of ␤-arrestin
signal and PS-Dvl/Dvl ratio. The arrowhead points to the localization of
PS-Dvl band. (D) Overexpressed HA-␤-arrestin2 (red; HA-␤-arr2) and Dvl2-Myc
(green) as well as CK1␧ (b/w; kinase-dead mutant CK1␧ K3R) are analyzed by
wt -arr2KO -arr1/2dKO
0
1
2
3
4
control
Wnt-3a (100 ng/ml)
*
Relativeluciferaseactivity
Dvl2
A
B
D
Wnt-3a
wt
arr2KO
arr1/2dKO
0 5 30 60 12015 min
Wnt-3a 0 3 30 10010 ng/ml
MEFs:
C
wt
arr2KO
arr1/2dKO
Dvl2
MEFs:
Wnt-3a - +
ABC
actin
- + - +
P-LRP6
wtMEFs:
-catenin
arr2
KO
arr1/2
dKO
Fig. 3. ␤-Arrestin2 is a necessary component of canonical Wnt signaling in
MEFs. (A) WT, ␤-arr2KO, or ␤-arr1/2dKO MEFs are treated with 100 ng/ml
Wnt-3a for the indicated times. Dvl2 activation is assessed as the formation of
PS-Dvl2 (Dvl, open; PS-Dvl, filled arrowheads) by immunoblotting. (B) Wnt-3a
dose responses were performed at 2 h. (C) Quantification of data is available
in SI Fig. 7. Phosphorylation of LRP6 at Ser-1490 (P-LRP6) and ␤-catenin
signaling was analyzed in WT, ␤-arr2KO, and ␤-arr1/2dKO MEFs after 100
ng/ml Wnt-3a treatment for 2 h. Dephosphorylation of ␤-catenin (ABC) and
␤-catenin stabilization show that Wnt-3a-induced signaling to ␤-catenin is
reduced in ␤-arr2KO MEFs and completely abolished in ␤-arr1/2dKO MEFs. For
responses in ␤-arr1KO MEFs, see SI Fig. 8. (D) SuperTOPflash activity upon 100
ng/ml Wnt-3a stimulation is shown (n ϭ 3). *, P Ͻ 0.01 as analyzed by ANOVA
and TukeyЈs post hoc tests.
confocallaserscanningmicroscopy.InthepresenceofWTCK1␧,␤-arrestin2,Dvl2,
and CK1 are distributed evenly throughout the cytoplasm. In the presence of
CK1␧K3R, ␤-arrestin2, Dvl2, and CK1␧ are confined to nonvesicular punctae
characteristic for Dvl aggregates. Overlap of distribution of ␤-arrestin and Dvl2Myc
is indicated in yellow in the merged pictures.
6692 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0611356104 Bryja et al.
To examine the importance of ␤-arrestin for Wnt signaling in
vivo, during embryonic development, we turned to one of the
most classical and robust models to study Wnt signaling, the early
X. laevis embryo. The axis duplication assay, as induced by
injection of XWnt-8 or Dsh⌬DEP mRNA in the ventral blastomeres,
was used to examine the role of ␤-arrestin overexpression
in canonical signaling. The lack of effect of ␤-arrestin RNA
injection on axis duplication under basal conditions or in blastomeres
injected with XWnt-8 or Dsh⌬DEP suggested that
␤-arrestin per se is not sufficient to induce Wnt/␤-catenin
signaling. In contrast, down-regulation of Xenopus ␤-arrestins
(for sequence and alignment, see SI Fig. 10) with ␤-arrestin
morpholinos (␤-arrMO) showed that ␤-arrestin is required for
Wnt/␤-catenin pathway (Fig. 5 B and C) because the XWnt-8induced
axis duplication was blocked (percent axis duplication:
XWnt-8, 51.0; XWnt-8 ϩ ␤-arrMO, 8.5). Control injections with
0
10
20
30
40
50
60
XWnt-8 Dsh DEP
-arrestin - + - ++
n= 202 55 189 113122
%secondaryaxis
0
10
20
30
40
50
XWnt-8 Dsh DEP
-arrMO - + - ++
n=
-catenin
-
202 258189 5758 45
CK1
70110
- +
%secondaryaxis
A
D
C
+-arrMO--arrMO
E
A1CT
ABC
--arrMO +
0.0 0.5 1.0
control
-arrMO
relative expressionof Xnr3
B
Fig. 5. ␤-Arrestin is not sufficient but necessary for Wnt/␤-catenin signaling in vivo. (A) Percentage of secondary axis induction in Xenopus embryos injected
with XWnt-8, Dsh⌬DEP, and ␤-arrestin RNA. n, no. of analyzed embryos per condition. (B) Effect of ␤-arrestin morpholino (␤-arrMO) treatment on XWnt-8-,
Dsh⌬DEP-, CK1␧-, and ␤-catenin-induced axis duplication; n, no. of analyzed embryos per condition. (C) Representative photographs of embryos. Secondary axis
formation (arrowheads) is best seen by the appearance of a secondary neural tube in neurula (XWnt-8, ␤-catenin), tailbud (CK1␧), and tadpole stages (Dsh⌬DEP).
Arrows indicate the endogenous axes. (D) Immunoblotting of Xenopus lysates analyzed for ␤-catenin dephosphorylation (ABC) and ␤-arrestin levels (A1CT). Filled
arrowheads indicate Xenopus ␤-arrestin signal. Open arrowhead indicates an unspecific band serving as loading control. Gene expression (Xnr3) was examined
in Xenopus embryos by quantitative RT-PCR. (E) Error bars show mean Ϯ SD.
-
+
-
+
-
+
+
+
+
-
+
+
-
-
+
+
-
-
-
-
-arr2
axin
axin
XDsh
-
+
-
+
-
+
+
+
+
-
+
+
-
-
+
+
-
-
-
-
-
+
-
+
-
+
+
+
+
-
+
+
-
-
+
+
-
-
-
-
B
WB: axin
WB: XDsh
WB: -arr
WB: axin
WB: -arr
-arr2
axin
axin
- - - +
- + + +
- + +
- - - +
- + + +
- + +
A IP: -arrTCL axinIP: -arr XDsh
Fig. 4. ␤-Arrestin interaction with axin. (A) Immunoprecipitation (IP) experiments in COS-7 cells show the interaction of ␤-arrestin (Right) with full-length and
aa1–477 axin (⌬axin). (Left) Total cell lysates (TCL). The arrowhead points to the IgG band in the immunoprecipitate. WB, Western blot. (B) Overexpression of
HA-␤-arrestin2, Myc-Dishevelled (Xenopus dishevelled, XDsh) and full length (FLAG-tagged) as well as ⌬axin reveals the existence of trimeric Dvl-␤–arrestin–axin
complexes.
Bryja et al. PNAS ͉ April 17, 2007 ͉ vol. 104 ͉ no. 16 ͉ 6693
CELLBIOLOGY
␤-arrMO alone did not result in axis duplication (data not
shown; percent axis duplication: ␤-arrMO, 0, n ϭ 261). In
addition, ␤-arrMO (Fig. 5 B and C) completely blocked
Dsh⌬DEP Ϫ (percent axis duplication: Dsh⌬DEP, 21.2;
Dsh⌬DEP ϩ ␤-arrMO, 0) as well as CK1␧-induced secondary
axis formation (percent axis duplication: CK1␧, 13.6; CK1␧ ϩ
␤-arrMO, 1.4). However, ␤-arrMO did not affect secondary axis
induced by ␤-catenin (% axis duplication: ␤-catenin, 44.4;
␤-catenin ϩ ␤-arrMO, 38.6), arguing for ␤-arrestin acting upstream
from ␤-catenin and downstream from CK1␧ and Dvl,
which is in good agreement with our in vitro data. As control for
the CK1␧ injection we also injected a kinase-dead mutant of
CK1␧K3R, which alone or in combination with ␤-arrMO failed
to induce axis duplication (data not shown; % axis duplication,
CK1␧, 0, n ϭ 87; CK1␧ ϩ ␤-arrMO, 0, n ϭ 117). Detection of
activated, dephosphorylated ␤-catenin (ABC, Fig. 5D) and
expression of the ␤-catenin target gene Xnr3 (Fig. 5E) in control
and ␤-arrestin depleted Xenopus embryos further showed that
␤-catenin activity is reduced in ␤-arrestin-depleted embryos. In
summary, the Xenopus experiments demonstrate that endogenous
␤-arrestin is required for normal development and for
Wnt/␤-catenin signaling in vivo.
Discussion
Here, we identify the multipurpose scaffolding protein ␤-arrestin
as a necessary component in the Wnt/␤-catenin pathway in vitro
and in vivo. We show that ␤-arrestin binds to and forms a trimeric
complex with axin and Dvl. Moreover, endogenous ␤-arrestin
does not affect phosphorylation of LRP6 but is necessary for
proper activation of Dvl, signaling along the Wnt/␤-catenin
pathway, activation of endogenous Wnt target genes, and XWnt-
8-, Dsh⌬DEP-, or CK1⑀-induced axis duplication in Xenopus
embryos in vivo.
We mapped the domain of physical interaction between
␤-arrestin and Dvl (9, 10) to a region N-terminal of the PDZ
domain of Dvl and aa163–300 of ␤-arrestin. This stretch of Dvl
contains important CK1␧ (21), PAR-1 (20, 22), and possibly also
casein kinase 2 (CK2) (30) phosphorylation sites, which may
work as potential regulators of ␤-arrestin–Dvl interaction. Importantly,
CK1, CK2, and PAR-1 are all necessary for Wnt/␤catenin
signaling (20, 31, 32), and at least CK1␧ and CK2 kinase
activity is induced directly by Wnts (16, 23, 33). It has been
reported that the association of Dvl with ␤-arrestin is potentiated
by CK2 phosphorylation (9), and we report herein that this
interaction is reduced by CK1 inhibition, a finding that also
supports this hypothesis. We also found that cells lacking ␤-arrestin
resemble cells with CK1␦/␧ knockdown (7, 16) in their
inability to form PS-Dvl properly in response to Wnt. We thus
suggest that the formation of the activated form of Dvl, PS-Dvl,
is initiated by and depends on Dvl phosphorylation by Wntinduced
kinases, as we demonstrated previously for CK1␧ (7, 16).
In this model, ␤-arrestin recognizes phosphorylated (primed)
Dvl and subsequently recruits other kinases to complete PS-Dvl
formation and Dvl activation. A second function of ␤-arrestin
that is likely to be crucial for Wnt signaling is its capacity to bind
axin directly. This binding did not require the DIX domain of
axin, which is necessary for the interaction of Dvl (7). This
finding suggested the possibility of a trimeric complex consisting
of Dvl, ␤-arrestin, and axin, which was confirmed by coimmunoprecipitation
experiments. We hypothesize that such a trimeric
complex could contribute to destabilize the degradation
complex, resulting in the stabilization of ␤-catenin. Thus, our
results suggest that the formation of a trimeric complex is an
essential step in Wnt signaling that provides a molecular link
between the LRP6/axin and FZD/Dvl branches of Wnt signaling
after activation.
Experiments in ␤-arrestin-deficient MEFs suggest that ␤-arrestins
1 and 2 might be at least partially redundant with respect
to mediating Wnt signaling and activation. Interestingly, unstimulated
␤-arr1/2KO MEFs contain a higher amount of PS-Dvl
and higher background activity in the TOPflash reporter assay
compared with WT and ␤-arr1KO or ␤-arr2KO MEFs, indicating
that mechanisms exist to accomplish the formation of PS-Dvl
in the absence of ␤-arrestin. These compensatory mechanisms
become evident also regarding the obvious delay and decrease
in efficacy of Wnt-3a-induced PS-Dvl formation rather than a
complete block. It is possible that high concentrations of Wnt or
long-term exposure may to some extent lead to PS-Dvl formation
in MEFs deficient in ␤-arrestins, although not to the same extent
as in WT MEFs. These findings show that ␤-arrestin is not
indispensable for PS-Dvl formation and suggest that redundant
mechanism(s) exist, which is also evident from the quantification
of PS-Dvl/Dvl data (SI Fig. 7), indicating that absence of
␤-arrestin2 alone has a more pronounced effect on Dvl activation
compared with cells depleted of both ␤-arrestins. However,
␤-arrestin seems to be uniquely required for proper dynamics of
the PS-Dvl formation and for correct Wnt signaling in vivo, as
demonstrated by the dramatic defects in ␤-arrestin-depleted
Xenopus embryos. It should be noted, however, that although
␤-arrestin is a necessary component for Wnt signaling, it is not
sufficient to induce PS-Dvl formation (Fig. 1A) or axis duplication
in Xenopus embryos (Fig. 5). Thus, our data suggest that
␤-arrestin is required, but not sufficient, for Wnt signaling and
that ␤-arrestin is recruited to Wnt signaling upon Wnt activation.
Our findings regarding the necessity of ␤-arrestin for Wnt
signaling, together with the recognized function of ␤-arrestins as
multifunctional adapter proteins, also open other interesting possibilities
such as that ␤-arrestin might be necessary for other
signaling pathways or that ␤-arrestin might mediate an interaction
between Wnt and other signaling pathways (12). This assumption
is further supported by structural data indicating that the domain
of ␤-arrestin2 that binds Dvl (aa 163–300) lies in a region of the
protein containing large parts of the C-terminal ␤-fold (␤ sheet
X-XVI; see alignments of nonvisual vertebrate ␤-arrestins in SI Fig.
10). Thus, both the N and C termini of ␤-arrestin could remain open
for interaction with other partners after Dvl binding. ␤-Arrestins
are also known to play a very important role in clathrin-mediated
endocytosis (34). In addition, blockade of endocytosis by, for
example, hyperosmolar sucrose blocks Wnt-induced ␤-catenin signaling
(35) and down-regulates Dvl (36). Combined, these findings
together with the recently appreciated role of endocytosis in
Wnt/Frizzled signaling (10, 35, 37–40) suggest the provocative
possibility that ␤-arrestin-mediated endocytosis might be required
for some aspects of Wnt signal transduction, an issue that remains
to be explored.
In summary, we hereby identify ␤-arrestin as an integral component
of the Wnt signaling pathway. This finding opens up the
possibility that Wnts may signal through novel additional pathways,
allowing extensive cross-talk with other, e.g., G protein-coupled
receptor-dependent, pathways. Future studies will explore such
interactions and will focus on further elucidating the role of
␤-arrestin in Dvl activation and the function of the trimeric complex
formed by Dvl–␤-arrestin–axin in Wnt signaling.
Methods
Cell Culture, Transfection, and Treatments. SN4741 cells were obtained
from J. H. Son (14). WT MEFs and MEFs lacking
␤-arrestin1 (␤-arr1KO), ␤-arrestin2 (␤-arr2KO), or ␤-arrestins 1
and 2 (␤-arr1/2dKO) were a gift from R. J. Lefkowitz (41).
SN4741 cells were propagated in DMEM/10% FCS/2 mM
L-glutamine/50 units/ml penicillin/50 units/ml streptomycin/
0.6% glucose. MEFs and COS-7 cells were grown in identical
medium without glucose. Cells (40,000–60.000 per well) were
seeded in 24-well plates either directly (for biochemical analysis)
or on sterile coverslips (for microscopy). The next day, cells were
transfected (plasmids are listed in SI Materials and Methods) by
6694 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0611356104 Bryja et al.
using Lipofectamine 2000 or polyethylenimine at 0.8 ␮g/ml in
PBS (42). For confocal analysis, 0.2 ␮g per construct were used
according to the manufacturer’s instructions. Cells were harvested
for immunoblotting or immunocytochemistry 24 h after
transfection (for a detailed description of immunocytochemistry
and confocal analysis, see SI Materials and Methods). Treatment
with the D4476 (4-[4-(2,3-dihydro-benzo[1,4]dioxin-6-yl)-5pyridin-2-yl-1H-imidazol-2-yl]benzamide),
dissolved in DMSO,
was done in 24-well plates in the presence of 1 ␮l per well
FuGENE 6 reagent to increase cell penetration. For analysis of
cellular signaling, the cells were stimulated with mouse Wnt-3a
(from R&D Systems, Minneapolis, MN) for 2 h if not otherwise
stated. Control stimulations were done with 0.1% BSA in PBS.
For the TOPflash assay, see SI Materials and Methods.
Immunoprecipitation and Immunoblotting. Immunoprecipitation
was done as described previously (16). For domain-mapping
experiments, cells were lysed in 0.1% SDS instead of 0.5%
Nonidet P-40. Immunoblotting and sample preparation were
done as published previously (7). Protein extracts from X. laevis
embryos were obtained by using 20 ␮l of lysis buffer (150 mM
NaCl/1 mM EDTA/50 mM Tris⅐Cl, pH 7.4/0.5% Nonidet P-40)
supplemented with protease inhibitors per embryo. After sonication,
lysates were depleted of yolk and lipids by mixing with
30 ␮l of freon per embryo, vortexing, and spinning down (15 min
at 12,000 ϫ g). The upper phase was mixed with 5ϫ Laemmli
buffer (4:1), boiled, and analyzed further. A list of antibodies for
immunoblotting and immunoprecipitation is available in the SI
Materials and Methods.
Injection and Analysis of X. laevis Embryos. Capped mRNAs were
transcribed from linearized DNA templates (pCS2-Dsh⌬DEP,
psp64T-XWnt-8, psp64T-␤-catenin, pcDNA-HA-␤-arrestin2) by
using mMessage mMachine (Ambion, Austin, TX). For knockdown
experiments in Xenopus, a morpholino antisense oligonucleotide
targeted against Xenopus ␤-arrestin (␤-arrMO: 5ЈTCTCCCCCATCTTCCCAGCTCCGC-3Ј)
was used. Eggs from
human chorionic gonadotropin-treated females were fertilized
by standard methods and staged according to (43). Morpholino
and RNA were injected into the marginal zone of the ventral or
dorsal blastomeres of four-cell stage embryos in a total volume
of 4 nl. If not mentioned otherwise in the text, the following
amounts were injected: XWnt-8, 20 pg; ␤-catenin, 250 pg;
Dsh⌬DEP, 500 pg; ␤-arrestin2, 500 pg; CK1␧, 500 pg; ␤-arrMO,
0.4 pg. Embryos were cultivated as described previously (44).
For real-time RT-PCR total RNA was extracted from stage
10.5 embryos (Nucleospin II; Macherey Nagel, Du¨ren, Germany)
and reverse transcribed using Moloney murine leukemia
virus reverse transcriptase (Promega, Madison, WI). Real-time
PCR was carried out using iQ-SybrGreen Supermix on an iCycler
instrument (Bio-Rad, Hercules, CA). Primer sequences were:
ODC-U, 5Ј-gcc att gtg aag act ctc tcc att c; ODC-D, 5Ј-ttc ggg tga
ttc ctt gcc ac (45); Xnr-3 forward, 5Ј-aag aga tca aac ccg agt gc;
and Xnr-3 reverse, 5Ј-ctg tgg aac tgc aca agt gg. Expression levels
were calculated relative to ornithine decarboxylase and normalized
to uninjected controls.
We thank Dr. R. J. Lefkowitz (Duke University Medical Center) for
providing the ␤-arrestin KO MEFs, ␤-arrestin, and FZD4-GFP constructs,
and ␤-arrestin antibodies as well as for valuable discussions. Drs. S.
Yanagawa (Kyoto University, Kyoto, Japan), R. T. Moon (University of
Washington School of Medicine, Seattle, WA), O. Ossipova (Mt. Sinai
School of Medicine, New York, NY), T. C. Dale (Cardiff School of
Biosciences, Cardiff, U.K.), and J. M. Graff (University of Texas Southwestern
Medical Center, Dallas, TX) provided additional plasmids, and we
thank Dr. Son for SN4741 cells. This work was supported by the Swedish
Foundation for Strategic Research (INGVAR and Center of Excellence in
Developmental Biology), Swedish Research Council (VR), European
Union (Eurostemcell) (to E.A.), Karolinska Institutet (to E.A. and G.S.),
the Stiftelse Lars Hiertas Minne and Tore Nilsson Foundation (to G.S.),
MoEYS CR Grant MSM0021622430 (to V.B.), Swedish Society for Medical
Research and the Swedish Brain Foundation (Hja¨rnfonden) postdoctoral
fellowships (to G.S.), and Deutsche Forschungsgemeinschaft Grants DFG
GR 1802 (to D.G.) and DFG SCHA 965 (to A.S.).
1. Gordon MD, Nusse R (2006) J Biol Chem 281:22429–22433.
2. Huelsken J, Birchmeier W (2001) Curr Opin Genet Dev 11:547–553.
3. Nusse R (2005) Cell Res 15:28–32.
4. Nusse R (2003) Development (Cambridge, UK) 130:5297–5305.
5. Wharton KA (2003) Dev Biol 253:1–17.
6. Malbon CC, Wang HY (2006) Curr Top Dev Biol 72:153–166.
7. Bryja V, Schulte G, Arenas E (2006) Cell Signal 19:610–616.
8. Gonza´lez-Sancho JM, Brennan KR, Castelo-Soccio LA, Brown AM (2004) Mol
Cell Biol 24:4757–4768.
9. Chen W, Hu LA, Semenov MV, Yanagawa S, Kikuchi A, Lefkowitz RJ, Miller
WE (2001) Proc Natl Acad Sci USA 98:14889–14894.
10. Chen W, ten Berge D, Brown J, Ahn S, Hu LA, Miller WE, Caron MG, Barak
LS, Nusse R, Lefkowitz RJ (2003) Science 301:1391–1394.
11. Reiter E, Lefkowitz RJ (2006) Trends Endocrinol Metab 17:159–165.
12. Lefkowitz RJ, Shenoy SK (2005) Science 308:512–517.
13. Gurevich EV, Gurevich VV (2006) Genome Biol 7:236.
14. Son JH, Chun HS, Joh TH, Cho S, Conti B, Lee JW (1999) J Neurosci 19:10–20.
15. Schulte G, Bryja V, Rawal N, Castelo-Branco G, Sousa KM, Arenas E (2005)
J Neurochem 92:1550–1553.
16. Bryja V, Schulte G, Rawal N, Grahn A, Arenas E (2007) J Cell Sci 120:586–595.
17. Smalley MJ, Signoret N, Robertson D, Tilley A, Hann A, Ewan K, Ding Y,
Paterson H, Dale TC (2005) J Cell Sci 118:5279–5289.
18. Schwarz-RomondT,MerrifieldC,NicholsBJ,BienzM(2005)JCellSci118:5269–5277.
19. Angers S, Thorpe CJ, Biechele TL, Goldenberg SJ, Zheng N, MacCoss MJ,
Moon RT (2006) Nat Cell Biol 8:348–357.
20. Ossipova O, Dhawan S, Sokol S, Green JB (2005) Dev Cell 8:829–841.
21. Klein TJ, Jenny A, Djiane A, Mlodzik M (2006) Curr Biol 16:1337–1343.
22. Sun TQ, Lu B, Feng JJ, Reinhard C, Jan YN, Fantl WJ, Williams LT (2001)
Nat Cell Biol 3:628–636.
23. Swiatek W, Tsai IC, Klimowski L, Pepler A, Barnette J, Yost HJ, Virshup DM
(2004) J Biol Chem 279:13011–13017.
24. Rena G, Bain J, Elliott M, Cohen P (2004) EMBO Rep 5:60–65.
25. Tamai K, Zeng X, Liu C, Zhang X, Harada Y, Chang Z, He X (2004) Mol Cell
13:149–156.
26. Axelrod JD, Miller JR, Shulman JM, Moon RT, Perrimon N (1998) Genes Dev
12:2610–2622.
27. Smalley MJ, Sara E, Paterson H, Naylor S, Cook D, Jayatilake H, Fryer LG,
Hutchinson L, Fry MJ, Dale TC (1999) EMBO J 18:2823–2835.
28. Kishida S, Yamamoto H, Hino S, Ikeda S, Kishida M, Kikuchi A (1999) Mol
Cell Biol 19:4414–4422.
29. Li L, Yuan H, Weaver CD, Mao J, Farr GH, Sussman DJ, Jonkers J, Kimelman
D, Wu D (1999) EMBO J 18:4233–4240.
30. Willert K, Brink M, Wodarz A, Varmus H, Nusse R (1997) EMBO J 16:3089–3096.
31. Dominguez I, Mizuno J, Wu H, Song DH, Symes K, Seldin DC (2004) Dev Biol
274:110–124.
32. Peters JM, McKay RM, McKay JP, Graff JM (1999) Nature 401:345–350.
33. Gao ZH, Seeling JM, Hill V, Yochum A, Virshup DM (2002) Proc Natl Acad
Sci USA 99:1182–1187.
34. Goodman OB, Krupnick JG, Santini F, Gurevich VV, Penn RB, Gagnon AW,
Keen JH, Benovic JL (1996) Nature 383:447–450.
35. Blitzer JT, Nusse R (2006) BMC Cell Biol 7:28.
36. Bryja V, Caja´nek L, Grahn A, Schulte G (2007) Acta Physiol Scand 190:53–59.
37. Seto ES, Bellen HJ (2006) J Cell Biol 173:95–106.
38. Rives AF, Rochlin KM, Wehrli M, Schwartz SL, DiNardo S (2006) Dev Biol
293:268–283.
39. Marois E, Mahmoud A, Eaton S (2006) Development (Cambridge, UK)
133:307–317.
40. Yamamoto H, Komekado H, Kikuchi A (2006) Dev Cell 11:213–223.
41. Kohout TA, Lin FS, Perry SJ, Conner DA, Lefkowitz RJ (2001) Proc Natl Acad
Sci USA 98:1601–1606.
42. Lundgren TK, Scott RP, Smith M, Pawson T, Ernfors P (2006) J Biol Chem
281:29886–29896.
43. Nieuwkoop PD, Faber J (1967) Normal Table of Xenopus laevis (Elsevier/
North–Holland, Amsterdam).
44. Ku¨hl M, Finnemann S, Binder O, Wedlich D (1996) Mech Dev 54:71–82.
45. Yokota C, Kofron M, Zuck M, Houston DW, Isaacs H, Asashima M, Wylie CC,
Heasman J (2003) Development (Cambridge, UK) 130:2199–2212.
Bryja et al. PNAS ͉ April 17, 2007 ͉ vol. 104 ͉ no. 16 ͉ 6695
CELLBIOLOGY
VIII
human β−arrestin 1 isoform A
human β−arrestin 1 isoform B
human β−arrestin 2 isoform 1
human β−arrestin 2 isoform 2
mouse β−arrestin 1 isoform A
mouse β−arrestin 1 isoform B
mouse β−arrestin 2
Xβ−arrestin 2-like
Xβ−arrestin 2-like
human β−arrestin 1 isoform A
human β−arrestin 1 isoform B
human β−arrestin 2 isoform 1
human β−arrestin 2 isoform 2
mouse β−arrestin 1 isoform A
mouse β−arrestin 1 isoform B
mouse β−arrestin 2
Xβ−arrestin 2-like
Xβ−arrestin 2-like
human β−arrestin 1 isoform A
human β−arrestin 1 isoform B
human β−arrestin 2 isoform 1
human β−arrestin 2 isoform 2
mouse β−arrestin 1 isoform A
mouse β−arrestin 1 isoform B
mouse β−arrestin 2
Xβ−arrestin 2-like
Xβ−arrestin 2-like
human β−arrestin 1 isoform A
human β−arrestin 1 isoform B
human β−arrestin 2 isoform 1
human β−arrestin 2 isoform 2
mouse β−arrestin 1 isoform A
mouse β−arrestin 1 isoform B
mouse β−arrestin 2
Xβ−arrestin 2-like
Xβ−arrestin 2-like
high consensus – red
low consensus – blue
neutral color - black
XX
XVII XVII XIX
VIIVIVIII IVII α-I
α-I
XVIXII XIII XIV XVIX X XI
I
Bryja et al. Figure S1
A B
DEP
Flag-Dvl3 mutants
WB: HA
IP:HA-β-arrestin
TCL:
100
75
50
37
75
37
kDa
100
50
1 2 3 4 5 6 7
WB:
Flag
WB:
Flag
2*
WB:
Flag
WB: Myc
WB:
Flag
IP:Myc-Dvl2IP:Flag-β-arrestin2
1 2 3 4 5
37
20
25
15
50
kDa
Flag-β-arrestin2 mutants
37
20
25
15
50
WB:
Flag
WB:
Myc
IP:FLAG-β-arrestin2
WB:
Flag
WB:
Myc
IP:XDsh-Myc
XDsh-Myc- +
+ +
+
- -
-
FLAG-β-arr2(163-300)
XDsh-Myc- +
+ +
+
- -
-
FLAG-β-arr2(163-300)
C
Bryja et al. Figure S2
Bryja et al. Figure S3
A
B
C β-arr1KO MEFs
Wnt-3a - +
ABC
β-catenin
actin
P-Lrp6
β-arr1KO MEFs
Wnt-3a
100 ng/ml
Dvl2
0 30 60 min
0 30 100 ng/ml
Dvl2
Wnt-3a
wt
β-arr1KOβ-arr2KOβ-arr1/2dKO
β-arr1
β-arr2
Dvl2-Myc
-FZD4
+FZD4
MEF wt MEF β-arr1/2dKO
Bryja et al. Figure S4
Bryja et al. Figure S5
0 20 40 60 80 100 120
0
20
40
60
80
100
120 MEF wt
MEF β-arr2KO
MEF β-arr1/2dKO
time [min]
ratioPS-Dvl/Dvl
%ofmaxresponse
0 10 100
0
20
40
60
80
100
120
log Wnt-3a [ng/ml]
ratioPS-Dvl/Dvl
%ofmaxresponse
*
** ***
***
***
**
***
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#6 
 
 
Bryja V 1
, Schambony A 1
, Čajánek L, Dominguez I, Arenas E*, Schulte G* (2008): beta‐
Arrestin and casein kinase 1/2 define distinct branches of non‐canonical WNT signalling 
pathways. EMBO Rep. 9(12): 1244‐50. Featured article. 
1
 equal contribution, * corresponding author 
 
 
Impact factor (2008): 7.099 
Times cited (without autocitations, WoS, Feb 21st 2014): 15 
Significance: This study defined the role of β‐arrestin in non‐canonical Wnt pathways. 
We first described, both in vitro and in Xenopus system, that involvement of β‐
arrestin  can  serve  as  a  discriminant  of  the  branch  involving  activation  of  small 
GTPase Rac1. In contrast, activity of casein kinase 1 (and phosphorylation of Dvl 
by this kinase) prevents Rac1 activation and triggers other, not yet well defined 
pathway. 
Contibution  of  the  author/author´s  team:  All  in  vitro  work,  design  of  the  in  vivo 
experiments. 
 
 
   
 
 
 
b-Arrestin and casein kinase 1/2 define distinct
branches of non-canonical WNT signalling pathways
Vı´te˘zslav Bryja1,2*, Alexandra Schambony3w*, Luka´s˘Cˇaja´nek1, Isabel Dominguez4, Ernest Arenas1+
& Gunnar Schulte5++
1Laboratory of Molecular Neurobiology, Department of Medical Biochemistry & Biophysics, Karolinska Institutet, Stockholm,
Sweden,2InstituteofBiophysicsofAcademyofSciencesoftheCzechRepublic& InstituteofExperimentalBiology,FacultyofScience,
Masaryk University, Brno, Czech Republic, 3Zoologisches Institut II, Universita¨t Karlsruhe (TH), Karlsruhe, Germany, 4Boston
University, Boston, Massachusetts, USA, and 5Section of Receptor Biology & Signaling, Department of Physiology & Pharmacology,
Karolinska Institutet, Stockholm, Sweden
Recent advances in understanding b-catenin-independent WNT
(non-canonical) signalling suggest an increasing complexity,
raising the question of how individual non-canonical pathways
are induced and regulated. Here, we examine whether intracellular
signalling components such as b-arrestin (b-arr) and
casein kinases 1 and 2 (CK1 and CK2) can contribute to
determining signalling specificity in b-catenin-independent
WNT signalling to the small GTPase RAC-1. Our findings indicate
that b-arr is sufficient and required for WNT/RAC-1 signalling,
and that casein kinases act as a switch that prevents the activation
of RAC-1 and promotes other non-canonical WNT pathways
through the phosphorylation of dishevelled (DVL, xDSH in
Xenopus). Thus, our results indicate that the balance between
b-arr and CK1/2 determines whether WNT/RAC-1 or other
non-canonical WNT pathways are activated.
Keywords: convergent extension movements; RAC-1; RHO-like
GTPases; Xenopus laevis; WNT-5A
EMBO reports (2008) 9, 1244–1250. doi:10.1038/embor.2008.193
INTRODUCTION
WNTs are secreted glycolipoproteins that activate b-catenindependent
and -independent (non-canonical) pathways. Several
recent reports have provided evidence for the complexity of the
non-canonical WNT pathways (Semenov et al, 2007). The
individual b-catenin-independent WNT branches, which mediate
planar cell polarity (for a list of abbreviations, see supplementary
information online) or convergent extension movements, are so
diverse that it has become necessary to name them by the signalling
components involved. Here, we refer to the following pathways as
defined in the original studies: WNT/RHO (Habas et al, 2003),
WNT/RAC-1 (Habas et al, 2003), WNT/Ca2 þ (Ku¨hl et al, 2001),
WNT/ROR2/CDC42 (Schambony & Wedlich, 2007) and WNT/
CK1/RAP1 (Tsai et al, 2007). b-Arrestin (b-arr) was recently found
to regulate WNT/b-catenin signalling (Bryja et al, 2007b) and
convergent extension movements in Xenopus laevis through RHOA
(Kim & Han, 2007). The frequent involvement of b-arr in WNT
signalling prompted us to examine whether it mediates the effects of
WNTs on other branches of non-canonical signalling.
We found that b-arr was required for WNT/RAC-1 signalling,
but was not essential for the WNT/ROR2/CDC42 pathway.
Furthermore, in vitro and in vivo data support that CK1/2 prevent
the activation of RAC-1, but promote the formation of phosphorylated
and shifted dishevelled (PS-DVL; dishevelled, xDSH in
Xenopus). This indicates that the recruitment of b-arr to DVL selects
and is required for WNT/RAC-1 signalling, and that casein kinases
switch signalling from WNT/RAC-1 towards non-canonical
pathways mediated by PS-DVL.
RESULTS AND DISCUSSION
WNT-induced activation of RAC-1 requires b-arr
First, we examined the activation of small GTPases by WNT-5A
in mouse embryonic fibroblasts (MEFs) using GTPase pull-down
assays. Although WNT-5A, which does not affect b-catenin
signalling (supplementary Fig S1A online), activated RAC-1
(Fig 1A; supplementary Fig S1B online; 4.1-fold±0.8 standard
Received 11 August 2008; accepted 8 September 2008;
published online 24 October 2008
*These authors contributed equally to this work
+
Corresponding author. Tel: þ 46 8 52487663; Fax: þ 46 8 34 1960;
E-mail: ernest.arenas@ki.se
++
Corresponding author. Tel: þ 46 8 52487933; Fax: þ 46 8 34 1280;
E-mail: gunnar.schulte@ki.se
1
Laboratory of Molecular Neurobiology, Department of Medical Biochemistry &
Biophysics, Karolinska Institutet, Scheeles v¨ag 1, S-171 77 Stockholm, Sweden
2
Institute of Biophysics of Academy of Sciences of the Czech Republic & Institute
of Experimental Biology, Faculty of Science, Masaryk University, Kotlarska 2,
611 37 Brno, Czech Republic
3
Zoologisches Institut II, Universita¨t Karlsruhe (TH), Kaiserstrasse 12,
D-76131 Karlsruhe, Germany
4
Boston University, Boston, 650 Albany Street, Massachusetts 02118, USA
5
Section of Receptor Biology & Signaling, Department of Physiology & Pharmacology,
Karolinska Institutet, Nanna Svartz va¨g 2, S-171 77 Stockholm, Sweden
w
Present address: Developmental Biology Unit, Biology Department,
University of Erlangen-Nuremberg, Staudtstrasse 5, 91058 Erlangen, Germany
EMBO reports VOL 9 | NO 12 | 2008 &2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
scientificreportscientific report
1244
error of the mean, s.e.m.), it activated neither RHO-A nor CDC42
(supplementary Fig S1C online). Interestingly, the activation of
RAC-1 by WNT-5A was blocked in MEFs lacking b-arr1 and b-arr2
(b-arr1/2 double knock out (dKO)), arguing that b-arr is required
for WNT/RAC-1 signalling. In the same cells, WNT-5A-induced
formation of PS-DVL (Gonza´lez-Sancho et al, 2004; Bryja et al,
2007c) was less efficient and delayed compared with wild-type
MEFs (Fig 1B). It is important to note that although the lack of b-arr
interferes with WNT-induced dynamics of PS-DVL, it increases the
basal PS-DVL (Fig 1B). This suggests that b-arr is not necessary for
PS-DVL but modulates its formation. Re-transfection of b-arr1 in
dKO MEFs reduces the basal PS-DVL and restores the WNT-5Ainduced
activation of RAC-1 (supplementary Fig S1D online). To
analyse whether b-arr is sufficient for the activation of RAC-1, we
overexpressed b-arr2-FLAG in MEFs and observed increased
activation of RAC-1 (Fig 1C; supplementary Fig S1E online).
To confirm these results, we overexpressed b-arr2-FLAG and
downregulated xb-arr by using antisense morpholinos (Xb-arr MO;
Bryja et al, 2007b) in X. laevis embryos. We found that
overexpression of b-arr increased basal RAC-1 activity and
that it was decreased on downregulation (supplementary Fig S1F
online). Furthermore, the effect of the xb-arr MO could be
reversed by overexpression of MO-insensitive, murine b-arr,
emphasizing the specificity of the xb-arr MO. These findings
identify b-arr as a signalling component required for the regulation
of RAC-1 in vitro and in vivo. For functional analysis, we
performed Keller open-face explant elongation assays in X. laevis
embryos, an established measure of convergent extension (Keller
et al, 2003; Schambony & Wedlich, 2007). Both overexpression
and downregulation of b-arr modulated convergent extension, and
the latter was reversed by co-injection of the MO-insensitive
haemagglutinin (HA)-b-arr (supplementary Fig S1F online), confirming
previous results (Kim & Han, 2007). Kim & Han (2007)
showed that b-arr2 regulates convergent extension movements in
0
20
40
60
80
100
120
*
*
Percentageofelongatedexplants
n/#exp
131/9
97/8
27/2
57/4
xβ-Arr MO
xDSHΔDIX
caRHO-A
caRAC-1
++ + + + +
+
+
+
58/4
36/3
30/2 caCDC42+
xNR3+
Elongation
– + – +WNT-5A
GTP-RAC-1
WT dKO
RAC-1
β-Arr1/2A
C
GTP-RAC-1
FLAG
RAC-1
DVL2
β-Arr2-FLAG – +
A1CT
RAC-1
GTP-RAC-1
DVL2-MYC – + – +
DVL2-MYC
siRNA Ctrl β-Arr1/2E
WNT-5A (ng/ml)
β-Arr1/2 WT
β-Arr1/2 dKO
DVL2
DVL2
0 10 30 100
300
1000
5WNT-5A (min)
β-Arr1/2 WT
β-Arr1/2 dKO
DVL2
DVL2
0 15 30 60 120
B
D
Fig 1 | b-Arrestin is necessary for WNT-induced activation of RAC-1. (A) WNT-5A induced the activation of RAC-1 (GTP-RAC-1) in wild-type MEFs
but not in MEFs lacking b-arrestin (b-arr1/2 double knock out (dKO)). One representative experiment is shown; in total, three are summarized in
supplementary Fig S1B online. (B) WNT-5A-induced formation of phosphorylated and shifted (DVL2, open arrowhead; PS-DVL2, filled arrowhead)
in a dose- and time-dependent manner in wild-type and b-arr1/2dKO MEFs is shown. (C) The activation and expression of RAC-1 were monitored in
MEFs overexpressing b-arr2-FLAG. (D) Downregulation of b-arr is compensated by constitutively active RAC-1 and RHO-A. Keller open-face explants
were scored for elongation on injection with Xb-arr MO and indicated RNAs. Asterisks indicate values that are significantly different (P40.95, t-test)
from xb-arr MO. (E) Downregulation of b-arr1/2 expression by short interfering RNA (siRNA) in HEK293 cells does not affect the DVL2-MYCinduced
activation of RAC-1 (GTP-RAC-1). Levels of b-arr are detected by the A1CT antibody. ca, constitutively active; DVL/DSH, dishevelled;
HEK, human embryonic kidney; MEF, mouse embryonic fibroblast; MO, morpholino; WT, wild type.
b-Arrestin in the WNT/RAC-1 pathway
V. Bryja et al
&2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION EMBO reports VOL 9 | NO 12 | 2008
scientificreport
1245
X. laevis through RHO-A. Thus, our results, combined with those
reported by Kim & Han, suggest that various subsets of RHO
family GTPases are regulated by b-arr.
b-Arr acts upstream from RAC-1 in convergent extension
To examine the regulation of RAC-1 by b-arr, we analysed
the effect of the following RNAs encoding for WNT signalling
components on the convergent extension phenotype in b-arr
knockdowns: xDSHDDIX (a mutant lacking the DIX domain),
a constitutively active WNT/planar cell polarity DVL mutant,
constitutively active caRHO-A, caRAC-1 or caCDC42, and
xNR3, a WNT/b-catenin transcriptional target (Fig 1D; Ku¨hl
et al, 2001; Bryja et al, 2007b). Both RAC-1 and RHO-A
compensated for the lack of b-arr, and xDSHDDIX partly restored
explant elongation, whereas CDC42 and xNR3 had no effect
(Fig 1D). Complementary results from b-arr1/2 short interfering
RNA (siRNA) experiments indicate that b-arr is not required for the
DVL-induced activation of RAC-1 (Fig 1E). Other epistatic
experiments showed that RHO-A and RAC-1 act downstream
from xDSH in the regulation of convergent extension (supplementary
Fig S1H online). When discussing the WNT-induced
b-arr-dependent formation of PS-DVL, it is worthwhile mentioning
that WNT-3A does not induce the activation of RAC-1 in MEFs
(supplementary Fig S1I online), despite the fact that it induces
b-arr-dependent PS-DVL (Bryja et al, 2007b) with a similar time
course (Bryja et al, 2007c).
Taken together, these results indicate that: b-arr acts upstream
or on the level of DVL; RHO-A and RAC-1 but not CDC42 are
mediators downstream from b-arr and DVL; and the WNT/
b-catenin pathway is not involved in the observed phenotype.
b-Arr is not required for xWNT-5A/ROR signalling
It has been shown previously that WNT-regulated convergent
extension in X. laevis Keller explants is mediated by several
distinct molecular mechanisms (Tada et al, 2002). Although
xWNT-11 exerts its effects on convergent extension by activation
of the WNT/RAC-1, WNT/RHO and WNT/FZD7/Ca2 þ pathways
(Winklbauer et al, 2001; Habas et al, 2003), xWNT-5A is not
required for Keller explant elongation but instead for explant
constriction, and activates the WNT/ROR2/CDC42 pathway
(Unterseher et al, 2004; Schambony & Wedlich, 2007). To
examine the function of b-arr for xWNT-11 or xWNT-5A signals,
we examined whether b-arr mediated their effects in Keller
explants. Strikingly, only xWNT-11 (Fig 2A), but not xWNT-5A
(Fig 2B), was reversed by Xb-arr MO co-injection. Consistently,
the negative effects of xWNT-11 MO on explant elongation
were partly reversed by the overexpression of b-arr (Fig 2A);
however, b-arr did not restore constriction in xWNT-5A-depleted
explants (Fig 2B), arguing that b-arr is not involved in the
xWNT-5A/ROR2 pathway.
To relate the xWNT-11-induced pathway to the small GTPases,
we examined whether caRHO-A, caRAC-1 and caCDC42 or
dnRHO-A and dnRAC-1 (supplementary Fig S2A online) rescued
the effects of xWNT-11 MO or xWNT-11, respectively. Reduced
explant elongation in xWNT-11-depleted explants was partly
rescued by coexpression of caRHO-A and caRAC-1 (but not
caCDC42), and xWNT-11 overexpression was compensated by
dnRHO-A, dnRAC-1 and xDSHDDEP, a mutant lacking the
RAC-1-activating DEP domain (supplementary Fig S2B online;
0
20
40
60
80
100
120
Percentageofelongatedexplants
0
20
40
60
80
100
120
Percentageofconstrictedexplants
+
n/#exp 65/3 24/2 97/7
xWNT-5A
xβ-Arr MO
xWNT-5A MO
xβ-Arr
+ +
+
+
69/5
+
Elongation
Constriction
B
A
xβ-Arr+
Elongation
n/#exp
131/9
99/5
36/3
108/7
xWNT-11
xβ-Arr MO
xWNT-11 MO
+ +
+
+
44/3
+
0
20
40
60
80
100
120
*
*
Percentageofelongatedexplants
Fig 2 | b-Arrestin mediates WNT-11- but not WNT-5A-induced
gastrulation movements in Xenopus laevis embryos. Keller open-face
explant elongation (A,B, upper panels) and constriction (B, lower panel)
were scored in X. laevis embryos injected with indicated RNAs and
morpholinos (MOs). Asterisks indicate values that are significantly
different (P40.95, t-test) from xWNT-11 and xWNT-11 MO.
b-Arrestin in the WNT/RAC-1 pathway
V. Bryja et al
EMBO reports VOL 9 | NO 12 | 2008 &2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
scientificreport
1246
Habas et al, 2003). These experiments confirmed the crucial
function of RAC-1 and RHO-A downstream from xWNT-11 in
convergent extension movements and indicated that xWNT-11
signalling to RHO/RAC also includes xDSH.
CK1/2 as switches in non-canonical WNT signalling
It is known that WNTs directly activate at least two kinases: casein
kinase (CK)1 and CK2 (Willert et al, 1997; Swiatek et al, 2004;
Gao & Wang, 2006; Bryja et al, 2007d), which, in turn,
phosphorylate DVL to form PS-DVL. In line with these findings,
it has been shown previously that CK1d/e are crucial components
of the b-catenin-independent WNT signalling machinery (McKay
et al, 2001; Klein et al, 2006; Strutt et al, 2006; Bryja et al, 2007d).
Furthermore, it was recently shown that CK1e acts through the
small GTPases RAP1 (Tsai et al, 2007). Interestingly, CK1 and CK2
can physically interact with b-arr (Xiao et al, 2007), and we have
already shown that CK1 mediates communication between b-arr
and DVL in the WNT/b-catenin pathway (Bryja et al, 2007b).
To test whether PS-DVL and CK1 have a similar function in
b-arr-dependent WNT/RAC-1 signalling, we inhibited CK1
pharmacologically with D4476 (4-[4-(2,3-dihydro-benzo[1,4]dioxin-6-yl)-5-pyridin-2-yl-1H-imidazol-2-yl]benzamide).
As expected,
D4476 led to a reduction of basal PS-DVL2 levels but,
surprisingly, it increased the activation of RAC-1 (Fig 3A).
Similar results were obtained with the inhibition of CK2 by TBBt
(4,5,6,7-tetrabromo-2-azabenzotriazole; Fig 3A). The presence of
the DVL protein per se seems to be required for both the activation
of RAC-1 and the maintenance of RAC-1 expression levels
(supplementary Fig S3A online). Thus, DVL as a protein, but not
PS-DVL, which is dependent on CK1 and CK2, is required for the
activation of RAC-1. In summary, our data suggest that CK1 and
CK2, and possibly also PS-DVL, negatively regulate WNT/RAC-1
signalling in vitro.
Importantly, WNTs seem to concomitantly evoke the activation
of RAC-1/RHO-A (Habas et al, 2003; Fig 1A) and the formation of
PS-DVL (Gonza´lez-Sancho et al, 2004; Schulte et al, 2005; Bryja
et al, 2007d; Fig 1B), which depend on CK1 (Bryja et al, 2007d)
and CK2 (Gao & Wang, 2006; Fig 3A). Interestingly, PS-DVL is
usually formed 30–45 min after stimulation with WNT-5A (Bryja
et al, 2007d; Fig 1B), whereas RAC-1 was shown to be already
activated 5 min after stimulation (Kurayoshi et al, 2006), raising
the possibility that the activation of RAC-1 precedes the formation
of PS-DVL and activation of other branches of non-canonical
signalling. Can CK1/CK2 thus act as a switch between individual
B
CK1ε
DVL3-FLAG – – + +
– + – +
Actin
DVL3-FLAG
RAC-1
GTP-RAC-1
CK1ε
0
20
40
60
80
100
120
*
Percentageofelongated
explants
Elongation
n/#exp
131/9
97/8
50/4
xβ-Arr MO
CK1ε
CK2α
CK2β
++ + + +
+
+
+ + + +
+ +
++
– – – –
––––––
– – – – – –
+
43/3
48/3
40/3
+
+
200 30 pg
CA
GTP-RAC-1
RAC-1
DVL2
CK2CK1
– + – +
Elongation
n/#exp
131/9
38/3
xWNT-11 MO
CK1ε
CK2α
CK2β
+ + + + + + +
+
+
+
41/3
60/4
46/3
+
+
200 30 pg
148/10
37/3
36/3
0
20
40
60
80
100
120
Percentageofelongatedexplants
D
*
*
*
E
xWNT-11 MO
CK2 inhibitor
RAC-1
GTP-RAC-1
CK1 inhibitor
Inhibitor
CK1 inhibitor
CK2 inhibitor
+
+
*
Fig 3 | Casein kinases 1 and 2 differentially regulate the formation of PS-DVL and the activation of RAC-1. (A) The activation of RAC-1 (GTP-RAC-1),
and the expression levels of RAC-1 and DVL2/PS-DVL2 (DVL2, open arrowhead; PS-DVL2, filled arrowhead) in MEFs were monitored in the absence
(À) or presence ( þ ) of the CK1 (100 mM) or CK2 inhibitor (100 mM). (B) HEK293 cells were transfected with RAC-1-MYC in the presence of
DVL3-FLAG and/or CK1e. RAC-1-MYC activity (GTP-RAC-1) was determined by pull down, and RAC-1-MYC, DVL3-FLAG, CK1e and actin levels
were determined in cell lysates. Note the CK1e-induced mobility shift of DVL3-FLAG. (C,D) Explant elongation after downregulation of b-arrestin
(C; xb-arr MO) or xWNT-11 (D; xWNT-11 MO), in combination with CK1e, CK2a, CK2b and CK2a/b, or CK1 and CK2 inhibitors, was evaluated.
Asterisks indicate values that are significantly different (P40.95, t-test) from (C) xb-arr MO and (D) xWNT-11 MO. (E) Effect of xWNT-11 MO on
the activation of RAC-1 in the absence (À) and presence ( þ ) of CK1 or CK2 inhibitors was measured by active GTP-RAC-1 pull down from Xenopus
embryo lysates. Levels of RAC-1 in the lysates are shown in the lower panel. CK, casein kinase; HEK, human embryonic kidney; MEF, mouse
embryonic fibroblast; MO, morpholino; PS-DVL, phosphorylated and shifted dishevelled.
b-Arrestin in the WNT/RAC-1 pathway
V. Bryja et al
&2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION EMBO reports VOL 9 | NO 12 | 2008
scientificreport
1247
b-catenin-independent WNT pathways at the level of DVL? To test
this possibility, we induced the activation of RAC-1 directly by
DVL3 and studied the effects of CK1 on this process (Fig 3B).
Although overexpression of DVL3 increased the activation of
RAC-1, this positive effect on RAC-1 was abolished when the
formation of PS-DVL3 was induced by simultaneous CK1e
co-expression. Furthermore, we found, by using the AP-1 reporter
assay, that basal and DVL3––but not phorbolester––or ca-RAC-1induced
AP-1 activity was enhanced by treatment with D4476
(supplementary Fig S3B online). These data suggest that: PS-DVL
(mediated by CK1/CK2 activity) does not participate in the WNT/
b-arr/RAC-1/AP-1 pathway; and that the activation of CK1/CK2
and formation of PS-DVL leads to a change in the signalling
function of DVL, displacing it from the RAC-1 pathway.
CK 1 and 2 in the regulation of convergent extension
In vivo, we confirmed that both CK1 and CK2 are involved in and
required for the regulation of convergent extension movements in
Keller explants (supplementary Fig S3C online). However, we
observed differences in the ability of CK1 and CK2 to restore
elongation in xb-arr or xWNT-11-depleted explants. xb-arr MO
was not rescued by CK1e, CK2a or CK2 holoenzyme and only
partly by CK2b (Fig 3C). By contrast, CK2a, CK2b and CK2
holoenzyme, but not CK1e rescued xWNT-11 depletion (Fig 3D).
Consistently, xWNT-11 overexpression was rescued by dominant
negative (dn) CK2a, but not by dnCK1e (supplementary Fig S3D
online). Furthermore, in agreement with our biochemical data,
chemical inhibition of CK1 or CK2 restored explant elongation
(Fig 3D) and RAC-1 activity (Fig 3E) in xWNT-11 MO-injected
explants. Simultaneous downregulation of xWNT-11 and xDSH
(for optimizing xDSH MOs, see supplementary Fig S4A online)
resulted in an additive phenotype that was rescued by co-injection
of CK2a, but not CK2b (Fig 4A). Overall, these results indicate
that in vivo CK1e and CK2a do not positively regulate
Xb-arr-dependent branches of non-canonical signalling, and that
xWNT-11 activates not only b-arr/xDSH/RAC-1 signalling but also
xDSH-MYC/DAPI
CK1ε
xDSH-MYC/DAPI
CK1 inhibitor
xDSH-MYC/DAPI xDSH-MYC/DAPI
xDSH-MYC/DAPI xDSH-MYC/DAPI
ctrl xWNT-5A
xWNT-1 1xWNT-8
D
Other branches
of PS-DVL
signalling
β-Arrestin
RAC-1
CK2
CK1
WNT
PS-DVL
DVL DVL
0
20
40
60
80
100
120
* *
Percentageofelongatedexplants
A
n/#exp
131/9
46/4
xDSH MO
xWNT-11 MO
CK2α
+
24/2
23/2
+
+
CK2β+
+ + +
+++
Elongation
148/10
41/4
57/4
55/10
+
+
+
+
+
+
+
CK1 inhibitor
CK2 inhibitor
B
C
xDSH-MYC
xDSH-MYC
B62A12
+
CK1ε
CK1εK-RCK1inhibitor
–+ + + + + +
xW
NT-8xW
NT-5AxW
NT-11
WNT-5A in MEFs
xWNT-11 in Xenopus
Fig 4 | DVL-dependent and -independent function of casein kinases. (A) Convergent extension was quantified in embryos treated with both xDSH MO
and xWNT-11 MO in combination with overexpression of CK2a, CK2b or CK1, CK2 inhibition. Elongation of Keller explants was quantified. Asterisks
indicate values that are significantly different (P40.95, t-test) from xWNT-11 MO/xDSH MO. (B) Immunocytochemical localization of xDSH-MYC
(nuclear counterstain DAPI) in Xenopus mesoderm in control (ctrl), WNT- or CK1e-overexpressing or D4476-treated embryos. Arrowheads point
at membraneous xDSH-MYC. (C) Corresponding biochemical data. xDSH-MYC was detected in embryo lysates and analysed for the expression of
xDSH-MYC (xDSH, open arrowhead; PS-xDSH, filled arrowhead). The antigen B62A12 was used as a loading control. (D) Schematic view of the role
of casein kinases and b-arrestin in the regulation of formation of PS-DVL and WNT-induced signalling to RAC-1; for details, see text. CE, convergent
extension; CK, casein kinase; DAPI, 4,6-diamidino-2-phenylindole; DVL/DSH, dishevelled; MO, morpholino; PS-DVL, phosphorylated and shifted DVL.
b-Arrestin in the WNT/RAC-1 pathway
V. Bryja et al
EMBO reports VOL 9 | NO 12 | 2008 &2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
scientificreport
1248
other pathways that involve CK2, most likely WNT/Ca2 þ
signalling. This assumption is supported by the observation that
CK2a rescues convergent extension in PTX-treated explants
(unpublished observation).
Interestingly, the positive effect of inhibition of CK1 on
convergent extension was strictly xDSH dependent, whereas
inhibition of CK2 led to explant elongation (Fig 4A) and the
activation of RAC-1 (supplementary Fig S4B online) even after
knockdown of xWNT-11/xDSH. To address the requirement of
DVL for the CK-modulated activation of RAC-1 in mammalian
the cells, we used pretreatment with hyperosmolaric sucrose to
deplete cells of DVL (Bryja et al, 2007a). Under these conditions,
only inhibition of CK2 increased the activation of RAC-1, further
supporting the idea that CK2 but not CK1 mediates the activation
of RAC-1 at least partly independently of DVL (supplementary
Fig S4C online).
When we analysed xDSH subcellular localization (Fig 4B) in
response to D4476, we observed that inhibition of CK1 activity
resulted in translocation of xDSH-MYC to the cell membrane,
similar to the overexpression of xWNT-11, but not of xWNT-5A
or xWNT-8, whereas xDSH-MYC was found predominantly in
the cytoplasm in CK1e-overexpressing cells. The effect of the
treatment was also monitored by the decrease or increase of
PS-xDSH, respectively (Fig 4C). This indicates that submembraneous
DVL could represent a pool of DVL that is active in the RAC-1
pathway and that is not phosphorylated by CK1/2, but does not
form PS-DVL.
In summary, our data first suggest that b-arr is not essential
for the WNT/ROR2/CDC42 and non-canonical pathways involving
CK1/2 and PS-DVL. However, we found that b-arr is
selectively required for the WNT/RAC-1 pathway. This finding
selectively links WNT/RAC-1 signalling with other b-arr-regulated
pathways and functions, such as receptor endocytosis, internalization
and desensitization.
Second, our in vitro and in vivo data support that the formation
of PS-DVL (which requires CK1 and/or CK2) and the activation of
RAC-1 (which requires inhibition of CK1/2) represent independent
events, and potential ways to measure two b-catenin-independent
pathways activated by a common ligand (WNT5A or XWNT-11).
We propose that CK1 and CK2 can act as a central relay to select
the pathways and signalling components being positively and
negatively regulated (PS-DVL and RAC-1, respectively, schematized
in Fig 4D). Thus, CK1 and CK2 can be considered as
switches between individual branches of b-catenin-independent
WNT signalling.
METHODS
Cell culture, transfection and treatments. Wild-type MEFs and
MEFs lacking b-arr 1 and 2 (b-arr1/2dKO) were a gift from
Dr Lefkowitz (Kohout et al, 2001). MEFs and human embryonic
kidney (HEK) 293 cells were grown in DMEM, 10% FCS,
L-glutamine (2 mM), penicillin (50 U/ml) and streptomycin
(50 U/ml). Transfection and treatment with D4476, casein kinase 2
inhibitor I (Calbiochem, Nottingham, UK)-TBBt or recombinant
mouse WNT-5A (from R&D Systems, Abingdon, UK) were carried
out as described previously (Bryja et al, 2007c). For a list of
expression vectors, see the supplementary information online.
GTPase pull-down assay and immunoblotting. GST-PAK-CRIB
(for glutathione-S-transferase-p21-activated kinase-CDC42/RAC
interactive binding domain), GST-WASP-CRIB (WASP for Wiskott–
Aldrich syndrome protein) and GST-RHOtekin recombinant
proteins were coupled to glutathione sepharose beads for the
detection of activated RAC-1, CDC42 and RHO-A, respectively,
and the assay performed as described in the supplementary
information online. Immunoblotting and sample preparation were
carried out as described previously (Bryja et al, 2007c).
Xenopus oocytes and Keller explants. For RNA transcription and
oocyte injection, see the supplementary information online.
Embryos were cultivated until Nieuwkoop and Faber stage 10.5,
and Keller explants were prepared, cultivated and scored as
described previously (Unterseher et al, 2004). For inhibitor
treatment, D4476 and CK2 inhibitors were added to the medium
at 1 mM at the blastula stage (stage 8). xDSH-MYC translocation
was examined after injection of 100 pg xDSH-MYC RNA. At onset
of gastrulation (stage 10.5), the dorsal marginal zone and the
blastocoel roof were prepared and fixed in 4% formalin. Tissue
was stained with 9E10 anti-MYC, mounted and examined with a
laser scanning confocal microscope.
Supplementary information is available at EMBO reports online
(http://www.emboreports.org).
ACKNOWLEDGEMENTS
The study was supported by the Swedish Foundation for Strategic
Research (INGVAR and Center of Excellence for Developmental
Biology), Swedish Research Council, European Union (Eurostemcell),
Karolinska Institutet, A˚ ke Wiberg, Signe & Olof Wallenius, Jeanssons,
Tore Nilsson Foundations, German Research Foundation (DFG), Ministry
of Education and Grant Agency of the Academy of Sciences of the
Czech Republic and the European Molecular Biology Organization
(for more details, see supplementary information online).
CONFLICT OF INTEREST
The authors declare that they have no conflict of interest.
REFERENCES
Bryja V, Caja´nek L, Grahn A, Schulte G (2007a) Inhibition of endocytosis
blocks Wnt signalling to b-catenin by promoting dishevelled degradation.
Acta Physiol 190: 55–61
Bryja V, Gradl D, Schambony A, Arenas E, Schulte G (2007b) b-Arrestin is a
necessary component of Wnt/b-catenin signaling in vitro and in vivo.
Proc Natl Acad Sci USA 104: 6690–6695
Bryja V, Schulte G, Arenas E (2007c) Wnt-3a utilizes a novel low dose and
rapid pathway that does not require casein kinase 1-mediated
phosphorylation of Dvl to activate b-catenin. Cell Signal 19:
610–616
Bryja V, Schulte G, Rawal N, Grahn A, Arenas E (2007d) Wnt-5a induces
dishevelled phosphorylation and dopaminergic differentiation via a
CK1-dependent mechanism. J Cell Sci 120: 586–595
Gao Y, Wang HY (2006) Casein kinase 2 is activated and essential for
Wnt/b-catenin signaling. J Biol Chem 281: 18394–18400
Gonza´lez-Sancho JM, Brennan KR, Castelo-Soccio LA, Brown AM (2004) Wnt
proteins induce dishevelled phosphorylation via an LRP5/6-independent
mechanism, irrespective of their ability to stabilize b-catenin. Mol Cell
Biol 24: 4757–4768
Habas R, Dawid IB, He X (2003) Coactivation of Rac and Rho by Wnt/
Frizzled signaling is required for vertebrate gastrulation. Genes Dev 17:
295–309
Keller R, Davidson LA, Shook DR (2003) How we are shaped: the
biomechanics of gastrulation. Differentiation 71: 171–205
Kim GH, Han JK (2007) Essential role for b-arrestin 2 in the regulation of
Xenopus convergent extension movements. EMBO J 26: 2513–2526
Klein TJ, Jenny A, Djiane A, Mlodzik M (2006) CKIe/discs overgrown
promotes both Wnt-Fz/b-catenin and Fz/PCP signaling in Drosophila.
Curr Biol 16: 1337–1343
b-Arrestin in the WNT/RAC-1 pathway
V. Bryja et al
&2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION EMBO reports VOL 9 | NO 12 | 2008
scientificreport
1249
Kohout TA, Lin FS, Perry SJ, Conner DA, Lefkowitz RJ (2001) b-Arrestin 1
and 2 differentially regulate heptahelical receptor signaling and
trafficking. Proc Natl Acad Sci USA 98: 1601–1606
Ku¨hl M, Geis K, Sheldahl LC, Pukrop T, Moon RT, Wedlich D (2001)
Antagonistic regulation of convergent extension movements in
Xenopus by Wnt/b-catenin and Wnt/Ca2+
signaling. Mech Dev 106:
61–76
Kurayoshi M, Oue N, Yamamoto H, Kishida M, Inoue A, Asahara T, Yasui W,
Kikuchi A (2006) Expression of Wnt-5a is correlated with aggressiveness
of gastric cancer by stimulating cell migration and invasion. Cancer Res
66: 10439–10448
McKay RM, Peters JM, Graff JM (2001) The casein kinase I family: roles in
morphogenesis. Dev Biol 235: 378–387
Schambony A, Wedlich D (2007) Wnt-5A/Ror2 regulate expression of XPAPC
through an alternative noncanonical signaling pathway. Dev Cell 12:
779–792
Schulte G, Bryja V, Rawal N, Castelo-Branco G, Sousa KM, Arenas E
(2005) Purified Wnt-5a increases differentiation of midbrain
dopaminergic cells and dishevelled phosphorylation. J Neurochem 92:
1550–1553
Semenov MV, Habas R, Macdonald BT, He X (2007) SnapShot: noncanonical
Wnt signaling pathways. Cell 131: 1378
Strutt H, Price MA, Strutt D (2006) Planar polarity is positively regulated by
casein kinase Ie in Drosophila. Curr Biol 16: 1329–1336
Swiatek W, Tsai IC, Klimowski L, Pepler A, Barnette J, Yost HJ, Virshup DM
(2004) Regulation of casein kinase I e activity by Wnt signaling. J Biol
Chem 279: 13011–13017
Tada M, Concha ML, Heisenberg CP (2002) Non-canonical Wnt signalling
and regulation of gastrulation movements. Semin Cell Dev Biol 13:
251–260
Tsai IC, Amack JD, Gao ZH, Band V, Yost HJ, Virshup DM (2007) A WntCKIvare-Rap1
pathway regulates gastrulation by modulating SIPA1L1,
a Rap GTPase activating protein. Dev Cell 12: 335–347
Unterseher F, Hefele JA, Giehl K, De Robertis EM, Wedlich D,
Schambony A (2004) Paraxial protocadherin coordinates cell polarity
during convergent extension via Rho A and JNK. EMBO J 23: 3259–3269
Willert K, Brink M, Wodarz A, Varmus H, Nusse R (1997) Casein kinase 2
associates with and phosphorylates dishevelled. EMBO J 16: 3089–3096
Winklbauer R, Medina A, Swain RK, Steinbeisser H (2001) Frizzled-7
signalling controls tissue separation during Xenopus gastrulation. Nature
413: 856–860
Xiao K, McClatchy DB, Shukla AK, Zhao Y, Chen M, Shenoy SK, Yates JR,
Lefkowitz RJ (2007) Functional specialization of b-arrestin interactions
revealed by proteomic analysis. Proc Natl Acad Sci USA 104: 12011–12016
b-Arrestin in the WNT/RAC-1 pathway
V. Bryja et al
EMBO reports VOL 9 | NO 12 | 2008 &2008 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
scientificreport
1250
1
Supplementary table:
Table S1:
Expression vector Supplied by/reference
-arrestin2-FLAG R. J. Lefkowitz (HHMI, Durham, NC)
-arrestin2-HA R. J. Lefkowitz (HHMI, Durham, NC)
X -arrestin A. Schambony / D. Gradl
XDSH DIX R. T. Moon (HHMI, University of
Washington, Seattle, WA)
XDSH DEP R. T. Moon (HHMI, University of
Washington, Seattle, WA)
XDSH-MYC R. T. Moon (HHMI, University of
Washington, Seattle, WA)
caRHO A A. Schambony (Unterseher et al. 2004)
caRAC-1 A. Schambony (Unterseher et al. 2004)
caCDC42 K. Giehl (University Ulm, Germany)
dnRHO A A. Schambony (Unterseher et al. 2004)
dnRAC-1 A. Schambony (Unterseher et al. 2004)
XNR3 R. T. Moon (HHMI, University of
Washington, Seattle, WA), Kuehl et al.
2001
XWNT-11 R. T. Moon (HHMI, University of
Washington, Seattle, WA)
XWNT-5A R. T. Moon (HHMI, University of
Washington, Seattle, WA), Kuehl et al.
2001
XWNT-8 R. T. Moon (HHMI, University of
Washington, Seattle, WA), Kuehl et al.
2001
CK1 J. M. Graff (University of Texas, Dallas,
TX)
DVL3-FLAG R. T. Moon (HHMI, University of
Washington, Seattle, WA)
RAC-1-MYC Alan Hall (University College London,
UK)
CK2 Isabel Dominguez (Boston University,
MA, USA)
CK2 Isabel Dominguez (Boston University,
MA, USA)
CK1 K-R J. M. Graff (University of Texas, Dallas,
TX)
dnCAMKII R. T. Moon (HHMI, University of
Washington, Seattle, WA)
pAP1-tk-Luc Philippe Lefebvre
We are thankful to the above-mentioned researchers for generously providing vectors
used in this study.
2
Unterseher F, Hefele JA, Giehl K, De Robertis EM, Wedlich D, Schambony A (2004) Paraxial
protocadherin coordinates cell polarity during convergent extension via Rho A and JNK. EMBO
Journal 23: 3259-3269.
Kühl M, Geis K, Sheldahl LC, Pukrop T, Moon RT, Wedlich D (2001) Antagonistic regulation of
convergent extension movements in Xenopus by Wnt/beta-catenin and Wnt/Ca2+
signaling. Mech
Dev 106: 61-76
3
Supplementary information:
List of abbreviations:
AP-1 - activator protein 1
-arr1/2dKO MEFs - MEFs lacking both isoforms of -arrestin
ca - constitutively active
CE - convergent extension
CK1 - casein kinase 1
CK1 K-R - K to R mutation of CK1 (kinase dead)
CK2 - casein kinase 2
DAAM - Dishevelled-associated activator of morphogenesis
D4476 - (4-[4-(2,3-dihydro-benzo[1,4]dioxin-6-yl)-5-pyridin-2-yl-1H
-imidazol-2-yl]benzamide)
DVL (PS-DVL) - mammalian Dishevelled (phosphorylated and shifted DVL)
(X)DSH - Xenopus Dishevelled
ERK1/2 - extracellular signal-regulated kinase 1/2
FZD - Frizzled
GTPase - GTP hydrolase
GST - Glutathione-S-transferase
GST-PAK-CRIB - GST-p21-activated kinase-Cdc42/Rac interactive binding
GST-WASP-CRIB - GST-Wiskott-Aldrich Syndrome protein-CRIB
JNK - c-jun N terminal kinase
MEF - mouse embryonic fibroblast
MO - morpholino
PCP - planar cell polarity
PI3K - phosphatidylinositol-3’-kinase
PKB - protein kinase B
RAP1 - RAS-related protein 1, RAS proximate
RAC-1, RHO A, CDC42 - RHO-like GTPases
ROR2 - receptor tyrosine kinase ROR2
c-SRC - cytosolic tyrosine kinase identified from the oncogene src
4
SDS-PAGE - sodium dodecyl sulfate polyacrylamide gelelectrophosresis
SEM - standard error of the mean
WNT - acronym wingless (from Drosophila) and the oncogene int-1
X -arr - Xenopus -arrestin
XNR3 - Xenopus Nodal-related 3
XWNT - Xenopus WNT
5
Supplementary material and methods:
Small GTPase pull down
MEFs were serum starved overnight and stimulated with recombinant WNT-5A (200
ng/ml, R&D Systems) for 2 h. They were pretreated with high molar sucrose (2 h) and
a subsequent wash in norm-osmolaric medium or with CK1 (D4476) or CK2
inhibitors (100 M) as indicated. Transfected Hek293 cells were used 24 h
posttransfection for small GTPase pull down. Xenopus samples were obtained as
follows: embryos were injected into the marginal zone of the dorsal blastomeres at the 4cell
stage and cultivated until they reached stage 10.5. Fifty embryos per sample were
collected, lysed and processed. Cells were washed with ice cold PBS and subsequently
allowed to lyse in ice cold lysis buffer (10 mM Tris-Cl – pH = 7.5, 110 mM NaCl, 1
mM EDTA, 10 mM MgCl2, 1% Triton X-100, 0.1% SDS, 20 mM glycerolphosphate,
1 mM dithiotreitol, complete protease inhibitors (Roche) for 5
min. Crude cell lysates were spun down in chilled tubes at 14000 rpm for 5 min at
4°C. Supernatants (5% saved as input) were supplemented with bait proteins coupled
to glutathione sepharose beads and tubes were incubated rotating end-over-end at 4°C
for 15 min. Beads were washed 3 times with washing buffer (lysis buffer without SDS
and protease inhibitors) on ice and subsequently mixed with 2x Laemmli buffer. Each
sample was boiled (5 min) before loading on SDS-PAGE.
RNA injection and morpholino treatment of Xenopus oocytes
Capped mRNAs were transcribed from linearized DNA templates using mMessage
mMachine (Ambion). For knock-down experiments in Xenopus, morpholino antisense
oligonucleotides targeted against Xenopus -arrestin (Bryja et al. 2007), XWNT-11
(Pandur et al. 2002), XWNT-5A (Schambony & Wedlich 2007) and XDSH (Sheldahl
6
et al. 2003) were used. Eggs from HCG-treated females were fertilized by standard
methods and staged according to (Nieuwkoop., and Faber 1967). Morpholino
oligonucleotides, RNA and DNA were injected into the marginal zone of the dorsal
blastomeres of 4-cell stage embryos in a total volume of 4 nl. If not mentioned otherwise
in the text, the following amounts were injected: arrMO: 1 pmol, arrestin2: 500 g,
XWNT-5A: 100 pg, XWNT-11: 20 pg, XWNT-5A MO: 0.8 pmol, XWNT-11 MO: 1
pmol, XWNT-8: 20 pg, XDSH DIX: 500 pg, XDSH DEP: 500 pg, XDSH-myc: 100
pg, XDSH MO: 0,8 pmol, Xnr-3: 500 pg, CK1 : 500 pg, CK2 , CK2 : 200 pg,
dnCAMKII: 1ng, dnJNK: 500 pg, dnRHO A: 50 pg, dnRAC-1: 100 pg, pCS2-caRHO
A: 5 pg DNA, pCS2-caRAC-1: 10 pg DNA, pcDNA-caCDC42: 20 pg DNA.
siRNA for -arrestin1/2 knock-down
HEK293 cells were transfected with DVL2-MYC, RAC-1-MYC and either control
siRNA ((AA)UUCUCCGAACGUGUCACGU; Xeragon (Qiagen) made as a nonsilencing
siRNA which does not have matches with mammalian genes by a BLAST
search) or -arrestin1/2 siRNA ((AA)ACCUGCGCCUUCCGCUAUG (positions
172-190 and 175-193 relative to the start codons of mouse -arrestin 1 and -arrestin
2, respectively) from Dharmacon using GeneSilencer (Genlantec) reagent (GestyPalmer
et al. 2006). RAC-1 pull down assays were performed >72 h posttransfection
after overnight serum deprivation. Levels of -arrestin1/2 were monitored with
immunoblotting using the polyclonal A1CT antibody kindly provided by Prof RJ
Lefkwitz, HHMI, Duke University Medical Center, Durham, NC, USA.
AP-1 reporter assay
7
COS7 cells were transfected with with mixture of pAP1-tk-Luc (20 ng, (Benkoussa et
al. 2002)), pRL-TK (200 ng, internal control, Promega) and indicated expression
construct (200 ng of either pcDNA-DVL3-FLAG or 400 ng of pCS2-caRAC-1). pcDNA
was used to equalize the total amount of DNA to 0.7 ug per 1 well in 24-well plate. Cells
were serum starved 24 h after transfection by reducing serum to 1% and stimulated with
D4476(100 uM)/TPA (0.8 uM) or DMSO (control) for additional 18 hours. Following
treatments cells were lysed and further processed using Dual-Luciferase®
Reporter
1000 Assay System (Promega) according to manufacturer´s instructions and measured
on a MLX luminometer (Dynex Technologies). Each data point was run in duplicate
and three independent experiments were performed. Data were normalized to control
transfected COS7 cells.
References:
Benkoussa M, Brand C, Delmotte MH, Formstecher P, Lefebvre P (2002) Retinoic
acid receptors inhibit AP1 activation by regulating extracellular signal-regulated
kinase and CBP recruitment to an AP1-responsive promoter. Mol. Cell. Biol. 22:
4522-4534
Bryja V, Gradl D, Schambony A, Arenas E, Schulte G (2007) beta-Arrestin is a
necessary component of Wnt/beta-catenin signaling in vitro and in vivo. Proc.
Natl. Acad. Sci. U. S. A. 104: 6690-6695
Gesty-Palmer D, et al. (2006) Distinct beta-arrestin- and G protein-dependent
pathways for parathyroid hormone receptor-stimulated ERK1/2 activation. J. Biol.
Chem. 281: 10856-10864
Kim GH, Han JK (2007) Essential role for beta-arrestin 2 in the regulation of
Xenopus convergent extension movements. EMBO J. 26: 2513-2526
Nieuwkoop, P.D. and Faber, J. (1967). Normal table of Xenopus laevis. Normal table
of Xenopus laevis, (Amsterdam: Elsevier North-Holland Biochemical Press).
8
Pandur P, Läsche M, Eisenberg LM, Kühl M (2002) Wnt-11 activation of a noncanonical
Wnt signalling pathway is required for cardiogenesis. Nature 418: 636-
641
Schambony A, Wedlich D (2007) Wnt-5A/Ror2 regulate expression of XPAPC
through an alternative noncanonical signaling pathway. Dev. Cell 12: 779-792
Sheldahl LM, Slusarski DC, Pandur P, Miller JR, Kühl M, Moon RT (2003):
Dishevelled activates Ca2+
flux, PKC and CamKII in vertebrate embryos. J. Cell
Biol. 161: 769-777
9
Supplementary figures:
Fig. S1: (A) WT MEFs were treated with increasing doses of WNT-5A for 2 h. Cell
lysates were probed for DVL2 to monitor pathway activation. WNT-5A did not
change -catenin phosphorylation as detected by the anti active -catenin antibody
(ABC). (B) quantification of Fig. 1A. *** p=0.004 WT, WNT-5A vs. dKO, WNT-
5A; paired t-test. (C) GTPase pull down assays for CDC42, RHO A and RAC-1
show that WNT-5A (2 h) induces RAC-1 but not CDC42/RHO A activation in
WT MEFs. (D) -arrestin1/2 double-deficient MEFs (dKO) and dKO MEFs with
the re-expressed -arrestin1 (a kind gift of Robert Lefkowitz) were treated with 300
ng/ml Wnt5a. RAC-1 activity and the levels of RAC1 and DVL3 (open triangle)/PSDVL3
(full triangle) were analyzed. (E) The bar graph summarizes three
experiments as shown in Fig. 3C: * p=0.0161, paired t-test. (F) RAC-1 activity
was measured in Xenopus embryos after injection of -arr2-FLAG RNA and upon
X -arr morpholino (MO) treatment. For a control, MO treatment was combined
with overexpression of -arr2-FLAG. (G) Consistent with previous results (Kim &
Han 2007), we found that the downregulation of -arrestin with X arr MO, or the
overexpression of -arrestin, reduced the intrinsic elongation from 100% to
36.3±4.3% (± SEM) or 47.6±3.1%, respectively. Furthermore, the inhibition of
explant elongation by X arr MO was reversed by simultaneous injection of arrestin
RNA (Fig. 2A), demonstrating the specificity of the approach. (H) Inhibition
of explant elongation induced by overexpression of Dsh DIX, a PCP activating
mutant, was rescued by co-expression of dnRHOA or dnRAC1. (I) WNT-3A (2 h)
stimulation of WT MEFs did not induce RAC 1 activation.
10
Fig. S2: RAC-1/RHO A involvement in XWNT-11-mediated CE. (A) Keller explant
elongation was quantified in XWNT-11 MO-treated embryos in combination with
constitutively active small GTPases and in XWNT-11 overexpressing embryos in
combination with dominant negative small GTPases. (B) Effect of DSH DEP on
XWNT-11-induced CE defects in Xenopus embryos.
11
Fig. S3: Effects of CK1 and CK2 and on CE movements. (A) AP-1 activity was
measured by an luciferase-based reporter assay in control, DVL3-FLAGoverexpressing,
TPA (1 M)-treated or caRAC-1 expressing cells in the presence and
absence of the CK1 inhibitor D4476. Results were normalized to DMSO-treated
control cells. (B) DVL protein is required for basal RAC-1 expression as well as
activation. MEFs were pretreated with 0.45 M sucrose for 2 h to deplete endogenous
DVL (Bryja et al 2007). Subsequently cells were treated as indicated for 2 hours and a
RAC-1 pull down assay was performed. Immunoblotting of the pull down as well as
the total cell lysate was done to analyze RAC-1 activation (GTP-RAC-1), as well as
RAC-1 and DVL2 levels. (C) Explant elongation is shown after injection of CK1 ,
CK1 K-R, CK2 , and at different concentrations. (D) Keller explant elongation
was determined in CK1 or CK2-inhibitor-treated oocytes and in XWNT-11/dnCK1 or
CK2 expressing oocytes.
Reference:
Bryja V, Cajanek L, Grahn A, Schulte G (2007) Inhibition of endocytosis blocks Wnt
signalling to beta-catenin by promoting dishevelled degradation. Acta Physiol 190:
55-61
12
Fig. S4: (A) optimization of DSH MO. Keller explant elongation and constriction was
measured in the embryos that were treated with DSH MO alone and in combination
with casein kinase inhibitors. (B) RAC-1 activation (GTP-RAC-1) was measured in
embryo lysates that were subjected to parallel XWNT-11 and DSH MO treatment
with and without CK1 or CK2 inhibtion. RAC-1 levels are shown in the lower
immunoblot. (C) WT MEFs were treated with hyperosmolaric (0.45 M) sucrose for
two hours in combination with pharmacological inhibition of CK1 or CK2. After
RAC-1 pull down, cell lysates and precipitates were analysed by immunoblotting for
RAC-1/ DVL-2 and for GTP-RAC-1, respectively.
13
Individual financial support
Support for: V.B. from MSM0021622430 (Ministry of Education, Youth and Sports of
the Czech Republic), Grant Agency of the Academy of Sciences of the Czech Republic
(GAAV, KJB501630801) and EMBO Installation Grant; G.S. from Swedish Brain
Foundation (hjärnfonden) and Swedish Research Council (VR; 2007-2769 and 2007-
5595); A.S. from Deutsche Forschungsgemeinschaft (DFG SCHA 965); I.D. from
Karin Grunebaum Cancer Research Foundation.
β-arr2-FLAG - +
0.0
0.5
1.0
1.5
2.0
2.5
*
RAC-1activation
(foldofpcDNA)
Figure S1
Supplementary
Figures
B
1
2
3
4
5
***
RAC-1actication
(foldofctrlWT)
- +WNT-5A
WT dKOβ-arr1/2
- +
WNT-5A (ng/ml)
DVL2
active β-catenin
DVL2
0 10 30 100
300
1000
A
GTP-CDC42
CDC42
GTP-RHO A
RHO A
- +WNT-5A
WTβ-arr1/2
GTP-RAC-1
RAC-1
C
F
E
- + - +
GTP-RAC-1
control
RAC-1
β-arr2
Xβ-arr MO
*
GTP-RAC-1
RAC- 1
DVL2
- +
WNT-3A
0
20
40
60
80
100
120
%elongatedexplants
n/#exp 131/9 97/8 36/3 46/3
Xβ-arr MO
HA-β-arr
+ +
+ +
elongation
G
D
GTP-RAC-1
RAC-1
DVL3
- + - +WNT-5A
dKO
dKO+
β-arr1β-arr1/2
H
0
20
40
60
80
100
120
*
*
%elongatedexplants
elongation
n/#exp 131/9 85/5 40/3 40/3
DSHΔDIX
dn RHO A
+ +
+
I
dn RAC-1+
+
Figure S2
Supplementary
Figures
elongation
n/#exp
131/9
99/5
46/3
XWNT-11
DSHΔDEP
+ +
+
B
0
20
40
60
80
100
120
*
%elongatedexplants
n/#exp
108/7
61/4
60/4
XWNT-11 MO
caRHO A
caRAC-1
caCDC42
+ ++ +
+
+
+
40/3
elongation
0
20
40
60
80
100
120
*
*
*
*
%elongatedexplants
131/9
33/2
41/3
39/3
+ ++
+
+
XWNT-11
dnRHO A
dnRAC-1
A
ctrl
D
VL3-FLA
G
TPA
caR
A
C
-1
0
1
2
3
4
DMSO
CK1 inhib.
AP-1activity
foldofcontrol
0
20
40
60
80
100
120
*
*
*
*
%elongatedexplants
Figure S3
Supplementary
Figures
A
RAC- 1
DVL2
- +
sucrose
GTP-RAC-1
B
+
n/#exp
131/9
31/3
32/3
CK1 inhib.
CK2 inhib.
+
148/10
37/3
+ dnCK1ε
dnCK2α
XWNT-11+ +
0
20
40
60
80
100
120
%elongatedexplants
n/#exp 131/9 44/343/3
CK1ε
CK2α
CK2β
43/3 39/3 43/3 28/2
CK1ε K-Rctrl 200 pg 30 pg
CK2α/β
CK2α/β
elongation
C D
+
XWNT-11 MO+ ++
+
+
+
elongation
36/3
99/5
40/3
33/2
Figure S4
A
n/#exp
131/9
49/4
46/4
DSH MO (pmol)
CK1 inhib
0.8
24/2
23/2
CK2 inhib
1.6
1.6
1.6
+
+
0
20
40
60
80
100
120
%constrictedexplants
constriction
C
DVL2
- - +CK2 inhib.
GTP-RAC-1
ctrl sucrose
RAC-1
- - +
- + -CK1 inhib. - + -
Supplementary
Figures
B
CK2
inhib
RAC-1
GTP-RAC-1
CK1 inhib
DSH MO
- - + -
- - +
- + + +
XWNT-11 MO + + +
0
20
40
60
80
100
120
*
%elongatedexplants
elongation
Vítězslav Bryja, 2014    Attachments 
 
 
#7 
 
 
Bryja V1
, Andersson ER1
, Schambony A1
, Esner M, Bryjová L, Biris KK, Hall AC, Kraft B, 
Cajanek L, Yamaguchi TP, Buckingham M, Arenas E. (2009): The Extracellular Domain of 
Lrp5/6 Inhibits Non‐Canonical Wnt Signaling in vivo. Mol Biol Cell. 20: 924‐936. Cover 
article. 
1
 equal contribution 
 
 
Impact factor (2009): 5.979 
Times cited (without autocitations, WoS, Feb 21st 2014): 28 
Significance: The first evidence of the fact that extracellular domain of Lrp6, a receptor 
dedicated to Wnt/β‐catenin signaling can block non‐canonical Wnt signaling via 
sequestration  of  Wnt  ligands  activating  non‐canonical  Wnt  pathway.  This 
interaction is physiologically relevant and is demonstrated both in mouse and in 
frog at several developmental processes. 
Contibution  of  the  author/author´s  team:  Coordination  of  the  study.  Biochemical 
analysis and generation/phenotype analysis of compound mouse mutants. 
 
 
   
 
 
 
Molecular Biology of the Cell
Vol. 20, 924–936, February 1, 2009
The Extracellular Domain of Lrp5/6 Inhibits Noncanonical
Wnt Signaling In Vivo
Vitezslav Bryja,*†‡
Emma R. Andersson,*‡
Alexandra Schambony,‡§ሻ
Milan Esner,¶#
Lenka Bryjova´,*†
Kristin K. Biris,@
Anita C. Hall,*,
** Bianca Kraft,§
Lukas Cajanek,*
Terry P. Yamaguchi,@
Margaret Buckingham,¶
and Ernest Arenas*
*Laboratory of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics, Center for
Developmental Biology and Regenerative Medicine, Karolinska Institute, SE-171 77 Stockholm, Sweden;
§
Zoologisches Institut II, Universita¨t Karlsruhe (TH), D-76131 Karlsruhe, Germany; ¶
Centre National de la
Recherche Scientifique Unite´ de Recherche Associe´e 2578, Department of Developmental Biology, Pasteur
Institute, 75 724 Paris Cedex 15, France; @
Cancer and Developmental Biology Laboratory, Center for Cancer
Research, National Cancer Institute-Frederick, National Institutes of Health, Frederick, MD 21702; and
†
Department of Cytokinetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, 601 77,
Brno, Czech Republic and Institute of Experimental Biology, Faculty of Science, Masaryk University, 602 00,
Brno, Czech Republic
Submitted July 11, 2008; Revised November 20, 2008; Accepted November 21, 2008
Monitoring Editor: Kunxin Luo
Lrp5/6 are crucial coreceptors for Wnt/␤-catenin signaling, a pathway biochemically distinct from noncanonical Wnt
signaling pathways. Here, we examined the possible participation of Lrp5/6 in noncanonical Wnt signaling. We found that
Lrp6 physically interacts with Wnt5a, but that this does not lead to phosphorylation of Lrp6 or activation of the
Wnt/␤-catenin pathway. Overexpression of Lrp6 blocks activation of the Wnt5a downstream target Rac1, and this effect
is dependent on intact Lrp6 extracellular domains. These results suggested that the extracellular domain of Lrp6 inhibits
noncanonical Wnt signaling in vitro. In vivo, Lrp6؊/؊ mice exhibited exencephaly and a heart phenotype. Surprisingly,
these defects were rescued by deletion of Wnt5a, indicating that the phenotypes resulted from noncanonical Wnt
gain-of-function. Similarly, Lrp5 and Lrp6 antisense morpholino-treated Xenopus embryos exhibited convergent extension
and heart phenotypes that were rescued by knockdown of noncanonical XWnt5a and XWnt11. Thus, we provide
evidence that the extracellular domains of Lrp5/6 behave as physiologically relevant inhibitors of noncanonical Wnt
signaling during Xenopus and mouse development in vivo.
INTRODUCTION
Wnts are extracellular lipoglycoproteins that activate several
downstream signaling pathways depending on cellular context.
The best defined pathways include the canonical Wnt/
␤-catenin pathway and the noncanonical Wnt/planar cell
polarity (PCP) pathway. These two pathways regulate distinct
biological processes. Certain components of Wnt signaling
machinery are, based on current evidence, believed to
be dedicated to only one of these two paths. Such components
include Wnt ligands, receptors/coreceptors, and cytoplasmic
components, in which Wnt1/Wnt3a, Lrp5/6
(XLRP5, and XLRP6 in Xenopus) and axin/APC/GSK3 are
usually associated with the canonical Wnt pathway (Clevers,
2006) and Wnt5a/Wnt-11, Vangl1/2, Celsr1, and Rho/
Rho kinase/c-Jun NH2-terminal kinase are associated with
the noncanonical Wnt pathway (Seifert and Mlodzik, 2007).
Deficiency in the core components of the vertebrate Wnt/
PCP pathway results in defects in embryonic development
that are different from the defects found in Wnt/␤-catenin
pathway mutants (van Amerongen and Berns, 2006; Seifert
and Mlodzik, 2007). The Wnt/PCP pathway is usually associated
with the regulation of cell polarity and/or cell migration.
In line with this, both gain-of-function (GOF) and lossof-function
(LOF) in Wnt/PCP often produce similar/
identical phenotypes (Fanto and McNeill, 2004; Klein and
Mlodzik, 2005; Schambony and Wedlich, 2007).
It was suggested that membrane proteins and proteoglycans
that act as Wnt coreceptors, e.g., Lrp5/6, Ror1/2, and
Knypek (Wehrli et al., 2000; Topczewski et al., 2001; Oishi et
al., 2003; Mikels and Nusse, 2006; Schambony and Wedlich,
2007), may be the factors deciding the predominant direction
of Wnt signaling. A large body of evidence suggests that
Lrp5 and Lrp6 are crucial coreceptors for Wnt/␤-catenin
signaling (Pinson et al., 2000; Tamai et al., 2000; Wehrli et al.,
2000). However, a recent report by Tahinci et al. (2007)
suggests that the intracellular part of Lrp6 can also act as an
This article was published online ahead of print in MBC in Press
(http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E08–07–0711)
on December 3, 2008.
‡
These authors contributed equally to this work.
Present addresses: ࿣
Developmental Biology Unit, Department of
Biology, University of Erlangen-Nuremberg, Staudtstrasse 5, 91058
Erlangen, Germany; #
Max-Planck Institute of Molecular Cell Biology
and Genetics, Screening facility, Pfotenhauerstrasse 108,
D-01307 Dresden, Germany; **Division of Cell and Molecular Biology,
Imperial College London, United Kingdom.
Address correspondence to: Vitezslav Bryja (bryja@sci.muni.cz) or
Ernest Arenas (ernest.arenas@ki.se).
924 © 2009 by The American Society for Cell Biology
inhibitor of noncanonical Wnt signaling in Xenopus. Yet, it is
not clear whether there is a general role of endogenous
Lrp5/6 as an inhibitor of noncanonical Wnt signaling, and
how Lrp5/6 achieves its inhibitory action.
Here, we performed in vitro and in vivo experiments,
both in Xenopus and mouse, to further define the involvement
of endogenous Lrp5/6 in noncanonical Wnt signaling.
We show that Wnt5a physically interacts with Lrp6, and
overexpression of Lrp6 inhibits the activity of the Rho GTPase
Rac1. Moreover, Lrp5 and/or Lrp6 deficiency in Xenopus
and mouse caused noncanonical Wnt gain of function
(GOF) defects, which could be rescued by ablation of noncanonical
Wnts. These data provide for the first time the
evidence that extracellular parts of Lrp5/6 can sequester
noncanonical Wnt ligands and act as physiologically relevant
inhibitors of noncanonical Wnt signaling in multiple
organs of Xenopus and mouse, including the heart and neural
tube, during vertebrate development.
MATERIALS AND METHODS
Tissue Culture
SN4741 cells were obtained from Dr. J. H. Son (Son et al., 1999). B1A and B1A
overexpressing hemagglutinin (HA)-Wnt5a (HA-Wnt5a-B1A) fibroblasts were a
kind gift of Jan Kitajewski (Columbia University, New York, NY; Shimizu et al.,
1997). SN4741 and human embryonic kidney (HEK) 293 cells were grown and
treated as described previously (Schulte et al., 2005; Bryja et al., 2007b).
Wnt3a and Wnt5a (R&D Systems, Minneapolis, MN) were tested for activity
using previously established protocols (Bryja et al., 2007a,b). Concentrations
required for maximal activity (Dvl shift) varied from batch to batch.
Western Blotting, Rac1 Activity Assay and
Immunoglobulin G (IgG) Pull-Down
Immunoblotting and sample preparation were done as published previously
(Bryja et al., 2007a). When required, signal intensity was quantified using
Scion Image densitometry software (Scion, Frederick, MD). Antibody details
are given in Supplemental Material. Activity of Rac1, Rho, and Cdc42 was
analyzed essentially as published previously (Unterseher et al., 2004). Briefly,
glutathione transferase (GST)-p21-activated kinase (PAK)-CDC42/Rac interactive
binding domain (CRIB), GST-Wiskott-Aldrich syndrome protein
(WASP)-CRIB, GST-RHOtekin recombinant proteins were coupled to glutathione-Sepharose
beads for detection of activated RAC-1, CDC42, and RHO
A, respectively. Cells were washed with ice-cold phosphate-buffered saline
(PBS) and subsequently allowed to lyse in ice-cold lysis buffer (10 mM Tris-Cl,
pH 7.5, 110 mM NaCl, 1 mM EDTA, 10 mM MgCl2, 1% Triton X-100, 0.1%
SDS, 20 mM ␤-glycerophosphate, 1 mM dithiothreitol, and complete protease
inhibitors (Roche Molecular Biochemicals, Indianapolis, IN) for 5 min. Crude
cell lysates were spun down in chilled tubes at 14,000 rpm for 5 min at 4°C.
Supernatants (5% saved as input) were supplemented with bait proteins
coupled to glutathione-Sepharose beads, and tubes were incubated rotating
end-over-end at 4°C for 15 min. Beads were washed three times with washing
buffer (lysis buffer without SDS and protease inhibitors) on ice and subsequently
mixed with 2ϫ Laemmli buffer. Each sample was boiled (5 min)
before loading on SDS-polyacrylamide gel electrophoresis (PAGE).
For analysis of the interaction of Lrp6 and Wnt5a by IgG pull-down, B1A
and HA-Wnt5a-B1A cells were transfected with Lipofectamine 2000 (Invitrogen,
Carlsbad, CA) with a vector encoding the extracellular part of Lrp6 fused
with human Fc fragment (Lpr6N-Fc; Tamai et al., 2000). After 2 d, culture
media were collected and supplemented with 0.5% NP-40, and remaining
cells were extracted for 15 min in ice-cold lysis buffer (50 mM Tris-HCl, pH
7.4, 150 mM sodium chloride, 0.5% NP-40, 1 mM EDTA, 1ϫ protease inhibitor
cocktail [Roche Diagnostics]) to generate samples of conditioned media and
cell lysate, respectively. Then samples were cleared by centrifugation at
15,000 ϫ g for 5 min at 4°C and incubated with protein G-coupled Sepharose
beads (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom)
overnight. Next day, beads were washed with lysis buffer five times, mixed
with 2ϫ Laemmli buffer, and subjected to SDS-PAGE.
Frog Handling, Microinjections, and Keller Explants
Embryos were obtained by in vitro fertilization, cultured, and injected as
described previously (Unterseher et al., 2004). Embryos were injected at the
four-cell stage in both dorsal blastomeres or at the eight-cell stage in one
dorsal blastomere. If not indicated otherwise, injection amounts of plasmids
were 60 pg of mLRP5 or mLRP6; 5 pg of constitutively active (ca) RhoA; 10 pg
of ca Rac 1; 100 pg of ␤-catenin, XWnt5a, dominant-negative (dn) RhoA, or dn
Rac 1; 20 pg of XWnt-11; and 100 pg of ␤-galactosidase; MOs were 0.8 pmol
(all MOs: GeneTools, Philomath, OR; sequences are given in Supplemental
Material). Keller open face explants for analysis of convergent extension
movements were prepared at stage 10.5 and cultured, imaged, and scored as
described previously (Unterseher et al., 2004). Statistical evaluation was performed
using Student’s t test. Whole mount in situ hybridizations were
carried out using the digoxigenin/alkaline phosphatase detection system
(Roche Molecular Biochemicals) as described previously (Hollemann et al.,
1999).
Mouse Strains and Genotyping
Lrp6 (Pinson et al., 2000) and Wnt5a (Yamaguchi et al., 1999a) mutant mice
were housed, bred, and treated in accordance with the ethical approval for
animal experimentation granted by Stockholms Norra Djurfo¨rso¨ks Etiska
Na¨mnd. The genotyping was performed by polymerase chain reaction and is
described in detail in Supplemental Material.
Whole-Mount in Situ Hybridization (ISH) of Mouse
Embryos
The original cDNA clones described in the literature were used as templates
for the generation of cRNA probes. Details are available upon request. Wholemount
in situ hybridization was performed as described previously (Wilkinson
and Nieto, 1993). Embryos were photographed on a stereoscope (Leica,
Wetzlar, Germany) or an Axiophot (Carl Zeiss, Jena, Germany) compound
microscope. Unless indicated otherwise, at least three mutant embryos were
examined with each probe, and all yielded similar results.
Heart Analysis in Mouse
Before embedding, embryos were fixed in 4% paraformaldehyde overnight,
and then they were incubated 12 h at 4°C in 15% sucrose in PBS. Embryos at
stage embryonic day (E) 10.5 were embedded in 7.5% gelatin/sucrose and at
stage E14.5 in Tissue-Tek OCT (Labonord, Villeneuve d’Ascq, France). Ten- to
16-␮m-thick sections were obtained using a cryostat. Slides were washed 2 ϫ
10 min in PBS at 37°C and stained for 30 min in 0.5% eosin solution (Labonord),
progressively dehydrated to 100% ethanol, and mounted into Cytoseal
(Richard Allan Scientific, Kalamazoo, MI).
RESULTS
Lrp6 Interacts with Wnt5a and Blocks Noncanonical Wnt
Signaling in Vitro
To analyze the involvement of Lrp6 in the noncanonical Wnt
pathway, we treated SN4741 cells with Wnt5a and used
Wnt3a (a canonical Wnt) for comparison. Treatment with
either Wnt (100 ng/ml) led to the phosphorylation of Dvl2
and Dvl3, detected by a mobility shift of the protein on
SDS-PAGE, as shown previously (Gonzalez-Sancho et al.,
2004; Schulte et al., 2005). Although both Wnt3a and Wnt5a
induced Dvl phosphorylation, only Wnt3a induced ␤-catenin
activation and Lrp6 phosphorylation at Ser1490 (Tamai
et al., 2004), as assessed by antibodies recognizing active
␤-catenin (ABC; the form of ␤-catenin dephosphorylated on
Ser37 and Thr41; van Noort et al., 2002) or pSer1490-Lrp6
(Figure 1A). These data demonstrated the ability of Wnt3a,
but not Wnt5a, to induce Wnt/␤-catenin signaling via phosphorylation
of Lrp6.
Wnt-induced phosphorylation of Lrp6 at Ser1490 was
shown to recruit axin to Lrp6 and promote further downstream
signaling to ␤-catenin (Tamai et al., 2004; Davidson et
al., 2005; Zeng et al., 2005). Wnt5a failed to activate Lrp6 and
the ␤-catenin pathway in SN4741 cells (Figure 1A), although
it induced phosphorylation of Dvl. Such activation of Dvl
was shown to be Lrp6-independent (Gonzalez-Sancho et al.,
2004). Based on this finding, it was expected that Wnt5a
should not interfere with Wnt3a-induced phosphorylation
of Lrp6. However, in Wnt3a-treated (20 ng/ml) SN4741
cells, Wnt5a efficiently reduced, in a dose-dependent manner,
theWnt3a-induced phosphorylation of Lrp6 at Ser1490
(Figure 1, B and C). These data suggested that Wnt5a directly
or indirectly interfered with the phosphorylation of
Lrp6 induced by Wnt3a. We therefore examined whether
Wnt5a could bind or physically interact with Lrp6.
Lrp5/6 in Noncanonical Wnt Signaling
Vol. 20, February 1, 2009 925
To explore this possibility, we overexpressed the extracellular
part of Lrp6 fused to the Fc fragment of human IgG
(Lrp6N-Fc; Tamai et al., 2000) in B1A fibroblasts and in B1A
fibroblasts overexpressing HA-tagged Wnt5a (HA-Wnt5a;
Shimizu et al., 1997). Cell lysates and serum free-conditioned
media were subjected to hFc (IgG) pull-down by incubation
Figure 1. Wnt5a can bind Lrp6, inhibit Lrp6 phosphorylation and Lrp6 inhibits Rac1 activation. (A) SN4741 cells were stimulated with 100
ng/ml Wnt3a or Wnt5a. Stimulation with either of these led to the phosphorylation of Dvl2 and Dvl3 (indicated by open arrowheads), as
assessed by a mobility shift in a Western blot. Only Wnt3a led to an increase in active ␤-catenin and phosphorylation of Lrp6 at Ser1490. (B)
Wnt5a inhibits Wnt3a-induced phosphorylation of Lrp6 at Ser1490, but not Dvl2 phosphorylation, in a dose-dependant manner. Total Lrp6
did not significantly change by Wnt treatment. Actin was used as loading control. The level of Lrp6 phosphorylation from three independent
experiments is quantified in C. (D) Lrp6 Fc can associate with HA-Wnt5a. Lrp6 Fc was overexpressed in HA-Wnt5a expressing B1A
fibroblasts (B1A fibroblasts were used as a control). Total cell lysates (TCL) or conditioned media (CM) were subjected to IgG pull-down, and
HA-Wnt5a was detected only in samples also expressing Lrp6-Fc. (E) Myc-tagged Lrp6 mutants lacking either E1 and E2 (Myc-Lrp6⌬E1-E2)
or E3 and E4 (Myc-Lrp6⌬E3-E4) were overexpressed in B1A, or B1A cells stably expressing HA-tagged Wnt5a. Cells lysates were
immunoprecipitated using antibody directed against HA-tag. Expression of Myc-Lrp6 and HA-Wnt5a in immunoprecipitates was determined
by Western blotting. (F) HEK cells were transfected with Myc-Rac1 and indicated Lrp6 constructs. The activation of Rac1 was
determined using Rac1 activation assay, and Western blot for Myc-Rac1. The signal ratio for GTP-Rac1/Rac1 was quantified and demonstrates
that only full length Lrp6, but not mutants in any of the extracellular domains of Lrp6, inhibited Rac1 activity.
V. Bryja et al.
Molecular Biology of the Cell926
with protein G-Sepharose beads and subsequent Western
blotting. As shown in Figure 1D, after IgG pull-down HAWnt5a
was present only in the samples expressing Lrp6-Fc
but not in any of the control conditions. Extracellular domains
E1 and E2 (YWTD EGF repeats), but not E3 and E4, of
Lrp6 are required for binding of Wnt5a to Lrp6 (Figure 1E)
as shown previously for Wnts activating the Wnt/␤-catenin
pathway (Mao et al., 2001). These results demonstrated that
the extracellular part of Lrp6 can physically interact with
Wnt5a. Because recombinant Wnt5a can induce the small
Figure 2. Lrp5/6 are crucial regulators of convergent extension (CE) movements in Xenopus. (A and B) Injection of Lrp5 or Lrp6 mRNA or
XLRP5/6 MOs all inhibit convergent extension of Keller explants from stage 10.5 that are rescued by mLrp5/6 but cannot be rescued by ␤-catenin
coinjection (*, significant difference from control; **, significant rescue of MO, p Ͼ 0.95). (C and D) The CE defects induced by XLRP5 MO or XLRP6
MO are not rescued by Wnt5a or Wnt11 overexpression or constitutively active (ca) RhoA and Rac1. However, down-regulation of noncanonical
signaling by XWnt5a or XWnt11 MO rescued XLRP5 and XLRP6 depletion phenotypes. XLRP5 MO induced inhibition of elongation was also
rescued by dn RhoA and Rac1 (**, significant rescue of MO; p Ͼ 0.95). (E) Typical morphology of Keller explants injected with XLRP5 and XLRP6
MOs. The numbers under the graphs indicate number of injected embryos/number of independent experiments.
Lrp5/6 in Noncanonical Wnt Signaling
Vol. 20, February 1, 2009 927
Rho GTPase Rac1 (Andersson et al., 2008), a downstream
component of the Wnt/PCP pathway, we next tested
whether activity of Rac1 was Lrp6 dependent. As we show
in Figure 1F, the overexpression of Lrp6 reduced the activity
of Rac1 (Figure 1F). Importantly, Lrp6 mutants lacking either
the Wnt-5a binding (⌬E1-E2; Figure 1E), or Dkk1 binding
(⌬E3-E4) or the entire extracellular domain (⌬E1-E4) of
Lrp6 (Mao et al., 2001) were not sufficient to reduce the
activity of Rac1. These findings suggested that extracellular
domains of Lrp5/6 may work as inhibitors of noncanonical
Wnts and prompted us to test this hypothesis in vivo.
XLRP5 Is Essential for Convergent Extension Movements
in Xenopus
In vertebrate embryos, ␤-catenin–independent Wnt pathways
regulate several developmental processes, including
convergent extension (CE) movements in the gastrulating
Xenopus embryo. To determine the importance of Lrp5 and
Lrp6 in Xenopus CE in vivo, we modulated the levels of
Lrp5/6 by injecting mRNAs encoding mouse Lrp5 or Lrp6
or antisense morpholino-oligonucleotides directed against
XLRP5 and XLRP6 (XLRP5 MO and XLRP6 MO, Supplemental
Figure S1A) and examined Keller explants of the
dorsal marginal zone. The scheme of timing of injections
performed in Xenopus embryos and subsequent analysis is
shown in Supplemental Figure S1B.
We show in Figure 2A, in agreement with Tahinci et al.
(2007) that XLRP5 MO strongly affected explant elongation,
whereas XLRP6 MO had less effect. However, depletion of
XLRP6 affected explant constriction (Figure 2B), which indicated
defective noncanonical Wnt signaling (Unterseher et
al., 2004; Schambony and Wedlich, 2007). Coinjection of both
XLRP MOs blocked elongation similarly to XLRP5 MO alone.
As expected, overexpression of mLrp5 or mLrp6 also affected
explant elongation similarly (Figure 2A). Coinjection of XLRP5
MO or XLRP6 MO with mLRP5 or mLRP6 induced a partial
Figure 3. (A) Embryos injected with mLRP5 or XLRP5 MO were lysed and analyzed for the activity of small GTPases Rac1 and Cdc42. (B)
XWnt5a- or XWnt11-induced CE defects can be partially rescued by coinjection of Lrp5 or Lrp6 (**, significant rescue of XWnt-11 and
XWnt-5a, respectively; p Ͼ 0.95). (C) Effects of FL and mutant hLRP6 on CE defects induced by XLRP5 MOs. hLRP6 and also hLRP6 lacking
cytoplasmic domain (hLRP6⌬C) can efficiently rescue XLRP5 MO defects, whereas hLRP6 lacking the extracellular domains E1-E4 cannot
(**, significant rescue of MO; p Ͼ 0.95). (D) Lrp6 lacking cytoplasmic domain (hLRP6⌬C) can rescue elongation defects caused by overexpression
of XWnt-11 or XWnt-5a. The numbers under the graphs indicate number of injected embryos/number of independent experiments.
V. Bryja et al.
Molecular Biology of the Cell928
rescue of explant elongation and constriction, respectively (Figure
2, A and B), indicating partial redundancy of LRP5/6 and
demonstrating that the effects of XLRP MOs were specific.
Importantly, the effects of XLRP5 depletion seem to be ␤-catenin
independent because coinjection of ␤-catenin RNA with
XLRP5 MO did not rescue the phenotype (Figure 2A).
It should be noted that, when injected into the dorsal
marginal zone, XLRP5 MO induced other defects, which
are associated with a ␤-catenin LOF, e.g., ventralization.
We scored these defects by calculating the dorso-anterior
index (Kao and Elinson, 1988) and found that XLRP5
MO-induced ventralization was rescued by coinjection of
mLrp5 and to the same extent also by ␤-catenin (Supplemental
Figure S1C), indicating that these phenotypes are
the result of defective canonical Wnt signaling caused by
XLRP5 depletion.
To identify the molecular mechanism responsible for the
observed phenotypes of XLRP5 knockdown in Xenopus embryos,
we performed a set of rescue experiments. We hypothesized
that if the XLRP5 knockdown caused an increase
in noncanonical Wnt signaling, as our in vitro experiments
suggested, negative but not positive regulators of noncanonical
Wnt signaling should rescue the phenotype. Coinjection
of XWnt5a, XWnt11, and ca forms of known downstream
effectors of Wnt/PCP pathway—ca RhoA and ca
Rac1 (Habas et al., 2003) did not rescue the phenotype (Figure
2C). Instead, inhibition of noncanonical Wnt pathways
by knockdown of XWnt5a or XWnt11 or dn forms of Rac1 or
RhoA were able to rescue XLRP5 MO. In XLRP6 MO, we
observed that coinjection of XWnt-11 MO but not XWnt-5a
MO restored constriction (Figure 2D). These and the previous
experiments suggest that the depletion of XLRP5/6
induced a noncanonical Wnt GOF phenotype.
These results indicate that Lrp5/6 interact with and sequester
noncanonical Wnts, partially preventing their physiological
activity and thereby inhibiting noncanonical signaling.
To test the possibility that Lrp5/6 overexpression
directly blocks the activity of small GTPases, we measured
the activity of Rac1 and Cdc42, two GTPases that have been
shown to be under the control of noncanonical Wnt signaling
in Xenopus embryos (Habas et al., 2003; Penzo-Mendez et
al., 2003; Kim and Han, 2005; Schambony and Wedlich,
2007). As we show in Figure 3A, overexpression of XLRP5
negatively regulates the activity of Rac1 and Cdc42. The
XLRP5 MOs have a weak positive effect, which, especially in
Cdc42, might be due to its effects on total Rac1/Cdc42. We
were unable to detect significant differences in the activity of
RhoA (data not shown). These results provide biochemical
support for the rescue experiments and demonstrate that
Lrp5 affects noncanonical Wnt signaling via modulation of
the activity of small GTPases.
To further test our model, we overexpressed XWnt11 and
XWnt5a, which resulted in a strong inhibition of explant
elongation by noncanonical GOF (Figure 3B). This inhibition
of explant elongation by XWnt-11 or XWnt-5a overexpression
was rescued by coinjection of either mLrp5 or mLrp6
(Figure 3A). To test which LRP-domains are required for its
function in CE, we attempted to rescue the stronger XLRP5
knockdown phenotype with hLrp6 deletion mutants (Figure
3C). The mutant lacking the extracellular domains (⌬E1-E4;
Mao et al., 2001) failed to rescue XLRP5 MO, whereas the
mutant without cytoplasmic domain (Lrp6 ⌬C; Tamai et al.,
2004) efficiently improved CE defects induced by XLRP5
MOs. Importantly, Lrp6 lacking the intracellular domain
(Lrp6 ⌬C) was sufficient to rescue elongation defects caused
by overexpression of XWnt-11 or XWnt-5a (Figure 3D). This
data confirmed that Lrp5/6, and specifically the extracellular
domains, in addition to playing a role in the Wnt/␤catenin
pathway, are physiologically relevant inhibitors of
noncanonical Wnt signaling.
XWnt11 MO Rescues the Heart Phenotype Induced by
XLRP5/6 MO in Xenopus embryos
Noncanonical Wnts are known to regulate not only CE
movements but also heart development in Xenopus (Pandur
et al., 2002). To analyze the role of Lrp5/6 in heart development
we investigated the expression of cardiac marker
genes in embryos injected with XLRP MOs targeted to the
presumptive cardiac mesoderm in eight–cell-stage embryos
to avoid convergent extension and primary-axis defects
(Supplemental Figure S1B). XLRP5 MO, and to a lesser
extent XLRP6 MO, caused a down-regulation of the cardiac
markers Nkx 2.5 and troponin (Figure 4A), two defects also
observed in the XWnt-11 knockdown (Pandur et al., 2002).
However, heart development is regulated by both canonical
and noncanonical Wnt signaling (Brade et al., 2006) and both
pathways could be potentially affected by XLRP5 depletion.
To better distinguish the contribution of each pathway and
to demonstrate specificity of the observed defects, we performed
a set of rescue experiments. The cardiac markers
Troponin and Nkx 2.5 were rescued by coinjection of
mLRP5, which demonstrates the specificity of XLRP5 MO.
However, only a partial rescue was observed after coinjection
of ␤-catenin (Figure 4, B and C), suggesting that the
XLRP5 knockdown phenotype is at least partially ␤-catenin
independent. To test whether this XLRP5 MO cardiac phenotype
is contributed to by noncanonical Wnt signaling, as
shown previously for CE movements, we coinjected XWnt11
MO. We observed a partial rescue of the XLRP5 MO cardiac
phenotype by XWnt11 MO (Figure 4, B and C), suggesting
that XLRP5 MO induces a noncanonical Wnt GOF as shown
for CE movements above. In summary, these data demonstrate
that endogenous XLRP5/6 regulates not only canonical
Wnt signaling but also CE movements and heart
development, two processes driven by noncanonical Wnt
signaling in Xenopus. Furthermore, our results suggest that
the inhibition of noncanonical Wnt signaling by Lrp5/6 is
achieved by an interaction of Lrp5/6 with noncanonical Wnts,
which may reduce the availability of noncanonical Wnts for
signaling.
Lrp6-deficient Mice Display Heart Malformations That
Are Partially Rescued by Deletion of Wnt5a
Based on our analysis of Wnt signaling in vitro and in vivo,
in Xenopus embryos, we hypothesized that Lrp5 or Lrp6
should also interact with noncanonical Wnts and regulate
heart development in mice. To test this hypothesis, we analyzed
heart morphology at E10.5 and E14.5 in Lrp6 and
Wnt5a mutant mice (Yamaguchi et al., 1999a; Pinson et al.,
2000). At E10.5, no obvious defects in heart morphology
were detected, although Lrp6Ϫ/Ϫ hearts were a little bit
smaller (Supplemental Figure S2), likely reflecting the overall
smaller size of Lrp6 mutant embryos (Pinson et al., 2000).
However, at E14.5 major outflow tract deformities were
observed in either Lrp6 or Wnt5a mutants (Figure 5, A and
B). Wnt5a mutants exhibited persistent truncus arteriosus
(PTA) and the right atrium was expanded, whereas in Lrp6
mutants the great arteries were separated, resulting in a
transposition of the great arteries.
Analysis of Wnt5a single mutants revealed not only defects
in intraventricular septation, with PTA, but also ventricular
septal defects (VSD). Defects in the closure of the
intraventricular septum (IVS) were observed in two of three
analyzed embryos. The myocardium in the Wnt5a mutants
Lrp5/6 in Noncanonical Wnt Signaling
Vol. 20, February 1, 2009 929
was abnormally thin, the right atria were expanded, and the
pericardium showed an abnormal morphology compared
with wild type. In Lrp6 single mutants, we also observed
VSD, the septum seemed porous, and the myocardium abnormally
thin. No pericardial deformities were found in the
Lrp6 mutants. In summary, at E14.5, both Wnt5a and Lrp6
Figure 4. XLRP5/6 regulate heart development. (A) Knockdown of XLrp5 and XLrp6 affects heart development. Embryos injected with
XLRP5 and XLRP6 MO in one or both dorsal blastomeres were analyzed by whole mount ISH for the expression of heart markers Nkx2.5
and Troponin lc (Tnlc) at stage 28. Injected side shown by blue circle in single-blastomere injections, open triangle shows Tnlc/Nkx2.5 on
injected side, closed triangle shows TnIc/Nkx2.5 on uninjected side. (B) XLRP5 MO-induced reduction in heart markers can be rescued with
mLrp5 and XWnt-11 MO (Tnlc) and only partially rescued with ␤-catenin overexpression (Nkx2.5). (C) Quantification of ISH analysis of
cardiac markers (*, significantly differs from ␤-galactosidase controls; p Ͼ 0.95); **, significantly differs from XLRP5MO; p Ͼ 0.95).
V. Bryja et al.
Molecular Biology of the Cell930
single mutants displayed arterial pole defects. Similar defects
were observed in other mutants of the noncanonical
signaling pathway, such as that for Vang-like 2 factor (Henderson
et al., 2006) and Dvl2 mutants (Hamblet et al., 2002).
These data suggest that both Lrp6 and Wnt5a are necessary
for proper heart development in mouse. Based on the
previous results we concluded that the heart phenotype of
Lrp6 mutants could in part be due to an excess of noncanonical
signaling. We therefore decided to analyze the effect
of removing one allele of Wnt5a at a later stage of heart
development (E14.5) in Lrp6 mutants, expecting that an excess
of noncanonical signaling in Lrp6 mutants may be
mitigated by reducingWnt5a.
Strikingly, analysis of Lrp6 null mice in which one allele of
Wnt5a had been removed led to a partial or complete rescue
of the heart defects seen in Lrp6 single mutants. Specifically,
two of four compound Wnt5aϩ/Ϫ Lrp6Ϫ/Ϫ embryos did not
display any heart defects at E14.5 (Figure 5C), and the heart
defects in the two remaining compound Wnt5aϩ/Ϫ Lrp6Ϫ/Ϫ
embryos showed a marked improvement in myocardium
and IVS, and the phenotype was less severe than that in
Lrp6Ϫ/Ϫ mice (Figure 5B). E14.5 Wnt5aϪ/Ϫ Lrp6ϩ/Ϫ embryos
showed identical heart defects to Wnt5aϪ/Ϫ Lrp6ϩ/ϩ
(Figure 5, A and B). Our analysis of heart development in
mice thus supports and extends our findings obtained in
Xenopus. Together, these data indicate that Lrp6 deficiency
causes noncanonical Wnt pathway GOF phenotypes and
that Lrp6 can inhibit noncanonical Wnt signaling in vivo.
Furthermore these findings underline the importance of
Wnt/PCP signaling in heart development and particularly
in outflow tract morphogenesis.
Deletion of Wnt5a Completely Rescues Exencephaly in
Lrp6 Mutant Mice
To define in more detail the functional interaction between
Lrp6- and Wnt5a-driven pathways in vivo and to ascertain
whether that interaction is more widespread than anticipated
previously, we studied the neural phenotype of compound
Wnt5a and Lrp6 mutants. Both Wnt5a and Lrp6 deficiencies
are embryonal lethal and we thus crossed
Wnt5aϩ/Ϫ mice with Lrp6ϩ/Ϫ mice to generate double
heterozygous Wnt5aϩ/Ϫ Lrp6ϩ/Ϫ animals. These double
Figure 5. Lrp6 mutant mice exhibit heart defects, which can be rescued by Wnt-5a heterozygosity. (A) Heart morphology in Lrp6 and Wnt5a
mutants at E14.5. Heart of E14.5 wild type, Lrp6Ϫ/Ϫ and Wnt5aϪ/Ϫ mouse embryos was dissected and the morphology was analyzed.
Representative examples are shown. ao, aorta; pt, pulmonary artery; PTA, persistent truncus arteriosus. (B) Hearts of embryos (E14.5) with
indicated genotypes were sectioned and stained with hematoxylin/eosin. Typical heart defects are indicated by arrows. peric., pericardium;
pIVS, porous intraventricular septum; VSD, ventricular septal defects; RA, right atrium. (C) Quantification of arterial pole deformities of
embryos in individual genotypes.
Lrp5/6 in Noncanonical Wnt Signaling
Vol. 20, February 1, 2009 931
heterozygous animals were born with the expected Mendelian
frequency (25.13%, expected 25%), and we did not notice
any gross morphological, fertility, or behavioral defects
in comparison with parental Wnt5aϩ/Ϫ or Lrp6ϩ/Ϫ mutants.
A small proportion (Ͻ5%) of Wnt5a ϩ/Ϫ Lrp6ϩ/Ϫ mice
showed tail deformities, which were also present at comparable
frequency in Lrp6ϩ/Ϫ mice. After crossing of double-heterozygous
mice, we recovered Lrp6Ϫ/ϪWnt5aϪ/Ϫ embryos at
E10.5 at the expected frequency. All Lrp6Ϫ/ϪWnt5aϪ/Ϫ
double null embryos were severely developmentally delayed
(Figure 6A), and we did not obtain any Wnt5a/Lrp6
double knockout embryos at E12.5.
We observed exencephaly (neural tube completely open
in cephalic region) in ϳ30% of Wnt5aϩ/ϩLrp6Ϫ/Ϫ embryos
at E10.5 (Figure 6A, open arrow) and in 25% of Lrp6Ϫ/Ϫ
embryos at E12.5 (n ϭ 20). Neural tube closure defects such
as exencephaly are usually associated with aberrant CE
movements and are observed in several other mutants of the
Wnt/PCP pathway components such as Dvl2, Vangl2, and
Wnt5a-deficient mice (Torban et al., 2004; Wang et al., 2006;
Qian et al., 2007). Previous studies directly proved the importance
of Wnt5a for neural tube closure in mouse (Qian et
al., 2007) and demonstrated that similar defects can also be
caused by GOF of noncanonical Wnt ligands (Shariatmadari
et al., 2005). Interestingly, the proportion of Lrp6 mutants
with exencephaly can be efficiently reduced by Wnt5a heterozygosity
and in the double Wnt5a/Lrp6-deficient embryos
we observed a complete rescue of exencephaly (Figure 6B).
This observation is in good agreement with our in vitro
findings, analyses of CE in Xenopus and heart development
in Xenopus and mouse. Thus, our results provide evidence
that Lrp5/6 deficiency results in noncanonical Wnt GOF
defects and attributes Lrp5/6 a role as an inhibitor of noncanonical
Wnt signaling in multiple vertebrate systems.
Wnt5a and Lrp6 Cooperate in Early Mouse Embryonic
Development
Although it is known that Lrp5/6 is required as a coreceptor
for canonical Wnt signaling and we hereby report that Lrp6
can inhibit noncanonical Wnt signaling, we also found evidence
that these are not the only two modalities of interaction
between Lrp6 and Wnt5a. We noticed that some of the
compound Wnt5a/Lrp6 mutants displayed intermediate
phenotypes at E10.5, and so we analyzed allelic combinations
of Wnt5a and Lrp6. The analyzed phenotypic features
included general developmental delay (defined as an embryo
Ͻ40% size of WT littermates) and a lack of embryo turning,
which usually takes place at E9.0. At E10.5, Lrp6Ϫ/ϪWnt5aϪ/Ϫ
embryos showed a complex phenotype that included a developmental
delay/lack of turning with almost complete
penetrance. A similar phenotype, but less penetrant, was
observed in Lrp6Ϫ/ϪWnt5aϩ/Ϫ embryos (Figure 6C). These
data suggest that in addition to Wnt/PCP pathway defects
(heart deformities and exencephaly), which were rescued by
Wnt-5a deficiency, other mechanistically unrelated interactions
exist between Lrp6- and Wnt5a-driven pathways during
early morphogenesis. We hypothesized that such defects
could result from the combination of defects in the Wnt/␤catenin
pathway of the Lrp6Ϫ/Ϫ mutants and the Wnt/PCP
pathway of Wnt5aϪ/Ϫ mutants resulting in additive or synergistic
effects in other developmental processes such as
embryonic turning. Analysis of embryos with various combinations
of Lrp6 and Wnt5a null alleles at E8.5 (Figure 7)
confirmed that Lrp6 deficiency resulted in decreased levels
of genes directly or indirectly regulated by ␤-catenin, such
as mesogenin (msgn), brachyury (T), and Mesp2 (Yamaguchi
et al., 1999b). The expression of these genes is abolished
in Wnt3a mutants, and in conditional ␤-catenin LOF mutants
(Dunty et al., 2008). In contrast, Wnt5aϪ/Ϫ embryos did not
show any alterations in the expression of ␤-catenin target
genes but showed smaller somites as a result of affected CE
movements (Figure 7A). Compound Lrp6Ϫ/ϪWnt5aϪ/Ϫ
mutants showed an additive phenotype, with no evidence for
further perturbation of ␤-catenin target gene expression (in
comparison to the Lrp6 null) or of somite condensation (in
comparison to the Wnt5a null). Thus, our analysis suggests that
the early phenotype of Wnt5a; Lrp6 double mutants (growth
retardation and lack of embryo turning) results from defects in
the regulation of common biological process by the Wnt/␤catenin
and Wnt/PCP pathways, rather than a direct interaction
between the two signaling pathways.
DISCUSSION
It is well documented that Lrp5/6 are coreceptors necessary
for Wnt signal transduction toward ␤-catenin (Pinson et al.,
Figure 6. Analysis of Wnt5a;Lrp6 double null mice at E10.5: Wnt5a
deficiency rescues exencephaly but promotes general retardation of
Lrp6Ϫ/Ϫembryos. (A) Wnt5a and Lrp6 single mutants occur as described
previously at E10.5, with some Lrp6 embryos exhibiting
exencephaly (arrow), compound Wnt5aϪ/Ϫ Lrp6Ϫ/Ϫ display developmental
delay and fail to undergo turning. (B) Loss of Wnt5a in
Lrp6 null mice rescued exencephaly. Exencephaly was observed in
30% of Lrp6 null mutants, this frequency was partially rescued by
loss of one allele of Wnt5a and completely rescued by loss of both
Wnt5a alleles. (C) Developmental delay and a failure to undergo
turning was only observed in 10% of Lrp6Ϫ/Ϫ mice but was exacerbated
by loss of Wnt-5a and occurred in almost in 100% of the
Wnt5aϪ/Ϫ Lrp6Ϫ/Ϫ double knockout mice.
V. Bryja et al.
Molecular Biology of the Cell932
2000; Tamai et al., 2000; Wehrli et al., 2000). Here, we demonstrate
an additional role for the extracellular domain of
Lrp5/6 as an inhibitor of noncanonical Wnt signal transduction.
Based on a series of experiments in vitro and in vivo, in
Xenopus and mouse, we suggest that Lrp5/6 is a physiologically
relevant inhibitor of noncanonical Wnt signaling,
which acts by interacting with and reducing the availability
of noncanonical Wnts for signaling. This conclusion is based
on the following critical pieces of evidence: 1) Wnt5a physically
interacts with Lrp6; 2) Lrp6 overexpression blocks
activation of Rac1 in vitro; 3) Lrp5 and/or Lrp6 deficiency in
Xenopus or mouse results in ␤-catenin–independent defects
in CE and heart development; 4) these defects can be partially
rescued by depletion of noncanonical Wnt ligands
both in Xenopus and in mouse; and 5) Lrp6 deficiency in
mice results in exencephaly, which is completely rescued by
deletion of Wnt5a.
Can our findings in XLRP5/6 depleted Xenopus or Lrp6deficient
mouse embryos be explained simply as ␤-catenin
lack-of-function phenotypes influenced by the loss of Wnt5a
and/or Wnt11 rather than Lrp5/6 regulating noncanonical
Wnt signaling? First, although inhibition of ␤-catenin signaling
has been reported to block CE in Xenopus (Kuhl et al.,
2001), we were not able to rescue XLRP5/6 MO phenotypes
with ␤-catenin in Keller explants but rather rescued the
phenotype with dn Rac1 or dn RhoA, suggesting that the
phenotype is caused by a noncanonical GOF. In contrast,
the overexpression of XWnt-8 (Kuhl et al., 2001) and ␤-catenin
(Schambony, unpublished observation) has no negative
effect on CE, but we observed CE defects after overexpression
of mLrp5 and mLrp6. Consistently, overexpression of
hLrp6 ⌬E1-E4, which acts as a constitutive activator of canonical
Wnt-signaling, had no negative effect on CE (data
not shown). Moreover, the effects of XLRP5 MO on dorsal
axis formation, which is a well-defined ␤-catenin-dependent
process, were almost abolished by coinjection of ␤-catenin.
Thus, our results suggest that the mechanisms of CE disruption
by blocking ␤-catenin signaling and by XLRP5/6 knockdown
are distinct. Second, the analysis of Wnt5a mutant
mice either alone or in combination with Lrp6 deletions did
not show any alteration (either negative or positive) in the
level of ␤-catenin target genes. Moreover, Wnt5a did not
activate canonical Wnt signaling in vitro. Thus, Wnt5a deficiency
or treatment does not affect ␤-catenin target genes
despite the fact that selected ␤-catenin target genes are expressed
in the Wnt5a expression domain (Yamaguchi et al.,
Figure 7. Analysis of ␤-catenin target genes
in Wnt5a, Lrp6 compound mutants: Wnt-5a
deficiency does not affect the expression of
␤-catenin target genes and Lrp6 deficiency
does not affect the somite compression. (A)
Embryos with indicated genotype were analyzed
by two-color whole-mount ISH at E8.5.
Somite marker Uncx4.1 is in red and ␤-catenin
target gene mesogenin is in purple. (B)
The expression of ␤-catenin target gene
brachyury (T) is in red and a marker of segmentation
clock Mesp2 is shown in purple.
Lrp5/6 in Noncanonical Wnt Signaling
Vol. 20, February 1, 2009 933
1999a). Wnt5a has also been shown to interfere with the
␤-catenin pathway, but such inhibition requires activation of
canonical Wnt signaling and/or specific cellular and receptor
contexts (He et al., 1997; Tao et al., 2005; Mikels and
Nusse, 2006; Bryja et al., 2007b; Kofron et al., 2007). Thus, our
results support the idea that deletion of Lrp6 or knockdown
of Lrp5 results not only in ␤-catenin-dependent phenotypes,
as described previously, but also in a disinhibition of noncanonical
Wnt signaling that results in diverse noncanonical
GOF phenotypes such as defects in CE movements, cardiac
outflow tract morphogenesis, and neural tube closure.
During cardiac development, canonical Wnt-signaling is
required in the very early phase of cardiac precursor specification
in the mesoderm (Naito et al., 2006; Ueno et al., 2007),
followed by an inhibition of the same pathway by DKK1 and
crescent (Marvin et al., 2001; Schneider and Nimpf, 2003) and
activation of noncanonical pathways by Wnt-11 as shown by
GOF and LOF (Eisenberg and Eisenberg, 1999; Pandur et al.,
2002; Garriock et al., 2005; Ueno et al., 2007). Why does the
increase in noncanonical Wnt signaling upon XLRP5 knockdown
result in a loss of cardiac marker genes? Because both
GOF and LOF of noncanonical Wnt signaling result in impaired
cell polarity, deficits in migration of cardiac precursors
to the anterior ventral side of the embryo would alter
the exposure of cardiac precursors to inductive signals and
therefore result in the loss of cardiac markers. This interpretation
is also consistent with a recently proposed model of
cardiac precursor migration and specification (Eisenberg
and Eisenberg, 2006) and the regulation of cell–cell adhesion
by noncanonical Wnts (Brade et al., 2006).
It is believed that Lrp5/6 provides specificity to Wnt
signaling by directing signaling to the ␤-catenin pathway
(Mikels and Nusse, 2006). Although not empirically tested,
binding specificity for canonical Wnts was thought to be a
part of that mechanism (He et al., 2004). The physical interaction
of Lrp6 and Wnt5a that we report seems to contradict
that view. Our experiments demonstrate that Wnt5a can
bind the extracellular soluble domain of Lrp6, although
Wnt5a (in contrast to Wnt3a) cannot induce Ser1490-phosphorylation
of Lrp6 or ␤-catenin activation. It is not clear
whether the interaction between Lrp5/6 and Wnt5a is direct
or mediated by other protein/proteoglycans such as the
Wnt/PCP pathway component Knypek (Topczewski et al.,
2001), which can bind Dkk1 (Caneparo et al., 2007), a highaffinity
ligand for Lrp5/6 (Mao et al., 2001). Thus, our data
reveal another level of complexity in Wnt signaling because
Lrp5/6 binds a larger array of Wnts than previously anticipated,
but only a subset of these ligands can activate specific
Lrp6 phosphorylation and downstream signaling to
␤-catenin.
Our functional in vivo studies suggest that Lrp5/6 (in
Xenopus) and Lrp6 (in mouse) are negative regulators of
noncanonical Wnt signaling. When this study was prepared
for publication, Tahinci et al. (2007) reported that a stretch of
36 amino acids from the cytoplasmic domain of Lrp6 can
block CE in Xenopus. Our data support the fact that Lrp5/6
inhibit CE via activation of noncanonical Wnt signaling, and
they suggest that an additional mechanism of inhibition
exists. Our experiments showed that mutations in the extracellular
domain strongly interfere with the ability of Lrp6 to
either block Rac1 or rescue CE defects caused by XLRP5
knockdown, whereas the membrane-tethered extracellular
domain of Lrp6 (Lrp6⌬C) behaved as full-length Lrp6. This
suggests that the mechanism of Lrp5/6 function in noncanonical
Wnt signaling involves formation of complexes on
the cell surface, which sequester noncanonical Wnts ligands
and prevent their interaction with signaling receptors such
as Frizzleds. The effects of Lrp6 on Rac1 activation require
both E1ϩE2 Wnt-binding domains, and E3ϩE4 Dkk1-binding
domains, pointing out the importance of physical interaction
of noncanonical Wnts and Lrp5/6 for the function of
Lrp5/6 in noncanonical signaling. This suggests that extracellular
complexes organized by Lrp5/6 and inhibiting noncanonical
Wnt signaling contain several components, e.g.,
Wnts, Dkk, and/or membrane glycoproteins such as Knypek
(Caneparo et al., 2007).
Our data support a model, where the availability of noncanonical
Wnts and the degree of noncanonical Wnt signaling
seems to be determined under physiological conditions
by the molecular ratio of noncanonical Wnts and free Lrp5/6
available for binding. Indeed, developmental defects caused
by the excess of noncanonical Wnt5a and Wnt11 were efficiently
rescued by overexpression of Lrp5 or Lrp6, and
developmental defects caused by the reduction of Wnt5a or
Wnt11 were rescued by knockdown of Lrp5. In agreement
with our model, a recent study by Caneparo and colleagues
demonstrated that the Lrp5/6 ligand, Dkk1, can act as a
␤-catenin–independent positive regulator of Wnt/PCP pathway
in vivo (Caneparo et al., 2007). Importantly, we hereby
demonstrate that the interaction between Lrp5/6 and noncanonical
Wnt ligands is physiologically important and regulates
normal development.
In summary, we provide several lines of evidence, both in
vitro and in vivo, in Xenopus and mouse that define Lrp5 and
Lrp6 as general inhibitors of the noncanonical Wnt signaling
pathway. Moroever, our results indicate that Lrp5/6 receptors,
by binding canonical or noncanonical Wnts, determine
not only the level of Wnt signaling through Wnt/␤-catenin
but also through noncanonical branches of Wnt signaling.
ACKNOWLEDGMENTS
We thank Andrew McMahon (Harvard University, Boston, MA) and William
Skarnes (Sanger Institute, Cambridge, United Kingdom) for providing Wnt5a
and Lrp6 mutant mice. We also thank Jan Kitajewski (Columbia University,
New York, NY) for HA-Wnt5a-B1A cells; Dr. J. H. Son (Columbia University,
New York, NY) for SN4741 cells; Christoph Niehrs (German Cancer Research
Center, Heidelberg, Germany) for vectors encoding hLrp6 and its extracellular
deletions; Mikhail Semenov and Xi He (Harvard Medical School) for
vectors encoding mLrp5, mLrp6, Lrp6⌬C, and Lrp6-Fc; and Paul Krieg (University
of Arizona, Tucson, AZ) for Xenopus Nkx2.5 and Troponin ISH probes.
We would also like to thank Michael Ku¨hl (University of Ulm, Ulm, Germany),
Sigolene Meilhac (Pasteur Institute, Paris, France), and the Arenas
laboratory for critical reading of the manuscript and valuable discussions and
Cecilia Olsson, Annika Ka¨ller, Claudia Winter, Caroline Berger, and C. Cimper
for excellent technical and secretarial assistance. V. B. and M. E. were
financed by the “EuroStemCell” project. This work was supported by European
Molecular Biology Organization Installation Grant, Academy of Sciences
of the Czech Republic (AVOZ50040507 and AVOZ50040702) and Ministry of
Education, Youth and Sports of the Czech Republic (MSM0021622430) to
V. B.; Swedish Foundation for Strategic Research, Swedish Royal Academy of
Sciences, Knut and Alice Wallenberg Foundation, European Commission
(Eurostemcell), Swedish Medical Research Council and Karolinska Institutet
to E. A.; the Pasteur Institute, the Centre National de la Recherche Scientifique,
the European Union Integrated Project Heart Repair to M. B., and the
German Research Foundation (Scha965/2-3) to A. S.
REFERENCES
Andersson, E. R., Prakash, N., Cajanek, L., Minina, E., Bryja, V., Bryjova, L.,
Yamaguchi, T. P., Hall, A. C., Wurst, W., and Arenas, E. (2008). Wnt5a
regulates ventral midbrain morphogenesis and the development of A9–A10
dopaminergic cells in vivo. PLoS ONE 3, e3517.
Brade, T., Manner, J., and Kuhl, M. (2006). The role of Wnt signalling in
cardiac development and tissue remodelling in the mature heart. Cardiovasc.
Res. 72, 198–209.
Bryja, V., Schulte, G., and Arenas, E. (2007a). Wnt-3a utilizes a novel low dose
and rapid pathway that does not require casein kinase 1-mediated phosphorylation
of Dvl to activate ␤-catenin. Cell Signal. 19, 610–616.
V. Bryja et al.
Molecular Biology of the Cell934
Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007b). Wnt-5a
induces Dishevelled phosphorylation and dopaminergic differentiation via a
CK1-dependent mechanism. J. Cell Sci. 120, 586–595.
Caneparo, L., Huang, Y. L., Staudt, N., Tada, M., Ahrendt, R., Kazanskaya, O.,
Niehrs, C., and Houart, C. (2007). Dickkopf-1 regulates gastrulation movements
by coordinated modulation of Wnt/beta catenin and Wnt/PCP activities,
through interaction with the Dally-like homolog Knypek. Genes Dev. 21,
465–480.
Castelo-Branco, G., Wagner, J., Rodriguez, F. J., Kele, J., Sousa, K., Rawal, N.,
Pasolli, H. A., Fuchs, E., Kitajewski, J., and Arenas, E. (2003). Differential
regulation of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a,
and Wnt-5a. Proc. Natl. Acad. Sci. USA 100, 12747–12752.
Clevers, H. (2006). Wnt/beta-catenin signaling in development and disease.
Cell 127, 469–480.
Davidson, G., Wu, W., Shen, J., Bilic, J., Fenger, U., Stannek, P., Glinka, A., and
Niehrs, C. (2005). Casein kinase 1 gamma couples Wnt receptor activation to
cytoplasmic signal transduction. Nature 438, 867–872.
Dunty, W. C., Jr., Biris, K. K., Chalamalasetty, R. B., Taketo, M. M., Lewandoski,
M., and Yamaguchi, T. P. (2008). Wnt3a/beta-catenin signaling controls posterior
body development by coordinating mesoderm formation and segmentation.
Development 135, 85–94.
Eisenberg, C. A., and Eisenberg, L. M. (1999). WNT11 promotes cardiac tissue
formation of early mesoderm. Dev. Dyn. 216, 45–58.
Eisenberg, L. M., and Eisenberg, C. A. (2006). Wnt signal transduction and the
formation of the myocardium. Dev. Biol. 293, 305–315.
Fanto, M., and McNeill, H. (2004). Planar polarity from flies to vertebrates.
J. Cell Sci. 117, 527–533.
Garriock, R. J., D’Agostino, S. L., Pilcher, K. C., and Krieg, P. A. (2005).
Wnt11-R, a protein closely related to mammalian Wnt11, is required for heart
morphogenesis in Xenopus. Dev. Biol. 279, 179–192.
Gonzalez-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A., and Brown,
A. M. (2004). Wnt proteins induce dishevelled phosphorylation via an LRP5/
6-independent mechanism, irrespective of their ability to stabilize beta-catenin.
Mol. Cell. Biol. 24, 4757–4768.
Habas, R., Dawid, I. B., and He, X. (2003). Coactivation of Rac and Rho by
Wnt/Frizzled signaling is required for vertebrate gastrulation. Genes Dev. 17,
295–309.
Hamblet, N. S., Lijam, N., Ruiz-Lozano, P., Wang, J., Yang, Y., Luo, Z., Mei, L.,
Chien, K. R., Sussman, D. J., and Wynshaw-Boris, A. (2002). Dishevelled 2 is
essential for cardiac outflow tract development, somite segmentation and
neural tube closure. Development 129, 5827–5838.
He, X., Saint-Jeannet, J. P., Wang, Y., Nathans, J., Dawid, I., and Varmus, H.
(1997). A member of the Frizzled protein family mediating axis induction by
Wnt-5A. Science 275, 1652–1654.
He, X., Semenov, M., Tamai, K., and Zeng, X. (2004). LDL receptor-related
proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development
131, 1663–1677.
Henderson, D. J., Phillips, H. M., and Chaudhry, B. (2006). Vang-like 2 and
noncanonical Wnt signaling in outflow tract development. Trends Cardiovasc.
Med. 16, 38–45.
Hollemann, T., Panitz, F., and Pieler, T. (1999). In situ hybridization techniques
with Xenopus embryos. In: A Comparative Methods Approach to the
Study of Oocytes and Embryos, ed. J. D. Richter, Oxford, United Kingdom:
Oxford University Press.
Kao, K. R., and Elinson, R. P. (1988). The entire mesodermal mantle behaves
as Spemann’s organizer in dorsoanterior enhanced Xenopus laevis embryos.
Dev. Biol. 127, 64–77.
Kim, G. H., and Han, J. K. (2005). JNK and ROKalpha function in the
noncanonical Wnt/RhoA signaling pathway to regulate Xenopus convergent
extension movements. Dev. Dyn. 232, 958–968.
Klein, T. J., and Mlodzik, M. (2005). Planar cell polarization: an emerging
model points in the right direction. Annu. Rev. Cell Dev. Biol. 21, 155–176.
Kofron, M., Birsoy, B., Houston, D., Tao, Q., Wylie, C., and Heasman, J. (2007).
Wnt11/beta-catenin signaling in both oocytes and early embryos acts through
LRP6-mediated regulation of axin. Development 134, 503–513.
Kuhl, M., Geis, K., Sheldahl, L. C., Pukrop, T., Moon, R. T., and Wedlich, D.
(2001). Antagonistic regulation of convergent extension movements in Xenopus
by Wnt/beta-catenin and Wnt/Ca2ϩ signaling. Mech. Dev. 106, 61–76.
Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A., and Niehrs, C.
(2001). LDL-receptor-related protein 6 is a receptor for Dickkopf proteins.
Nature 411, 321–325.
Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M., and Lassar, A. B. (2001).
Inhibition of Wnt activity induces heart formation from posterior mesoderm.
Genes Dev. 15, 316–327.
Mikels, A. J., and Nusse, R. (2006). Purified Wnt5a protein activates or inhibits
beta-catenin-TCF signaling depending on receptor context. PLoS Biol. 4, e115.
Naito, A. T., Shiojima, I., Akazawa, H., Hidaka, K., Morisaki, T., Kikuchi, A.,
and Komuro, I. (2006). Developmental stage-specific biphasic roles of Wnt/
beta-catenin signaling in cardiomyogenesis and hematopoiesis. Proc. Natl.
Acad. Sci. USA 103, 19812–19817.
Oishi, I., et al. (2003). The receptor tyrosine kinase Ror2 is involved in noncanonical
Wnt5a/JNK signalling pathway. Genes Cells 8, 645–654.
Pandur, P., Lasche, M., Eisenberg, L. M., and Kuhl, M. (2002). Wnt-11 activation
of a non-canonical Wnt signalling pathway is required for cardiogenesis.
Nature 418, 636–641.
Penzo-Mendez, A., Umbhauer, M., Djiane, A., Boucaut, J. C., and Riou, J. F.
(2003). Activation of Gbetagamma signaling downstream of Wnt-11/Xfz7
regulates Cdc42 activity during Xenopus gastrulation. Dev. Biol. 257, 302–314.
Pinson, K. I., Brennan, J., Monkley, S., Avery, B. J., and Skarnes, W. C. (2000).
An LDL-receptor-related protein mediates Wnt signalling in mice. Nature
407, 535–538.
Qian, D., Jones, C., Rzadzinska, A., Mark, S., Zhang, X., Steel, K. P., Dai, X.,
and Chen, P. (2007). Wnt5a functions in planar cell polarity regulation in mice.
Dev. Biol. 306, 121–133.
Schambony, A., and Wedlich, D. (2007). Wnt-5A/Ror2 regulate expression of
XPAPC through an alternative noncanonical signaling pathway. Dev. Cell 12,
779–792.
Schneider, W. J., and Nimpf, J. (2003). LDL receptor relatives at the crossroad
of endocytosis and signaling. Cell Mol Life Sci. 60, 892–903.
Schulte, G., Bryja, V., Rawal, N., Castelo-Branco, G., Sousa, K. M., and Arenas,
E. (2005). Purified Wnt-5a increases differentiation of midbrain dopaminergic
cells and dishevelled phosphorylation. J. Neurochem. 92, 1550–1553.
Seifert, J. R., and Mlodzik, M. (2007). Frizzled/PCP signalling: a conserved
mechanism regulating cell polarity and directed motility. Nat. Rev. Genet 8,
126–138.
Shariatmadari, M., Peyronnet, J., Papachristou, P., Horn, Z., Sousa, K. M.,
Arenas, E., and Ringstedt, T. (2005). Increased Wnt levels in the neural tube
impair the function of adherens junctions during neurulation. Mol. Cell
Neurosci. 30, 437–451.
Shimizu, H., Julius, M. A., Giarre, M., Zheng, Z., Brown, A. M., and Kitajewski,
J. (1997). Transformation by Wnt family proteins correlates with regulation of
beta-catenin. Cell Growth Differ. 8, 1349–1358.
Son, J. H., Chun, H. S., Joh, T. H., Cho, S., Conti, B., and Lee, J. W. (1999).
Neuroprotection and neuronal differentiation studies using substantia nigra
dopaminergic cells derived from transgenic mouse embryos. J. Neurosci. 19,
10–20.
Tahinci, E., Thorne, C. A., Franklin, J. L., Salic, A., Christian, K. M., Lee, L. A.,
Coffey, R. J., and Lee, E. (2007). Lrp6 is required for convergent extension
during Xenopus gastrulation. Development 134, 4095–4106.
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess,
F., Saint-Jeannet, J. P., and He, X. (2000). LDL-receptor-related proteins in Wnt
signal transduction. Nature 407, 530–535.
Tamai, K., Zeng, X., Liu, C., Zhang, X., Harada, Y., Chang, Z., and He, X.
(2004). A mechanism for Wnt coreceptor activation. Mol. Cell 13, 149–156.
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M.,
Wylie, C. C., Lin, X., and Heasman, J. (2005). Maternal wnt11 activates the
canonical wnt signaling pathway required for axis formation in Xenopus
embryos. Cell 120, 857–871.
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores, A., Lele, Z.,
Hammerschmidt, M., Postlethwait, J., and Solnica-Krezel, L. (2001). The zebrafish
glypican knypek controls cell polarity during gastrulation movements
of convergent extension. Dev. Cell 1, 251–264.
Torban, E., Kor, C., and Gros, P. (2004). Van Gogh-like2 (Strabismus) and its
role in planar cell polarity and convergent extension in vertebrates. Trends
Genet. 20, 570–577.
Ueno, S., Weidinger, G., Osugi, T., Kohn, A. D., Golob, J. L., Pabon, L.,
Reinecke, H., Moon, R. T., and Murry, C. E. (2007). Biphasic role for Wnt/
beta-catenin signaling in cardiac specification in zebrafish and embryonic
stem cells. Proc. Natl. Acad. Sci. USA 104, 9685–9690.
Unterseher, F., Hefele, J. A., Giehl, K., De Robertis, E. M., Wedlich, D., and
Schambony, A. (2004). Paraxial protocadherin coordinates cell polarity during
convergent extension via Rho A and JNK. EMBO J. 23, 3259–3269.
Lrp5/6 in Noncanonical Wnt Signaling
Vol. 20, February 1, 2009 935
van Amerongen, R., and Berns, A. (2006). Knockout mouse models to study
Wnt signal transduction. Trends Genet 22, 678–689.
van Noort, M., Meeldijk, J., van der Zee, R., Destree, O., and Clevers, H.
(2002). Wnt signaling controls the phosphorylation status of beta-catenin.
J. Biol. Chem. 277, 17901–17905.
Wang, J., Hamblet, N. S., Mark, S., Dickinson, M. E., Brinkman, B. C., Segil, N.,
Fraser, S. E., Chen, P., Wallingford, J. B., and Wynshaw-Boris, A. (2006).
Dishevelled genes mediate a conserved mammalian PCP pathway to regulate
convergent extension during neurulation. Development 133, 1767–1778.
Wehrli, M., Dougan, S. T., Caldwell, K., O’Keefe, L., Schwartz, S., VaizelOhayon,
D., Schejter, E., Tomlinson, A., and DiNardo, S. (2000). Arrow
encodes an LDL-receptor-related protein essential for Wingless signalling.
Nature 407, 527–530.
Wilkinson, D. G., and Nieto, M. A. (1993). Detection of messenger RNA by in
situ hybridization to tissue sections and whole mounts. Methods Enzymol.
225, 361–373.
Yamaguchi, T. P., Bradley, A., McMahon, A. P., and Jones, S. (1999a). A Wnt5a
pathway underlies outgrowth of multiple structures in the vertebrate embryo.
Development 126, 1211–1223.
Yamaguchi, T. P., Takada, S., Yoshikawa, Y., Wu, N., and McMahon, A. P.
(1999b). T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm
specification. Genes Dev. 13, 3185–3190.
Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., Okamura, H.,
Woodgett, J., and He, X. (2005). A dual-kinase mechanism for Wnt co-receptor
phosphorylation and activation. Nature 438, 873–877.
V. Bryja et al.
Molecular Biology of the Cell936
Supplementary Figure 1
A.
ctrl
XLRP5MO
XLRP6MO
mLrp5
mLrp6
pLrp5/6
total protein
B.
Dorsalized
Normal
Ventralized
Control
XLRP6MO
XLRP5MO
XLRP5MO
+-catenin
XLRP5MO
+mLRP5
C.
E-/N-cadherin
Supplementary
Figure 2
Supplementary
Figure 3
E13.5
Wnt5a
(relativeexpression)
lrp6 +/+ lrp6 +/- lrp6 -/lrp6
+/+ lrp6 +/- lrp6 -/-
Wnt5a
(relativeexpression)
E11.5
0
0,5
1
WT Wnt5a -/-
Lrp6
(relativeexpression)
E12.5
Supplementary Figure legends
Supplementary Figure 1.
(A) Efficiency of XLRP5/6 MO and mLrp5/6 overexpression in Xenopus embryos. Cell
lysates were injected as indicated and analyzed by Western Blotting with phospho Lrp6
antibody, which also recognizes unphosphorylated Lrp5 and Lrp6, or XLRP5 and XLRP6,
respectively. Levels of E-/N-cadherin and total protein were used as a loading control.
(B) Scheme of Xenopus injections used in the study.
(C) Effects of XLRP5/6 MOs on ventralization. Xenopus embryos were injected as indicated
and the ventralization has been scored using DAI index (Kao and Elinson, 1988).
Ventralization induced by XLRP5 MO is rescued by mLrp5 and β-catenin.
Supplementary Figure 2. Heart morphology in Lrp6 and Wnt5a mutants at E10.5.
Heart of E10.5 wild type, Lrp6-/- and Wnt5a-/- mouse embryos was dissected and the
morphology was analyzed. No obvious abnormalities were detected at this stage.
Representative examples are shown. RV – right ventricle, LV – left ventricle, RA - right
atrium, LA - left atrium, OFT – outflow tract.
Supplementary Figure 3. Expression of wnt5a in midbrain of lrp6 mutants. Ventral midbrains
of mouse embryos with indicated genotypes were dissected and total RNA was isolated.
Expression of wnt5a and lrp6 was determined by quantitative RT-PCR . Expression levels of
Wnt5a were unchanged by loss of Lrp6, and expression levels of Lrp6 were unchanged by
loss of Wnt5a.
Supplementary Materials and Methods
Mouse genotyping
Ear or embryonic tissues were boiled at 95ºC for 40 minutes in 100-200 μl of 25mM
NaOH/0,2mM EDTA and an equal volume of 40mM Tris HCl pH 5 was added. 3 μl of this
solution was used for PCRs. Lrp6 wild type allele was identified with the previously
described primers LRP6-U1 and LRP6-D1, while mice with the gene trap insertion (Lrp6
knockout allele) were recognized with the following primer set: CD4mix forward (5´GCACGGATGTCTCAGATCAAGAGG-3’)
and CD4mix reverse (5’CGGGATCATCGCTCCCATATATG-3’),
with an annealing temperature of 63ºC and an
amplicon of 108bp. Wnt5a WT and null alleles were identified with the following primers: 5a
WT For (5´-GACTTCCTGGTGAGGGTGCGTG-3´), Wnt5a WT Rev (5´GGAGAATGGGCACACAGAATCAAC-3´),
Wnt5a null For (5´GGGAGCCGGTTGGCGCTACCGGTGG-3´)
and Wnt5a null Rev (5´-
GGAGAATGGGCACACAGAATCAAC-3´).
Sequences of antisense MOs
XLRP5 MO (5’-ctc cca tgg cct cgt acc cct ctcc), XLRP6 MO (5’-gct caa tgc tcc ccc gta acc
cgac) or standard control MO directed against Lpr5 and Lrp6 were used at 0.8 pmol (all MOs:
GeneTools, Philomath, OR, USA). Sequences of XWnt5a and XWnt11 MOs were published
before (Pandur et al., 2002; Schambony and Wedlich, 2007).
Antibodies
Following antibodies were used: anti P-Ser1490-Lrp6 (#2568), anti Lrp6 (#2560) from Cell
Signaling Technologies), anti-Dvl2, anti-Dvl3 (sc-8027), anti-c-Myc (sc-40) (from Santa Cruz
Biotechnology), anti-active β-catenin (ABC, #05-389) and anti-Rac1 (-389) from Upstate
Biotechnology , anti--actin (Ab6276) and anti HA (Ab9110) for IP from Abcam, anti HA
(HA.11) for WB from Nordic Biosite, and anti-human IgG Fc fragment (109-005-098, Jackson
ImmunoResearch Laboratories). Cadherin levels in Xenopus lysates were detected using the
mixture of antibodies against E- and N-cadherin (610182 and 610921, BD Biosciences).
Quantitative-PCR
cDNA was generated as described previously (Castelo-Branco et al., 2003) RNA from.
ventral midbrains of lrp6+/+, lrp6+/- and lrp6-/- mouse embryos at E11.5 and E13.5.5
(where both Lrp6 and Wnt5a are known to be expressed) was extracted using RNeasy Mini
Kit (Qiagen). 1 g of RNA was reverse-transcribed using SuperScript II Reverse
Transcriptase (Invitrogen) and random primers (Invitrogen). Wnt5a primers used in this study
have been described previously (Castelo-Branco et al., 2003), Lrp6 primers were as follows:
forward 5-GCTACAAATGGCAAAGAGAATGC-3, reverse
CAGTATACAAGCCATGACCAAACA.
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#8 
 
 
Andersson T, Södersten E, Duckworth JK, Cascante A, Fritz N, Sacchetti P, Cervenka I, 
Bryja  V,  Hermanson  O  (2009):  CXXC5  is  a  novel  BMP4‐regulated  modulator  of  Wnt‐
signaling in neural stem cells. J Biol Chem. 284(6):3672‐81. 
 
 
Impact factor (2009): 5.328 
Times cited (without autocitations, WoS, Feb 21st 2014): 24 
Significance:  Identification  of  a  previously  unknown  protein,  CXXC5,  which  acts  as  a 
negative regulator of canonical Wnt signaling via interaction with Dishevelled. 
Contibution  of  the  author/author´s  team:  Analysis  of  the  role  of  CXXC5  in  the  Wnt 
signaling pathway. 
 
 
   
 
 
 
CXXC5 Is a Novel BMP4-regulated Modulator of Wnt
Signaling in Neural Stem Cells*□S
Received for publication,October 22, 2008 Published, JBC Papers in Press,November 10, 2008, DOI 10.1074/jbc.M808119200
Therese Andersson‡
, Erik So¨dersten‡
, Joshua K. Duckworth‡
, Anna Cascante‡1
, Nicolas Fritz§2
, Paola Sacchetti§
,
Igor Cervenka¶
, Vitezslav Bryja¶3
, and Ola Hermanson‡4
From the ‡
CoE in Developmental Biology for Regenerative Medicine (CEDB/DBRM), Department of Neuroscience, and §
CoE in
Developmental Biology for Regenerative Medicine (CEDB/DBRM), Department of Medical Biochemistry and Biophysics (MBB),
Karolinska Institutet, SE17177 Stockholm, Sweden and the ¶
Institute of Experimental Biology, Faculty of Science, Masaryk
University and the Department of Cytokinetics, Institute of Biophysics, Academy of Sciences of the Czech Republic,
61137 Brno, Czech Republic
Bone morphogenetic proteins such as BMP4 are essential for
proper development of telencephalic forebrain structures and
induce differentiation of telencephalic neural stem cells into a
variety of cellular fates, including astrocytic, neuronal, and mesenchymal
cells. Little is yet understood regarding the mechanisms
that underlie the spatiotemporal differences in progenitor
response to BMP4. In a screen designed to identify novel
targets of BMP4 signaling in telencephalic neural stem cells, we
found the mRNA levels of the previously uncharacterized factor
CXXC5 reproducibly up-regulated upon BMP4 stimulation. In
vivo, CXXC5 expression overlapped with BMP4 adjacent to
Wnt3a expression in the dorsal regions of the telencephalon,
including the developing choroid plexus. CXXC5 showed partial
homology with Idax, a related protein previously shown to
interact with the Wnt-signaling intermediate Dishevelled (Dvl).
Indeed CXXC5 and Dvl co-localized in the cytoplasm and interacted
in co-immunoprecipitation experiments. Moreover, fluorescence
resonance energy transfer (FRET) experiments verified
that CXXC5 and Dvl2 were located in close spatial proximity in
neural stem cells. Studies of the functional role of CXXC5
revealed that overexpression of CXXC5 or exposure to BMP4
repressed the levels of the canonical Wnt signaling target Axin2,
and CXXC5 attenuated Wnt3a-mediated increase in TOPflash
reporter activity. Accordingly, RNA interference of CXXC5
attenuated the BMP4-mediated decrease in Axin2 levels and
facilitated the response to Wnt3a in neural stem cells. We propose
that CXXC5 is acting as a BMP4–induced inhibitor of Wnt
signaling in neural stem cells.
Members of the TGFß family such as bone morphogenetic
proteins (BMP)5
influence multiple essential events during
brain development, such as differentiation, proliferation, and
migration (1–3). Stimulation of telencephalic neural stem cells
by BMP4 induces differentiation into a variety of cellular fates,
including neuronal, astrocytic and smooth muscle cells in vitro,
and genetic studies have shown that BMP4 is essential for
proper differentiation and regionalization of the telencephalic
forebrain (1, 2, 4, 5). BMP4 mediates its effects through nuclear
translocalization of Smad proteins such as Smad1 and Smad4
that can act directly as transcription factors and associate with
a number of important cofactors, including TGIF, Sip1, and
CBP/p300 (6, 7).
BMP activity exert cross-talk with many signaling pathways,
such as the membrane-bound receptor Notch, fibroblast
growth factors (FGFs), and Wnt factors (8, 9), and it has been
proposed that BMP molecules act in synergy with canonical
Wnt signaling molecules, such as Wnt3a, to regulate telencephalic
regionalization (1, 10). Less is known regarding downstream
targets of BMP signaling that regulate the spatial and
temporal context-specific differences in progenitor responsiveness
to extracellular signaling factors.
BMP activity is directly regulated by extracellular inhibitors
such as noggin and chordin, and Wnt signaling activity is regulated
at many levels by both extra- and intracellular mechanisms.
An example of an intracellular inhibitor of Wnt signaling
with reported effects on forebrain development is Idax. Idax
binds directly to the Wnt signaling mediator Dishevelled (Dvl)
and seems to compete at the binding site of Axin, resulting in an
inhibition of Wnt activity (11). Idax belongs to the CXXC family
of proteins of which other members, such as MBD1, are
predominantly nuclear DNA-binding proteins with chromatin-modifying
properties (12). Dvl is predominantly albeit not
exclusively localized in the cytoplasm, and Idax appears to be an
exception to other CXXC domain-containing proteins, being
localized largely in the cytoplasm (11). It has been shown that
some CXXC proteins are cancer-associated genes that can regulate
the activity and function of important transcriptional
complexes, such as Polycomb proteins (12). Idax is expressed in
* This study was supported in part by grants from K&A Wallenberg Foundation,
the Swedish Research Council (VR), the Swedish Cancer Society
(CF), the Jeansson Foundation, the Åke Wiberg Foundation, the Åhle´n
Foundation, the Swedish Medical Society, Karolinska Institutet, the
Swedish Foundation for Strategic Research (SSF), and the Swedish Children’s
Cancer Foundation (BCF) (to O. H.). The costs of publication of
this article were defrayed in part by the payment of page charges. This
article must therefore be hereby marked “advertisement” in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
□S
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Fig. S1 and Table S1.
1
Supported by Fundacio´n Ramo´n Areces, Spain.
2
Supported by VR-M, Sweden.
3
Supported by MSM0021622430 (Ministry of Education, Youth and Sports of
the Czech Republic), KJB501630801, AVOZ50040507, AVOZ50040702
(Academy of Sciences of the Czech Republic), and EMBO Installation Grant.
4
To whom correspondence should be addressed. Tel.: 46-8-5248-7477;
46-76-118-7452; Fax: 46-8-341-960; E-mail: Ola.Hermanson@ki.se.
5
The abbreviations used are: BMP, bone morphogenetic protein; GFP, green
fluorescent protein; FRET, fluorescence resonance energy transfer; DAPI,
4Ј,6-diamidino-2-phenylindole; ROI, region of interest; RT-qPCR, reverse
transcriptase-quantitative PCR; NSC, neural stem cells.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 6, pp. 3672–3681, February 6, 2009
© 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
3672 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 6•FEBRUARY 6, 2009
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
http://www.jbc.org/cgi/content/full/M808119200/DC1
Supplemental Material can be found at:
anterior brain structures and is required for appropriate forebrain
development as loss of Idax by morpholinos in Xenopus
tadpoles result in severe forebrain defects (13).
In a systematic attempt to increase the understanding of the
mechanisms underlying cell context-specific responses of
telencephalic neural stem cells (NSCs) to BMP4 signaling during
forebrain development, we have pursued gene expression
profiling analysis using microarrays to identify putative direct
and novel targets for BMP4 signaling in NSCs. By this approach,
we identified CXXC5 as a direct BMP4 target in NSCs. In situ
hybridization experiments revealed that CXXC5 expression
localized selectively to the BMP4-rich dorsal telencephalon
adjacent to the neighboring regions expressing Wnt3a.
Although CXXC5 displayed predominantly nuclear localization,
it co-localized and interacted with several Dvl isoforms in
the cytoplasm. CXXC5 influenced the expression of the endogenous
Wnt signaling target Axin2 as well as Wnt3a-induced
activation of a TOPflash reporter. Based on these results, we
propose that CXXC5 is a novel BMP-regulated modulator of
Wnt signaling and targets thereof in telencephalic NSCs.
EXPERIMENTAL PROCEDURES
Cortical NSC Cultures—NSCs were obtained from the dissociated
cerebral cortices of Sprague-Dawley rat E15.5 embryos
and cultured as previously described (14–16). Briefly NSCs
were cultured in serum-free DMEM:F12 media (Invitrogen)
enriched with N2 supplement and grown on poly-L-ornithine/
fibronectin (Sigma)-coated cell culture dishes (Corning). Cells
were maintained in a proliferative state using 10 ng/ml FGF2
(R&D Systems) and passaged once before nucleofections or
twice before stimulations. After the second passage, cells were
plated at 500–10,000 cells/cm2
and allowed to proliferate for
24 h prior to commencement of the experiment. To induce
differentiation of NSCs, FGF2 was withdrawn from the cultures
with or without the addition of other soluble factors. BMP4 and
Wnt3a (R&D Systems) were both used at 10 ng/ml. Addition of
soluble factors was carried out every 24 h, and media was
changed every 48 h. For inhibition of protein synthesis, 10–20
␮g/ml Cycloheximide (Sigma) was added to the media 15–30
min before addition of BMP4. All experiments in this study
involving animals and stem cell isolation were approved by the
ethics committee for animal research in Stockholm, Sweden.
Gene Expression Profiling Using Microarrays—Rat neural
stem cells were exposed to BMP4 or kept in FGF2 for 3h before
the cells were lysed and RNA extracted (Qiagen). RNA from the
time for stimulation start was extracted and used as control.
The microarray was carried out by KI seq-express (former
KIChip). Briefly, RNA was amplified (17) and labeled with Cy3
or Cy5 (PerkinElmer Life Sciences) and hybridized onto Agilent
whole rat genome array (G4131A) (all kits and arrays from Agilent).
The arrays were scanned at two different intensities, and
the images were analyzed for background correction. Both
BMP4 and FGF2 samples where co-hybridized with RNA from
the starting point and a dye-swap was performed. The arrays
were normalized and the differential gene expression analyzed
using the R and bioconductor-based method LIMMA (18).
RNA Isolation and Quantitative RT-PCR—RNA was isolated
using RNeasy and contaminating DNA removed using RNasefree
DNase set (Qiagen). First strand cDNA synthesis was
obtained using High Capacity cDNA Reverse Transcription kit
(Applied Biosystems). For quantitative PCR 0.5ϫ Platinum
SYBR green mix (Invitrogen) was used and run on Applied Biosystems
7300 Real Time PCR system using the PCR-program
recommended by Invitrogen for Platinum SYBR green. Primers
used for the quantitative RT-PCR were designed to span an
intron where possible. Sequences can be obtained upon
request. To further exclude DNA contamination, ϪRT (no
reverse transcriptase) samples were run as controls. Data were
analyzed using the statistical programming language R.
DNA Constructs—The open reading frame of rat CXXC5 was
amplified using Taq-polymerase (Invitrogen) and gene-specific
primers and cloned into pCR4 using TOPO TA kit according to
manufacturers instructions (Invitrogen). Isolated clones were
sequenced (KI seq-express) before subcloning into pcDNA3
and subsequent use in overexpression experiments. To obtain
CXXC5-GFP and GFP-CXXC5 fusion proteins, the PCR product
was purified using a PCR purification kit (Qiagen), cut with
restriction enzymes (NEB), and ligated using Quick ligase
(NEB) into the HindIII and EcoRI sites of pNGFP-EU or
pCGFP-EU (19). Clones were sequenced and subsequently
used for co-immunoprecipitation, FRET, and subcellular localization
experiments. In vitro transcription/translation was performed
using TNT (Promega) according to the supplier’s
instructions. The BMP4 and Wnt3a constructs were kind gifts
from Dr. John L. R. Rubenstein.
In Situ Hybridization—Non-radioactive in situ hybridization
on sections was performed as previously described (20). Heads
(E10.5, E12.5, and E14.5) of mouse embryos were fixed in 4%
paraformaldehyde (Sigma) for 2–5 h and then transferred to
30% sucrose at 4 °C overnight before frozen in Tissue-Tek
(Sakura Finetek) on dry ice and kept in Ϫ70 °C until cryostatsectioned
(Microm) onto SuperFrost Plus glasses (MenzelGmbH
& Co KG) as 12-␮m sections. Prior to hybridization,
sections were permeabilized with 1 ␮g/ml proteinase K
(Invitrogen), acetylated with 13.5 ml/L triethanolamine
(Sigma), 44 mM acetic anhydride (Sigma) and 1.7 mM HCl
(Merck), and pre-hybridized with hybridization buffer (50%
formamide (Fluka), 5ϫ SSC, 5ϫ Denhardt’s solution (Sigma),
250 ␮g/ml bakers’ yeast RNA (Sigma), 500 ␮g/ml herring sperm
DNA (Invitrogen), 1 g/50 ml blocking reagent (Boehringer)) for
3–6 h. Hybridization was carried out at 70 °C overnight with
1–4 ␮l of DIG-labeled probe (0.1–0.2 ␮g/␮l) per 100 ␮l of
hybridization buffer and glass. Post-hybridization washes were
performed for 1–2 h at 70 °C in 0.2ϫ SSC. Sections were then
blocked with 10% fetal calf serum for 2–4 h before being subjected
to an anti-DIG antibody (1:5000, Roche) at 4 °C overnight.
Finally, the slides were submerged into a 10% polyvinyl
alcohol (Sigma) solution containing 1.72 ml/l NBT (Roche) and
1.72 ml/l B-CIP (Roche) chromogen components until sufficiently
stained (3–72 h). DIG probes were produced according
to the manufacturers’ recommendations using DIG RNA labeling
mix (Roche). After in situ hybridization, the sections were
analyzed and micrographs obtained with a Zeiss Axioskop 2
mot plus microscope. CXXC5, BMP4, and Wnt3a probes were
used on Ͼ3 littermate brains per developmental stage.
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
FEBRUARY 6, 2009•VOLUME 284•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3673
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
Immunoprecipitation, Immunoblotting, and Immunocytochemistry—COS7
and HEK-293 cells were transfected with
GFP-CXXC5, CXXC5-GFP, or vector control only containing
GFP individually or cotransfected with a full-length XDishevelled-Myc
(21) using Lipofectamine 2000 (Invitrogen)
according to the manufacturer’s instructions. Immunoprecipitation,
immunoblotting, and culturing of COS7 and
HEK-293 cells were performed essentially as previously
described (22). Antibodies used for immunoprecipitation
were anti-GFP (Fitzgerald Industries), rabbit anti-Myc
(SCBT) and anti-Dvl3 (Cell Signaling Technology). Primary
antibodies used for immunoblotting: anti-ß-catenin (BD
Biosciences), anti-Dvl1 (SCBT), anti-Dvl2 (SCBT), anti-Dvl3
(SCBT), anti-GFP (Chemicon), mouse anti-Myc (SCBT), and
anti-ß-actin (Abcam) (22). For immunocytochemistry, cultures
were fixed using 10% formalin (Sigma) 24 h after transfections.
Immunostaining was performed using standard
protocols using chicken polyclonal anti-GFP (Chemicon,
1:1000) and mouse monoclonal anti-c-Myc (SCBT, 1:200)
followed by appropriate species-specific Alexa-488 and
Alexa-594-conjugated secondary antibodies (Molecular
Probes, 1:500). Nuclei were visualized using Vectashield
containing DAPI (Vector Laboratories, Inc.). Fluorescent
and brightfield images were acquired using Zeiss Axioskop2/
MRm camera with Axiovision software. Images were assembled
using Adobe Photoshop.
FRET—To perform Fo¨rster (Fluorescent) Resonance Energy
Transfer (FRET) measurements, we used a Zeiss LSM 5 Exciter
inverted confocal scanning laser microscope using a ϫ63/1.2
NA objective as described previously (23). CXXC5-GFP-expressing
NSCs were grown on prepared glass coverslips, and
24 h after nucleofection, cells were fixed using a 50% methanol/
50% acetone fixing solution and then processed for immunocytochemistry.
The coverslips were mounted on slides using the
ProLong Antifade mounting media kit (Molecular Probes,
Invitrogen) to enable perfect conservation of the fluorescent
signal. A detailed description of the FRET technique can be
found elsewhere (24, 25). The Fo¨rster constant, R0, for the
donor-acceptor pair, GFP and Alexa-555, used in this study was
6.3 nm (Handbook of Probes, Invitrogen). FRET occurs when
the fluorophores are separated by distances 0.5 R0 Ͻ r Ͻ 2 R0.
Thus, it is possible to distinguish proteins that are spatially colocalized
within a ϳ14-nm radius. To determine FRET, we
quantified the quenching of donor fluorescence by performing
acceptor photobleaching. NSCs expressing CXXC5-GFP and
stained with Alexa555-labeled secondary goat anti-rabbit IgG
antibody (Molecular Probes, Invitrogen; 1:100) to detect rabbit
polyclonal antibody to Dvl2 (SCBT; 1:100) were excited with
the 488 and 561 nm lasers. The acceptor, Alexa555, was then
irreversibly photobleached in a selected adequate cytoplasmic
region (ϳ5–10 ␮m2
) by continuous excitation with the 561 nm
laser for 10–20 s. Thereafter, the residual Alexa555 and GFP
image was obtained, and a region of interest (ROI) was outlined
in the photobleached area and processed using Zeiss LSM
image Examiner. Ratios between GFP intensities in the ROI,
before and after photobleaching, were calculated to quantify
FRET. The FRET values presented are corrected for erroneous
intensity changes for each cell in two cytoplasmic ROIs randomly
selected outside the bleached area. 10–25 cells were
measured for each experiment.
Overexpression and siRNA-mediated Knockdown—NSCs
were nucleofected according to the manufacturer’s instructions
using program A-33 on the Nucleofector (Amaxa) as previously
described (26). Experiments were commenced 24h after
nucleofection, during which NSCs were maintained in FGF2.
As the healthiness of the cells varied significantly when obtaining
very high (Ͼ90%) or very low (Ͻ20%) knockdown of
CXXC5 expression levels, experiments where a knockdown of
CXXC5 mRNA showed between 40–70% efficiency (n ϭ 5)
were chosen for detailed analysis. Transient transfection studies
for luciferase assay in fibroblasts were performed essentially
as previously described (27). Cells were plated in 24-well plates
24h before transfection and transfected with 0.6 ␮g of plasmid
DNA/well complexed with 2 ␮l of Lipofectamine 2000 (Invitrogen).
Typically, cells were transfected with 200 ng of the
reporter construct and increasing doses of CXXC5 expression
vector. After 5 h of incubation, the lipid/DNA mix was replaced
with fresh 10% serum medium. Cells were serum-starved 24-h
post-transfection and stimulated with vehicle or purified
Wnt3a (R&D Systems). Luciferase activities were assayed using
Dual-Luciferase Reporter Assay System (Promega), following
the manufacturer’s protocol. Primary antibodies used for
immunoblotting: anti-ß-catenin (BD Biosciences), anti-activated
(dephosphorylated) ß-catenin (Upstate), anti-Dvl2
(SCBT), and anti-ß-actin (Abcam).
Statistical Analysis—Statistical analysis was performed in
Prism4 (GraphPad software). Initially variance analysis
(ANOVA) was performed, followed by Student’s t test
(unpaired). Significance were assumed at the level of p Ͻ
0.05 (*, p Ͻ 0.05; ***, p Ͻ 0.001, see figure legends).
RESULTS
BMP4 Rapidly Induces Significant Changes in Gene Expression
in Neural Stem Cells—To elucidate novel downstream targets
of BMP signaling in neural progenitors, we used a well-characterized
rat embryonic telencephalic NSC preparation that has
previously been used to study BMP signaling. During the continuous
administration of FGF2 the NSCs remain undifferentiated
with the capacity to differentiate into neuronal, astrocytic, oligodendrocyte,
and mesenchymal cells (14–16, 26). Upon BMP4
stimulation these cells respond with increased Smad phosphorylation,
subsequent nuclear translocation of Smads and increase in
transcription of Smad target genes (5), and subsequent differentiation
into astrocytic and mesenchymal cells (5, 28).
After primary FGF2 expansion, one passage and continued
FGF2 expansion, NSCs were treated with either FGF2 or BMP4
for 3 h. This time point was chosen due to the rapid induction
(Ͻ30 min) of Smad-mediated transcription downstream of
BMP4 stimulation (5). The gene expression profile was subsequently
investigated using microarrays. This procedure identified
162 spots that were putatively (p value Ͻ 0.05) up- or downregulated
more than 1.5-fold after 3 h (supplemental data). To
initially validate the array, we picked Ϸ10% of the identified
genes and performed quantitative RT-PCR (RT-qPCR) on the
same samples that were used for the microarrays. This experiment
showed that around 90% of the genes identified in the
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
3674 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 6•FEBRUARY 6, 2009
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
screen were up- or down-regulated, in approximate accordance
with the chosen p value predicting 95% accuracy (see further
below).
The effects of BMP4 stimulation
of NSCs are highly dependent on
the microenvironment and cell
culture conditions, such as plating
density (4, 28). To analyze the
reproducibility of the effects of
BMP4 on the expression of the
identified genes in NSCs, we
therefore picked eight factors
from our screen (Fig. 1A and see
below), including known and
potentially novel targets of BMP4,
and repeated the experimental
procedure four times. Six out of
these eight mRNAs were reproducibly
BMP4-regulated in NSCs:
Gas1, Olig1, Id2, Idb4, CXXC5,
and Hey1 (Fig. 1A), whereas two
mRNAs, Sin3A and Skiip, were
regulated only in occasional
experiments (data not shown).
CXXC5 Is a Novel Direct Target
of BMP4 in NSCs—Id2 and Idb4
have previously been shown to be
direct targets of BMP signaling.
These factors interact with and
down-regulate the activity of
bHLH proteins, such as the oligodendrocyte-associated
bHLH
transcription factors Olig1 and
Olig2 thus interfering with oligodendrocyte
differentiation (29). In
addition to this mechanism, we
found that Olig1 expression was
significantly down-regulated by
BMP4 stimulation (Fig. 1A), suggesting
that BMP4-mediated inhibition
of oligodendrocyte differentiation
may occur at several
levels. Other reproducibly BMP4regulated
mRNAs were the Notchassociated
repressor Hey1 (8), and
Gas1 recently linked to Sonic
Hedgehog signaling (30–32) (Fig.
1A).
Another significantly BMP4-regulated
mRNA was the previously
uncharacterized factor CXXC5 (Fig.
1A). CXXC5 expression levels were
up-regulated by BMP4 approximately
15-fold in average after 3 h as
assessed by RT-qPCR (Fig. 1, A and
B). Time course experiments (0, 20,
40, 60, 90, 120, 150, 180 min, 4, 6,
10 h after initial BMP4 exposure)
revealed that CXXC5 expression levels started to increase at 40
min, were high at 60 min and remained up-regulated at 10 h
after BMP4 exposure (see further below and data not shown).
FIGURE 1. BMP4 exposure results in rapid changes in gene expression in telencephalic NSCs. A, levels of
mRNA expression relative to control mRNA (HPRT) of six putative target genes (Gas1, Olig1, Id2, Idb4, CXXC5,
Hey1) in NSCs after BMP4 treatment and relative to unstimulated control as assessed by RT-qPCR. B, RT-qPCR
assessment of the relative CXXC5 mRNA expression levels to HPRT after BMP4 stimulation with or without
pretreatment with the protein synthesis inhibitor cycloheximide (CHX) compared with unstimulated control.
FIGURE 2. CXXC5 mRNA is expressed at high levels in the dorsal telencephalon, the expression overlaps
with BMP4 and is adjacent to Wnt3a expression. A–I, micrographs depicting in situ hybridization results of
transverse sections of mouse brains at embryonic ages (E) 10.5 (A–C), 12.5 (D–F), and 14.5 (G–I) hybridized with
probes for detection of CXXC5 (A, D, G), BMP4 (B, E, H), and Wnt3a (C, F, I). At E10.5, the expression patterns
overlap significantly. At E12.5, CXXC5 and BMP4 mRNA expressions overlap significantly and are detected in
the very close vicinity of Wnt3a labeling. At E14.5, very low levels of CXXC5 transcripts were detected, whereas
BMP4 mRNA was found in and around the developing choroid plexus, and Wnt3a labeling was detected just
lateral to the BMP4-expressing domain. Arrows mark regions of high specific labeling.
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
FEBRUARY 6, 2009•VOLUME 284•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3675
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
To investigate whether CXXC5 could be a direct target of
BMP4 signaling, we pretreated the NSCs with cycloheximide
(CHX), an inhibitor of translation and thus de novo protein
synthesis. We then evaluated the expression levels of CXXC5
3 h after subsequent FGF2 versus BMP4 stimulation. Pretreatment
with CHX 15–30 min before BMP4 or FGF2 stimulation
did not significantly inhibit BMP4-mediated up-regulation of
CXXC5 (Fig. 1B), suggesting that the increased levels of
CXXC5 mRNA could be the result of a direct effect of BMP4
signaling on CXXC5 gene expression.
CXXC5 Is Highly Expressed in the Dorsal Telencephalon
Where BMP4 Expression Is Enriched—To confirm the gene
product of CXXC5, we performed in vitro transcription/translation
by TNT using a sequenced construct harboring fulllength
CXXC5. The protein product revealed a major band
migrating at around 38 kDa (data not shown), in close range of
the predicted protein product of the CXXC5 gene.
To assess the gene expression pattern of CXXC5 in vivo in
relation to BMP4 in neural progenitors, we performed in situ
hybridization on forebrain sections from mice at embryonic age
(E) 10.5, 12.5, and 14.5. At E10.5 and E12.5, CXXC5 expression
was largely restricted to the dorsal pallium (Fig. 2, A and D).
These regions are known to be rich in expression of BMP receptors
as well as several BMP molecules, including BMP4 (2, 3).
Indeed in situ hybridization experiments using a probe for
BMP4 demonstrated a clear overlap in expression of CXXC5
and BMP4 in the dorsal pallium (Fig. 2, A, B, D, and E). Importantly,
CXXC5 expression was prominent in and around the
developing choroid plexus (Fig. 2D), a non-neuronal structure
producing and secreting the cerebrospinal fluid. At E14.5 however,
only low levels of CXXC5 expression were detected (Fig.
2G), whereas BMP4 transcripts displayed a high expression
selectively in the ventricular zone at the region of the developing
choroid plexus (Fig. 2H).
In addition to BMP4, the signaling molecule Wnt3a has been
shown to be required for proper development of the dorsal
telencephalon, influencing the development of the hippocampal
formation and pyramidal neurons therein (10). At E10.5,
Wnt3a mRNA showed an overlapping expression with CXXC5
and BMP4 (Fig. 2, A–C), while at E12.5 Wnt3a transcripts
showed a marked reduction in expression just at the border of
CXXC5 and BMP4 expression (Fig. 2, D–F), possibly demarcating
the regions of the developing hippocampal formation and
the choroid plexus. At E14.5 a marked expression of the Wnt3a
gene was detected just lateral to the BMP4 expression (Fig. 2, H
and I). The expression pattern of CXXC5 thus suggests that this
factor could play a role in telencephalic development and
strengthens the association between CXXC5 and high BMP
signaling activity.
CXXC5 Interacts with the Wnt Signaling Mediator Dishevelled
in Co-immunoprecipitation Experiments—CXXC5 has
been predicted to be a paralogue of another CXXC domain
containing factor named Idax (CXXC4) (11, 12, 33). Idax was
identified in a screen for proteins interacting with the PDZ
domain of the intracellular signaling factor Dishevelled (Dvl).
Dvl is a predominantly cytoplasmic protein (34, 35) and acts as
an intermediate of canonical Wnt signaling. Accordingly, Idax
was found to inhibit canonical Wnt signaling as assessed by
transcriptional assays (11). A model of the sequence in the
domain of Idax that interacts with Dvl has been generated and
this sequence shows 100% similarity to a sequence in CXXC5
(supplemental data). We, therefore, generated constructs
where GFP was fused to the N or C terminus of CXXC5 to
investigate whether Dvl interacts with CXXC5 in a similar
manner as Idax. After co-transfection of the GFP fusion proteins
with full-length Myc-Dvl in COS7 and HEK-293 cells, we
immunoprecipitated whole cell protein extracts using Myc- or
FIGURE3.CXXC5interactswithtransfectedandendogenousDvlproteins
in co-immunoprecipitation experiments. A, both N- and C-terminally
tagged full-length CXXC5 constructs interact with Myc-Dvl in co-immunoprecipitation
(IP) experiments using GFP antibody for IP and Myc antibodies for
blot. Control vector expressing only GFP does not show any interactions.
Arrows point to CXXC5 (upper band) and GFP (lower band). An additional
unspecific protein product is seen after IP with GFP-CXXC5 only. B, CXXC5GFP
co-immunoprecipitates with Myc-Dvl also when using Myc antibody for
IP whereas the GFP-expressing vector shows no interaction. C, COS7 cells
were transfected with empty vector or CXXC5-GFP fusion protein. Cell lysates
were immunoprecipitated with anti-GFP or anti-Dvl3 antibodies and analyzed
for the presence of Dvl3 or CXXC5-GFP in the complex by Western
blotting. IP, immunoprecipitation; TCL, total cell lysate, WB, Western blot.
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
3676 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 6•FEBRUARY 6, 2009
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
GFP-specific antibodies. This experiment revealed that both
constructs of CXXC5 could be co-immunoprecipitated with
Myc-Dvl in both cell types and with both antibodies, whereas
the control vector expressing GFP alone did not interact with
Dvl (Fig. 3, A and B).
To investigate whether endogenous Dvl protein could interact
with the CXXC5-GFP protein, we immunoprecipitated
whole cell protein extracts of COS7 cells transfected with
CXXC5-GFP using either the GFP antibody or antibodies
against Dvl proteins, and examined putative co-immunoprecipitation
by subsequent immunoblotting for the Dvl proteins
or GFP, respectively. In this experiment, Dvl3, the most abundant
Dvl isoform in COS7 cells, co-immunoprecipitated with
CXXC5-GFP during both experimental conditions, whereas
the vector only expressing GFP did not (Fig. 3C). These results
suggest that CXXC5 interact with endogenous Dvl proteins,
including Dvl3.
CXXC5 Displays Both Nuclear and Cytoplasmic Subcellular
Localization and Co-localizes with Dvl in the Cytoplasm—Although
Idax has been demonstrated to be largely a cytoplasmic
protein, in silico screens predicted CXXC5 to localize to the
nucleus, despite the lack of classical nuclear localization signal
motifs. It has further been reported that Dvl can display nuclear
localization (34). To investigate whether the interaction of
CXXC5 and Dvl occurred in the nucleus or in the cytoplasm, we
investigated the subcellular localization of CXXC5 and Dvl.
Transfection of the GFP-CXXC5 construct into COS7 cells
revealed that CXXC5 located both
to the nucleus and the cytoplasm
(Fig. 4A). Nuclear GFP-CXXC5
could be detected in 90–95% of the
transfected cells whereas clear cytoplasmic
labeling was detected in
ϳ30–40% of the transfected cells.
The nuclear labeling was homogenous
and associated with DNA as
assessed by merging with the DAPI
staining (Fig. 4D). The cytoplasmic
labeling of CXXC5 displayed characteristics
of large bodies in close
proximity to the nucleus, localized
just outside the nuclear membrane.
Transfections of Myc-Dvl revealed a
predominantly cytoplasmic localization
(Fig. 4B). Co-transfection
revealed that CXXC5 and Dvl
indeed co-localized extensively in
the cytoplasm (Fig. 4, C and D). The
results showed some experimental
variations but yielded an average of
co-localization in around 40% of the
co-transfected cells.
FRET Experiments Show that
CXXC5-GFP and Dvl2 Are Located
in Close Proximity in Neural Stem
Cells—All proteins of the Dishevelled
family are expressed during
the development of the nervous system,
and Dvl2 is highly expressed in forebrain progenitors. In
order to investigate the interaction between endogenous Dvl2
and CXXC5 specifically in NSCs, we performed Fo¨rster FRET
experiments (23–25). For FRET quantification we used the
acceptor photobleaching method on NSCs nucleofected with
CXXC5-GFP. Endogenous Dvl2 was detected in NSCs by
immunocytochemistry using polyclonal anti-Dvl2 IgG.
CXXC5-GFP served as FRET donor. The primary antibody
against Dvl2 was probed with an Alexa555-conjugated IgG secondary
antibody, which served as the FRET acceptor (Dvl2Alexa555).
In each cell, we measured the intensity of the
CXXC5-GFP and Dvl2-Alexa555 in a subcellular ROI showing
overlap of the two proteins, before and after irreversible and
total acceptor photobleaching (Fig. 5A). Subsequently, two subcellular
regions were randomly selected away from the photobleached
region and the intensity of CXXC5-GFP was measured
before and after photobleaching. These values were used
to correct the value measured in the bleached region for erroneous
intensity changes.
Following acceptor photobleaching, the CXXC5-GFP fluorescence
intensity in the ROI was significantly enhanced to
108.0 Ϯ 0.7% of the intensity before photobleaching (p Ͻ 0.001,
n ϭ 23, Fig. 5B). These results implied that the donor and
acceptor complexes, CXXC5-GFP and Dvl2-Alexa555, were in
close proximity, separated by less than 14 nm, i.e. the maximal
distance for FRET detection between GFP and Alexa555 (24).
FIGURE 4. CXXC5 is localized both to the nucleus and the cytoplasm, and in the cytoplasm CXXC5 colocalizes
with Dvl. A, micrograph depicting transfected GFP-CXXC5 in COS7 cells as detected by anti-GFP
antibody (green). Note that CXXC5 localizes both to nuclear and cytoplasmic compartments. B, micrograph
showing transfected Myc-Dvl in COS7 cells as revealed by immunocytochemistry (red). C, merged micrographs
demonstrating the extent of subcellular co-localization of GFP-CXXC5 and Myc-Dvl in the cytoplasm (yellow).
D, merged micrographs depicting GFP-CXXC5, Myc-Dvl, and nuclear staining using DAPI (blue).
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
FEBRUARY 6, 2009•VOLUME 284•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3677
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
To ensure that the resulting increase in CXXC5-GFP fluorescence
intensity was a specific consequence of the photobleaching
of Dvl2-Alexa555 and not a result of laser excitation,
we decreased the laser power during photobleaching to levels
unable to fully bleach Dvl2-Alexa555. Dvl2-Alexa555 fluorescence
intensity following the photobleaching protocol was
reduced to 20–30% (20% laser power), 40–50% (10% laser
power), or unchanged (0.1% laser power). In none of these cases
was the CXXC5-GFP fluorescence intensity enhanced after
photobleaching (20% laser power, 101.2 Ϯ 1.3, n ϭ 7; 10% laser
power, 97.8 Ϯ 3.3, n ϭ 7; 0.1% laser power, 98.8 Ϯ 0.6, n ϭ 6).
To further assure that the observed FRET between CXXC5
and Dvl2 uniquely reflected a property of this pair of proteins,
we performed control experiments in NSCs using nucleofection
and expression of either GFP alone or of another GFPtagged
cytoplasmic protein, NFATc1. FRET analysis was performed
using GFP/GFP-NFATc1 (donor) and the same
Alexa555-labeled secondary antibody to detect the Dvl2 antibody
(Dvl2-Alexa555, acceptor). No significant change in
donor emission ratio before and after acceptor photobleaching
was found for neither of these molecular pairs (n ϭ 11, data not
shown).
Taken together, these results indicate that CXXC5 and Dvl2
are located in close proximity (Ͻ14 nm) strengthening the suggestion
that there is a specific physical association between
CXXC5 and Dvl2 in NSCs.
BMP4 Stimulation or Overexpression of CXXC5 Attenuates
the Expression Levels of the Wnt3a Target Gene Axin2 in
NSCs—To elucidate a functional role for the BMP4-induced
increase in CXXC5 expression levels and the interaction
between CXXC5 and Dvl, we next aimed at investigating the
effects of CXXC5 overexpression on the response to Wnt signaling
in the NSCs. In the developing nervous system, canonical
Wnt signaling by Wnt3a has been show to exert cross-talk
with BMP signaling in the neural crest and in the dorsal regions
of the developing telencephalon (1, 9, 10, 36) where high levels
of CXXC5 expression were found (Fig. 2, A and D).
To first investigate the responsiveness of telencephalic NSCs
to dorsally expressed signaling factors, we used RT-qPCR to
estimate the endogenous levels of the bona fide Wnt target
Axin2 in response to short-term exposure to recombinant
BMP4 or Wnt3a. Axin2 gene expression is directly regulated by
the Wnt signaling mediator ß-catenin and is commonly used as
a measurement for canonical Wnt signaling activity (37–39).
BMP4 treatment led to significantly reduced levels of Axin2
expression within 6 h, in accordance with an up-regulation of
CXXC5 and thus inhibitory effect on Wnt signaling activity
(Fig. 6A). In contrast, Wnt3a stimulation resulted in a significant
increase (Ϸ4-fold) in Axin2 mRNA expression 4 h after
stimulation compared with control (Fig. 6B, black bars).
To study whether the Wnt3a response would be affected by
increased levels of CXXC5 as assessed by Axin2 expression levels,
we next overexpressed CXXC5 in the NSCs by nucleofection.
Nucleofection efficiency was estimated to vary between
30–60% in individual experiments with the NSCs. Overexpression
of CXXC5 resulted in a marked attenuation of the Wnt3amediated
increase in Axin2 expression levels (Fig. 6B). A
decrease in Axin2 expression levels was seen also in FGF2treated
control cultures by CXXC5 overexpression (Fig. 6B).
These results suggest that high levels of CXXC5 interfere with
the response to Wnt3a stimulation in NSCs.
CXXC5 Overexpression Attenuates Wnt3a-mediated Increase
in TOPflash Reporter Activity—To see whether the effect of
CXXC5 on Wnt signaling was selective for Axin2 expression in
NSCs or a general effect on canonical Wnt signaling, we next
investigated the effects of CXXC5 expression on Wnt3a mediated
activation of a TOPflash reporter in HEK-293 cells, a comFIGURE
5. FRET experiments reveal that CXXC5-GFP and endogenous
Dvl2 are localized in close proximity in neural stem cells. Acceptor pho-
tobleachingFRETmeasurementswereperformedonNSCsnucleofectedwith
CXXC5-GFP (donor) and in which Dvl2 was revealed by an Alexa555-coupled
IgG secondary antibody (acceptor). A, expression of Dvl2-Alexa555 and
CXXC5-GFP in NSCs before (left panel) and after (right panel) acceptor photobleaching.
The bleached region is indicated by a white rectangle on the pictures.
Scale bar: 5 ␮m. B, quantitative analysis of the FRET changes before
and after photobleaching, with the number of cells analyzed in parentheses.
***, p Ͻ 0.001.
FIGURE 6. BMP4 exposure or CXXC5 overexpression strongly reduces the
expression of the canonical Wnt signaling target Axin2 in neural stem
cells. A, mRNA expression levels of Axin2 relative to control mRNA (TBP) in
NSC cultures as assessed by RT-qPCR after FGF2 versus BMP4 exposure for 6 h.
The bars represent average levels after three independent experiments in
triplicates. B, mRNA expression levels of Axin2 relative to control (HPRT) after
nucleofections with either empty vector or expression vector for CXXC5 after
4 h. The Wnt3a-mediated increase in expression of Axin2 decreases significantly
after CXXC5 overexpression, but the Axin2 expression remains higher
than in control cultures. The bars represent an average of two independent
experiments in triplicates.
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
3678 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 6•FEBRUARY 6, 2009
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
monly used assay for studies of canonical Wnt signaling (11).
Control experiments confirmed that reporter activity was
robustly activated by overexpression of the canonical Wnt signaling
mediator ß-catenin (Fig. 7A). Transfections of increasing
amounts of CXXC5 revealed that 100 ng of CXXC5 significantly
inhibited the TOPflash reporter activity induced by 50 or
100 ng of recombinant Wnt3a (Fig. 7B). In addition, a decrease
in Wnt3a-induced activated (dephosphorylated) ß-catenin was
observed in CXXC5-transfected cells, although no significant
changes in the total protein levels of ß-catenin or Dvl could be
detected (Fig. 7, C and D). Hence these experiments strengthen
the suggestion of a role for CXXC5 in modulating canonical
Wnt signaling activity.
siRNA Against CXXC5 Attenuates the BMP4 Response and
Facilitates the Wnt3a Response in NSCs—The results from the
overexpression experiments allowed us to speculate whether a
reduction of the endogenous levels of CXXC5 should attenuate
the BMP4-mediated decrease in Axin2 expression levels and
facilitate Wnt3a signaling effects in the NSCs. To study the role
for CXXC5 in more physiological cellular conditions, we developed
an siRNA strategy that after nucleofection reduced the
levels of CXXC5 with 40–70% (see “Experimental Procedures”)
but did not reduce Idax levels significantly in control cultures
(Fig. 8A and data not shown). We then used this siRNA against
CXXC5, named sir-CXXC5, in comparison with an unrelated
siRNA against cyan fluorescent protein (sir-CFP) to investigate
putative changes in the NSCs response to BMP4 and Wnt3a as
assessed by RT-qPCR measurement of Axin2 gene expression
levels after 4h exposure. Interestingly, administration of sirCXXC5
24 h before exposure of BMP4 resulted in an almost
complete abolishment of the BMP4-mediated reduction of
Axin2 levels (Fig. 8B). Cultures treated with sir-CXXC5 displayed
around 10% reduction of Axin2 expression levels after
BMP4 exposure, compared with an average of 60% reduction in
cells that were nucleofected with sir-CFP (Fig. 8B). As the efficiency
of the siRNA was significantly lower than 100% in our
experiments (40–70%), a complete reversal of the BMP4/
Wnt3a-mediated effects was not expected. Accordingly, sirCXXC5
facilitated the increase in Axin2 levels in Wnt3a stimulated
cultures compared with those cultures that received
control siRNA (Fig. 8B). It should be noted that the Wnt3amediated
increase in Axin2 was lower in all siRNA-transfected
cultures than in any of the other experimental series, which we
speculate is due to the siRNA treatment per se (40). We conclude
that CXXC5 is a mediator of BMP4-mediated modulation
of Wnt signaling in NSCs.
FIGURE 7. CXXC5 overexpression attenuates Wnt3a-mediated TOPflash
reporter activity. A, relative luciferase activity of a TOPflash reporter construct
in HEK-293 cells after co-transfections with empty (left bar) or ß-catenin
(right bar) expression vectors. Bars illustrate the average from two independent
experiments in triplicates. B, relative luciferase activity of the TOPflash
reporter construct in HEK-293 cells after treatment with 50 (left bars) or 100
(right bars) ng of purified Wnt3a and co-transfections with 0, 50 or 100 ng of
CXXC5-containing expression vector. Note the marked decrease in reporter
activityafterco-transfectionwith100ngCXXC5construct.Barsrepresenttwo
independent experiments in triplicates. C, immunoblotting of total cell
extracts from a fraction of the HEK-293 cells used in the corresponding luciferase
experiments shown in B. No significant changes in total protein levels
wereseenafterimmunoblottingwithß-cateninorDvlantibodies.ß-actinwas
used as loading control. D, immunoblotting of total cell extracts corresponding
to C using an antibody against activated (dephosphorylated) ß-catenin
(ABC) compared with loading control (ß-actin). The relative increase in ABC
induced by Wnt3a is decreased in cells transfected with CXXC5.
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
FEBRUARY 6, 2009•VOLUME 284•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3679
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
DISCUSSION
BMP4 treatment induces differentiation of NSCs in vitro into
astrocytic and mesenchymal cells (4, 5) and is required for the
proper development of the dorsal-most telencephalic structures,
such as the hippocampal formation and the non-neuronal
choroid plexus (1–3). In addition, BMP4 is in coordination
with Wnt3a and FGF8 required for the correct size and regionalization
of the dorsal pallium (1, 10). Yet little is understood
regarding the cellular properties that allow and restrict these
multiple and complex outcomes downstream of BMP4. In this
study, we have identified CXXC5 as a novel potential target for
cross-talk between BMP4 and canonical Wnt3a signaling as we
show that CXXC5 is induced by BMP4 stimulation, selectively
expressed in the BMP4-rich dorsal telencephalon, interacting
with the Wnt signaling intermediate Dvl, and modulates the
response to Wnt3a exposure in NSCs.
The telencephalic choroid plexus extends from the ventricular
zone into the ventricles and produces and secretes the cerebrospinal
fluid. Many non-neural cell types can be found in the
choroid plexus, including epithelial and mesenchymal cells.
Interestingly while Wnt3a expression is excluded from the
developing choroid plexus, both BMP4 and CXXC5 expression
levels are high in this region (Fig. 2 and Ref. 41). It appears that
while Wnt3a is required for neuronal progression from these
regions contributing to hippocampal structures, Wnt3a seems
dispensable for choroid plexus development (1). A possible
functional role for CXXC5 in forebrain development could
therefore be to repress the effects of long range Wnt3a signaling
to allow BMP4-dependent formation of the choroid plexus.
Future studies using conditional gene deletion strategies specifically
targeting CXXC5 in the developing dorsal telencephalon
will be required to test this hypothesis.
The Xenopus homologue of the closely related factor Idax
(CXXC4), named Xidax, has been shown to disrupt the correct
formation of anterior brain structures when overexpressed in
the developing Xenopus forebrain (13). This is not surprising
considering its interaction with Dvl
and thus interference with canonical
Wnt signaling (11). The expression
pattern of Idax in mammalian
brain is not yet reported, but we
have noted that Idax is expressed in
telencephalic NSCs6
suggesting that
it may be expressed also in the dorsal
telencephalon. Although the
sequence in the C-terminal parts of
Idax and CXXC5 are very similar,
the N-terminal domain shows clear
divergences. Further, whereas Idax
subcellular localization is preferentially
cytoplasmic (11), CXXC5 is
predominantly nuclear. It will
therefore be of interest to investigate
whether Idax and CXXC5 work
synergistically, complementary, or
antagonistically. It has been demonstrated
that the CXXC domain in
the founding members of the CXXC
family, the MBD proteins, participate in DNA and protein
interactions (12). In addition, several of the other CXXC
domain containing proteins have been shown to participate in
chromatin modifying mechanisms and regulate and interfere
with the activity of chromatin modifying factors, such as Polycomb
proteins (12). It is therefore possible that some of the
effects of CXXC5 are due to additional function/s in the
nucleus, and ongoing studies are focusing on elucidating a
potential role for nuclear CXXC5.
In summary, our results suggest that CXXC5 is a BMP4regulated
modulator of Wnt signaling essential for proper
response of telencephalic stem cells to canonical Wnt3a signaling.
We speculate that the functional role of CXXC5 in telencephalic
development may be to contribute to the establishment
of the demarcation between BMP4 and Wnt3a signaling
regions during the development of hippocampal and choroid
plexus formations.
Acknowledgments—We thank Per Uhle´n for advice on FRET, Lars
Bjo¨rklund and the members of the Hermanson laboratory for discussions,
John L. R. Rubenstein for constructs, and Christer Ho¨o¨g, Claes
Wahlestedt, Ole Isacson, and Jamie Timmons for support.
REFERENCES
1. Shimogori, T., Banuchi, V., Ng, H. Y., Strauss, J. B., and Grove, E. A. (2004)
Development 131, 5639–5647
2. Panchision, D. M., Pickel, J. M., Studer, L., Lee, S. H., Turner, P. A., Hazel,
T. G., and McKay, R. D. (2001) Genes Dev. 15, 2094–2110
3. Hebert, J. M., Mishina, Y., and McConnell, S. K. (2002) Neuron 35,
1029–1041
4. Tsai, R. Y., and McKay, R. D. (2000) J. Neurosci. 20, 3725–3735
5. Rajan, P., Panchision, D. M., Newell, L. F., and McKay, R. D. (2003) J. Cell
Biol. 161, 911–921
6. van Grunsven, L. A., Verstappen, G., Huylebroeck, D., and Verschueren,
K. (2005) Cytokine Growth Factor Rev. 16, 495–512
6
T. Andersson and O. Hermanson, unpublished observations.
FIGURE 8. siRNA against CXXC5 modulates BMP4- and Wnt3a-mediated effects on endogenous Axin2
levels in neural stem cells. A, mRNA expression of CXXC5 relative to control (TBP) in NSC cultures receiving
either a control siRNA (sir-CFP, see “Results”) or an siRNA directed against CXXC5 (sir-CXXC5) after exposure to
FGF2, BMP4, or Wnt3a for 4 h. NSC cultures that have received sir-CXXC5 show significantly lower levels of
CXXC5 mRNA. B, mRNA expression levels of Axin2 relative to control (TBP) in NSC cultures as assessed by
RT-qPCR after transfections with either control siRNA (sir-CFP) or siRNA against CXXC5 (sir-CXXC5) after 4 h of
exposure to FGF2, BMP4 or Wnt3a. Notably, NSCs that have received sir-CXXC5 show almost no down-regulation
of Axin2 after BMP4 exposure. *, p Ͻ 0.05 compared with basal FGF2-treated control, n ϭ 6.
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
3680 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 6•FEBRUARY 6, 2009
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
7. Xu, L. (2006) Biochim. Biophys. Acta 1759, 503–513
8. Dahlqvist, C., Blokzijl, A., Chapman, G., Falk, A., Dannaeus, K., Ibanez,
C. F., and Lendahl, U. (2003) Development 130, 6089–6099
9. Kleber, M., Lee, H. Y., Wurdak, H., Buchstaller, J., Riccomagno, M. M.,
Ittner, L. M., Suter, U., Epstein, D. J., and Sommer, L. (2005) J. Cell Biol.
169, 309–320
10. Sur, M., and Rubenstein, J. L. (2005) Science 310, 805–810
11. Hino, S., Kishida, S., Michiue, T., Fukui, A., Sakamoto, I., Takada, S.,
Asashima, M., and Kikuchi, A. (2001) Mol. Cell. Biol. 21, 330–342
12. Katoh, M. (2004) Int. J. Oncol. 25, 1193–1199
13. Michiue, T., Fukui, A., Yukita, A., Sakurai, K., Danno, H., Kikuchi, A., and
Asashima, M. (2004) Dev. Dyn. 230, 79–90
14. Johe, K. K., Hazel, T. G., Muller, T., Dugich-Djordjevic, M. M., and McKay,
R. D. (1996) Genes Dev. 10, 3129–3140
15. Hermanson, O., Jepsen, K., and Rosenfeld, M. G. (2002) Nature 419,
934–939
16. Brunkhorst, A., Karlen, M., Shi, J., Mikolajczyk, M., Nelson, M. A., Metsis,
M., and Hermanson, O. (2005) Mol Cell Neurosci 29, 250–258
17. Marko, N. F., Frank, B., Quackenbush, J., and Lee, N. H. (2005) BMC
Genomics 6, 27
18. Smyth, G. K. (2004) Stat. Appl. Genet. Mol. Biol. 3, Article 3
19. Kawate, T., Allerson, C. R., and Wolfe, J. L. (2005) Org. Lett 7, 3865–3868
20. Schaeren-Wiemers, N., and Gerfin-Moser, A. (1993) Histochemistry 100,
431–440
21. Ossipova, O., Dhawan, S., Sokol, S., and Green, J. B. (2005) Dev. Cell 8,
829–841
22. Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007) J. Cell Sci.
120, 586–595
23. Miyakawa-Naito, A., Uhlen, P., Lal, M., Aizman, O., Mikoshiba, K., Brismar,
H., Zelenin, S., and Aperia, A. (2003) J. Biol. Chem. 278, 50355–50361
24. Uhlen, P. (2003) Ann. N. Y. Acad. Sci. 986, 514–518
25. Wouters, F. S., Verveer, P. J., and Bastiaens, P. I. (2001) Trends Cell Biol.
11, 203–211
26. Ilkhanizadeh, S., Teixeira, A. I., and Hermanson, O. (2007) Biomaterials
28, 3936–3943
27. Sacchetti, P., Dwornik, H., Formstecher, P., Rachez, C., and Lefebvre, P.
(2002) J. Biol. Chem. 277, 35088–35096
28. Sailer, M. H., Hazel, T. G., Panchision, D. M., Hoeppner, D. J., Schwab,
M. E., and McKay, R. D. (2005) J. Cell Sci. 118, 5849–5860
29. Samanta, J., and Kessler, J. A. (2004) Development 131, 4131–4142
30. Allen, B. L., Tenzen, T., and McMahon, A. P. (2007) Genes Dev. 21,
1244–1257
31. Lee, C. S., Buttitta, L., and Fan, C. M. (2001) Proc. Natl. Acad. Sci. U. S. A.
98, 11347–11352
32. Martinelli, D. C., and Fan, C. M. (2007) Genes Dev. 21, 1231–1243
33. Biemar, F., Nix, D. A., Piel, J., Peterson, B., Ronshaugen, M., Sementchenko,
V., Bell, I., Manak, J. R., and Levine, M. S. (2006) Proc. Natl. Acad. Sci.
U. S. A. 103, 12763–12768
34. Itoh, K., Brott, B. K., Bae, G. U., Ratcliffe, M. J., and Sokol, S. Y. (2005)
J. Biol. 4, 3
35. Leonard, J. D., and Ettensohn, C. A. (2007) Dev. Biol. 306, 50–65
36. Ille, F., Atanasoski, S., Falk, S., Ittner, L. M., Marki, D., Buchmann-Moller,
S., Wurdak, H., Suter, U., Taketo, M. M., and Sommer, L. (2007) Dev. Biol.
304, 394–408
37. Yan, D., Wiesmann, M., Rohan, M., Chan, V., Jefferson, A. B., Guo, L.,
Sakamoto, D., Caothien, R. H., Fuller, J. H., Reinhard, C., Garcia, P. D.,
Randazzo, F. M., Escobedo, J., Fantl, W. J., and Williams, L. T. (2001) Proc.
Natl. Acad. Sci. U. S. A. 98, 14973–14978
38. Lustig, B., Jerchow, B., Sachs, M., Weiler, S., Pietsch, T., Karsten, U., van de
Wetering, M., Clevers, H., Schlag, P. M., Birchmeier, W., and Behrens, J.
(2002) Mol. Cell. Biol. 22, 1184–1193
39. Jho, E. H., Zhang, T., Domon, C., Joo, C. K., Freund, J. N., and Costantini,
F. (2002) Mol. Cell. Biol. 22, 1172–1183
40. Jepsen, K., Solum, D., Zhou, T., McEvilly, R. J., Kim, H. J., Glass, C. K.,
Hermanson, O., and Rosenfeld, M. G. (2007) Nature 450, 415–419
41. Furuta, Y., Piston, D. W., and Hogan, B. L. (1997) Development 124,
2203–2212
CXXC5 Is a Neural BMP4-induced Modulator of Wnt Signaling
FEBRUARY 6, 2009•VOLUME 284•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3681
atKarolinskainstitutetlibraryonFebruary3,2009www.jbc.orgDownloadedfrom
Vítězslav Bryja, 2014    Attachments 
 
 
#9 
 
 
Witte F1
, Bernatik O1
, Kirchner K, Masek J, Mahl A, Krejci P, Mundlos S, Schambony A, 
Bryja V*, Stricker S.* (2010): Negative regulation of Wnt signaling mediated by CK1‐
phosphorylated Dishevelled via Ror2. FASEB J. 24(7):2417‐26. 
1
 equal contribution, * corresponding authors 
 
 
Impact factor (2010): 6.515 
Times cited (without autocitations, WoS, Feb 21st 2014): 14 
Significance:  The  first  study  showing  physical  interaction  of  Ror2,  a  Wnt  receptor 
dedicated  to  non‐canonical  Wnt  signaling,  and  Dishevelled.  The  interaction  is 
controlled  by  CK1  and  requires  C‐terminus  of  Dishevelled.  The  first  study  that 
pointed towards an important regulatory role of Dishevelled C‐terminus. 
Contibution of the author/author´s team: Biochemical description of the interaction, 
functional in vitro data. 
 
 
   
 
 
 
The FASEB Journal • Research Communication
Negative regulation of Wnt signaling mediated by CK1phosphorylated
Dishevelled via Ror2
Florian Witte,*,†,‡,1
Ondrej Bernatik,§,ʈ,1
Katharina Kirchner,¶
Jan Masek,§,ʈ
Annika Mahl,*,†,‡
Pavel Krejci,§,ʈ
Stefan Mundlos,*,†
Alexandra Schambony,¶
Vitezslav Bryja,§,ʈ,2
and Sigmar Stricker*,†,2
*Development and Disease Group, Max Planck-Institute for Molecular Genetics, Berlin, Germany;
†
Institute for Medical Genetics, University Medicine Charite´, Berlin, Germany; ‡
Institut fu¨r Chemie/
Biochemie, Freie Universita¨t Berlin, Berlin, Germany; §
Institute of Experimental Biology, Faculty of
Science, Masaryk University, Brno, Czech Republic; ʈ
Department of Cytokinetics, Institute of
Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic; and ¶
Developmental
Biology Unit, Biology Department, University of Erlangen-Nuremberg, Erlangen, Germany
ABSTRACT Dishevelled (Dvl) is a multifunctional
effector of different Wnt cascades. Both canonical
Wnt3a and noncanonical Wnt5a stimulate casein-kinase-1
(CK1) -mediated phosphorylation of Dvl, visualized
as electrophoretic mobility shift [phosphorylated
and shifted Dvl (ps-Dvl)]. However, the role of this
phosphorylation remains obscure. Here we report the
functional interaction of ps-Dvl with the receptor tyrosine
kinase Ror2, which is an alternative Wnt receptor
and is able to inhibit canonical Wnt signaling. We
demonstrate interaction between Ror2 and ps-Dvl at the
cell membrane after Wnt3a or Wnt5a stimulus dependent
on CK1. Ps-Dvl interacts with the C-terminal
proline-serine-threonine-rich domain of Ror2, which is
required for efficient inhibition of canonical Wnt signaling.
We further show that the Dvl C terminus, which
seems to be exposed in ps-Dvl and efficiently binds
Ror2, is an intrinsic negative regulator of the canonical
Wnt pathway downstream of ␤-catenin. The Dvl C
terminus is necessary and sufficient to inhibit canonical
Wnt/␤-catenin signaling, which is dependent on the
presence of Ror2. Furthermore, both the Dvl C terminus
and CK1␧ can inhibit the Wnt5a/Ror2/ATF2 pathway
in mammalian cells and Xenopus explant cultures.
This suggests that phosphorylation of Dvl triggers negative
feedback regulation for different branches of Wnt
signaling in a Ror2-dependent manner.—Witte, F., Bernatik,
O., Kirchner, K., Masek, J., Mahl, A., Krejci, P.,
Mundlos, S., Schambony, A., Bryja, V., Stricker, S.
Negative regulation of Wnt signaling mediated by CK1phosphorylated
Dishevelled via Ror2. FASEB J. 24,
2417–2426 (2010). www.fasebj.org
Key Words: Wnt/␤-catenin signaling ⅐ casein kinase ⅐ Wnt5a
⅐ Xenopus
The wnt family of secreted signaling molecules,
consisting of 19 members in mammals, plays multiple
roles in embryonic development, adult homeostasis,
and disease. In humans, deregulation of Wnt cascades
is responsible for human diseases, including cancer,
bone density defects, and limb malformations (1).
Classically, Wnt ligands are divided into factors that
can activate the so-called canonical branch, acting via
stabilization of ␤-catenin or factors that activate several
alternative pathways that have been collectively termed
noncanonical cascades. Wnt molecules activating the
canonical pathway, e.g., Wnt3a, bind surface receptors
of the Frizzled and lipoprotein receptor-related protein
(Lrp) families and induce the dispersal of a protein
complex that targets ␤-catenin for proteasomal destruction.
This leads to accumulation of ␤-catenin levels in
the cell and nuclear translocation of ␤-catenin, where it
interacts with transcription factors of the Tcf/Lef family
to activate transcription (1, 2).
Wnt5a, the founding member of the “noncanonical”
Wnt class, was shown to activate or inhibit canonical Wnt
signaling dependent on the presence of the coreceptor
Ror2 (3). In addition, Wnt5a can signal to noncanonical
pathways via Ror2. In Xenopus gastrulation, Wnt5a via
Ror2 triggers a novel noncanonical pathway implicating
PI3-kinase, Cdc42, JNK, and ATF2/c-Jun (hereafter referred
to as Wnt5a/Ror2/ATF2 pathway) to regulate the
expression of paraxial protocadherin (XPAPC) and coordinate
convergent extension movements (4). Binding of
Wnt5a to Ror2 results in dimerization and phosphorylation
of Ror2 (5, 6).
Ror2 is a receptor tyrosine kinase (RTK) consisting of
conserved extracellular immunoglobulin (IG), cysteine-rich
(CRD), and kringle (KR) domains, a cytoplasmic
kinase domain, and, as a unique feature among
RTKs, distally located proline- and serine/threoninerich
(PST-rich) domains (7).
A critical component of several Wnt-signaling
branches is the cytoplasmic protein Dishevelled (Dvl).
Dvl proteins carry an N-terminal DIX (Dishevelled/
1
These authors contributed equally to this work.
2
Correspondence: S.S., Development and Disease Group,
Max Planck Institute for Molecular Genetics, Ihnestr. 73,
14195 Berlin, Germany. E-mail: strick_s@molgen.mpg.de;
V.B., Institute of Experimental Biology, Faculty of Science,
Masaryk University, Kotla´rˇska´ 2, 61137 Brno, Czech Republic.
E-mail: bryja@sci.muni.cz
doi: 10.1096/fj.09-150615
24170892-6638/10/0024-2417 © FASEB
Axin) domain, a central PDZ (PSD-95; DLG, ZO1)
domain, and a DEP (Dishevelled, EGL-10, Pleckstrin)
domain, each with a variety of interaction partners. The
C terminus of the Dvl proteins comprises ϳ220 aa
[hereafter termed Dvl C terminus (Dvl-CT)], a domain
for which no function has been described so far.
Depending on Wnt stimulation and receptor context,
Dvl can inhibit the ␤-catenin destruction complex,
thereby stabilizing ␤-catenin and activating canonical
Wnt signaling, or Dvl can regulate some of the noncanonical
branches of Wnt signaling (8, 9). In response to
Wnt ligands, several kinases, including casein kinases
(CKs) CK1␦, CK1ε, and CK2, PKC, MAK, and PAR1, have
been reported to phosphorylate Dvl, but the relevance of
individual Dvl phosphorylation remains unclear (10–17).
In this study, we report the interaction of Ror2
specifically with the C terminus of CK1-phosphorylated
Dishevelled (ps-Dvl) and reveal that the Dvl-CT is an
intrinsic negative regulator of the canonical Wnt-signaling
cascade depending on the presence of Ror2. Inhibition
of canonical Wnt signaling is not mediated via
the Wnt5a/Ror2/ATF2 cascade, but CK1 and Dvl-CT
also antagonize this pathway. These findings indicate a
yet unappreciated role for CK1-phosphorylated Dvl,
which mediates negative feedback control of canonical
as well as noncanonical Wnt cascades.
MATERIALS AND METHODS
Constructs and antibodies
Full-length (FL) and truncated mouse Ror2 constructs were
described previously (18). We thank Yasuhiro Minami (Kobe
University, Kobe, Japan) for Ror2–13S/T and Ror2–5YF constructs
(19). Human Ror2 constructs were described previously
(20). Dvl2-HA was kindly provided by Ulrich Stelzl (Max
Planck-Institute for Molecular Genetics, Berlin, Germany),
Dvl3-Flag, XWnt-8, XWnt5a, XDsh, and ␤-catenin constructs
were provided by Randall T. Moon [Howard Hughes Medical
Institute (HHMI), Seattle, WA, USA], and pCS2-Xror2 was
provided by Maranori Taira (Tokyo University, Tokyo, Japan).
We thank Shin-ichi Yanagawa (Kyoto University, Kyoto,
Japan), Robert J. Lefkowitz (HHMI, Durham, NC, USA), and
Jonathan M. Graff (University of Texas, Dallas, TX, USA) for
expression vectors encoding Dvl2-Myc, CK1ε, and CK1ε
(KϾR). CK2 constructs were kindly provided by Isabel
Dominguez (Boston University, Boston, MA, USA). PAR1
expression constructs (13) were obtained from Olga Ossipova
and Sergei Sokol (Mount Sinai School of Medicine, New
York, NY, USA).
The following antibodies were used in immunoprecipitation:
Western blot or immunofluorescence: anti-Ror2 (R&D
Systems, Minneapolis, MN, USA); anti-Dvl2 (sc-13974), antiDvl3
(sc-8027), anti-CK1ε (sc-25423), anti-JNK, anti-pJNK
(sc-6254), anti-AKT1,2,3, anti-Myc (sc-40 for WB, sc-789 for
IP) (Santa Cruz Biotechnology, Santa Cruz, CA, USA); antiAKTpS473
(ab18206), anti-pATF2 (ab 4734), anti-HA for IP
(ab9110) (Abcam, Cambridge, UK); anti-HA for Western blot
(H6908–2), anti-␤-actin (A5441), anti-Flag (M2 for WB,
F7425 for IP) (Sigma-Aldrich, St. Louis, MO, USA); anti-CK2␣
(BD Biosciences, Franklin Lakes, NJ, USA), and anti-FL-ATF2
(Cell Signaling, Beverly, MA, USA). Secondary antibodies for
immunofluorescence: AlexaFluor 568 and 488 (Invitrogen
Molecular Probes, Carlsbad, CA, USA).
Cell culture and immunofluorescence
Hek293T, Cos-7, and Cos-1 cells were grown in 5–10% fetal
calf serum (FCS, heat inactivated) according to standard
protocols.
For immunofluorescence, cells were transfected with either
ExGen500 (Fermentas, Burlington, ON, Canada) or Polyfect
(Qiagen, Hilden, Germany), with constructs as indicated. For
immunofluorescence, 24 h after transfection, cells were
starved 2 h in medium containing 1% FCS followed by
stimulation with 200 ng/ml recombinant Wnt5a or Wnt3a
(R&D Systems). D4476 (100 ␮M; Calbiochem, San Diego, CA,
USA) was added together with Fugene (1 ␮l/200 ml; Roche,
Mannheim, Germany) to enhance penetration. Cells were
fixed with ice-cold methanol, and immunodetection was
performed according to standard procedures. Pictures were
taken with a Zeiss Axiovert 200M microscope using ApoTome
optics (Zeiss, Jena, Germany) and processed with Axiovision
software (Zeiss). For quantification, 100 cells in each of 3–5
independent experiments were photographed and analyzed
for yellow membrane staining.
For Wnt5a/Ror2 pathway analysis, Cos-1 cells were serumstarved
for 16 h and stimulated with 100 ng/ml recombinant
Wnt5a (R&D Systems) in SF-DMEM for the indicated time
periods. Cell extracts were prepared using NOP buffer,
protein content was quantified by BCA assay (Pierce, Rockford,
IL, USA), and equal amounts were subjected to SDSPAGE
and transferred to PVDF membranes. For CK1 inhibition,
cells were pretreated with D4476/Fugene for 30 min
before stimulation with Wnt5a.
Coimmunoprecipitation and Western blotting
Coimmunoprecipitation was performed in Cos-7 cells transfected
with the indicated plasmids using polyethyleneimine as
described previously (21). Immunoprecipitation and Western
blotting were performed essentially as described previously
(22). When required, Western blots were quantified by densitometry
using ImageJ 1.42 software (U.S. National Institutes
of Health, Bethesda, MD, USA).
Dual luciferase assay
HEK293 cells were transfected with mixture of SuperTopFlash
(100 ng), pRL-TK (50 ng, internal control), and
other plasmids as indicated, in a 24-well plate using polyethyleneimine,
as described previously (21). Cells were
lysed 24 h after transfection and further processed using
the Dual-Luciferase®
Reporter 1000 Assay System (Promega,
Madison, WI, USA) according to the manufacturerЈs
instructions and measured on a luminometer. Confirmation
of the expression levels of the proteins overexpressed
in the reporter assays was assessed in parallel experiments
by Western blotting and detection with appropriate antibodies
(see Supplemental Fig. 5).
siRNA treatment
HEK293 cells were transfected with siRNA using retrofection
according to the manufacturerЈs instructions (Ambion, Austin,
TX, USA). We mixed siRNAs (0.55 ␮l of 20 ␮M siRNA)
with lipofectamine 2000 (1.45 ␮l) and OptiMEM (48 ␮l) and
incubated them at room temperature for 20 min. The transfection
mixture was added to a 24-well plate and mixed with
a suspension of freshly trypsinized HEK293 cells (30,000
cells/well in 300 ␮l of complete medium). This procedure
results in a final siRNA concentration of 30 nM. Transfection
was terminated after 5 h by changing medium. After 24 h,
2418 Vol. 24 July 2010 WITTE ET AL.The FASEB Journal ⅐ www.fasebj.org
cells were transfected with appropriate plasmids according to
the transfection scheme. At 24 h posttransfection (48 h after
siRNA transfection), cells were collected for further analysis.
siRNAs against Ror2 were purchased from Ambion (I, catalog
no. s9758; II, s9759; III, s9760). Silencer®
Negative Control
siRNA (4635; Ambion) was used as negative control. The
efficiency of the silencing was assessed by Western blotting.
Injection and analysis of Xenopus laevis embryos
Capped mRNAs were transcribed from linearized DNA templates
(pCS2-XDsh, psp64T-XWnt-8, psp64T-␤-catenin, pcDNA-Ror2Flag,
pcDNA-Ror2⌬745Flag, pcDNA-Dvl3, pcDNA-Dvl3⌬C, pcDNADvl3CT,
pCS2-CK1ε, pCS2-XWnt5a, pCS2-XRor2) using mMessage
mMachine Kits (Ambion).
Eggs from human chorionic gonadotropin-treated females
were fertilized by standard methods and staged according to
Nieuwkoop and Faber (23). Morpholino and RNA were
injected into both cells of 2-cell-stage embryos or the marginal
zone of the ventral or dorsal blastomeres of 4-cell-stage
embryos in a total volume of 4 nl. If not mentioned otherwise
in the text, the following amounts were injected: XWnt-8, 8
pg; ␤-catenin, 100 pg; XDsh and Dvl3-C-term, 500 pg; Ror2
and Ror2⌬745, 200 pg; XWnt5a 100 pg, XRor2, 3 pg; CK 1ε,
5 pg. For axis duplication assays, embryos were cultivated till
stage 24 and scored for secondary body axes. For real-time
RT-PCR, Animal Cap explants were prepared at stage 8 and
cultivated for 4 h in Barth’s solution in the absence or
presence of 10 ␮M D4476. Real-time RT-PCR was carried out
as described previously (4).
In situ hybridization
Two-cell-stage embryos were injected in one blastomere with
80 pg ␤-galactosidase RNA and MO or RNA as indicated.
After fixation, the embryos were stained for ␤-galactosidase
activity. Whole-mount in situ hybridizations were carried out
by using the Digoxygenin/Alkaline Phosphatase detection
system (Roche) as described previously (24).
RESULTS AND DISCUSSION
Ror2 interacts via its PST-rich domain with the
Dvl-CT
Ror2 was previously implicated in canonical as well as
noncanonical Wnt signaling (3, 4, 25–27). We therefore
tested whether Dvl, a protein that participates in
both signaling cascades, could interact with Ror2. Using
coimmunoprecipitation, we found that mouse Ror2
can interact with mouse Dvl2 (Fig. 1A and Supplemental
Fig. 1). This interaction was abolished by deletion of
C-terminal parts of Ror2 (Ror2⌬745 and Ror2⌬469),
both representing mutations found in human brachydactyly
type 1 (BDB1) (28), but was not dependent on
the 2 extracellular domains for ligand and coreceptor
interaction (Ror2⌬CRD/KR) (Fig. 1A and Supplemental
Fig. 1). Thus, it is likely that the interaction is direct
and not mediated by secondary interaction of Ror2 with
Frizzled proteins, which have been shown to bind each
other via their CRDs (27). Both BDB1 mutants of Ror2
cannot interact with Dvl, indicating that this interaction
could be part of the molecular pathogenesis of BDB1.
To map the interaction domain on Dvl, we used Cand
N-terminally truncated forms of human Dvl3
(29) (Fig. 1B). HDvl3 also interacted with the Cterminal
PST-rich domain of mRor2 (Supplemental
Fig. 1C). Mouse Ror2 was coimmunoprecipitated
with all Dvl3 mutants to a variable degree. The
weakest interaction was observed between Ror2 and
FL Dvl3. The most efficient interaction was found
between the C terminus of Dvl3 (albeit very weakly
expressed) and Ror2 (Fig. 1B and Supplemental Fig.
1, quantification in Supplemental Table 1). The
truncations containing either the DIX or the DEP
domains but not the PDZ domain bound with intermediate
efficiency. The most probable explanation
of these results is that Dvl coimmunoprecipitates with
Ror2 via 2 binding sites. A high-affinity binding site
localizes to the C-terminal domain of Dvl, whereas
other low-affinity binding sites appear to exist outside
the C terminus. Notably, the DIX, PDZ, and DEP
domains of Dvl appear to be dispensable for highaffinity
binding to Ror2.
Figure 1. Interaction of Ror2 and CK1ε-phosphorylated ps-Dvl.
A, B) mRor2 (A) and hDvl3 (B) constructs used. Interaction is
indicated by ϩ or Ϫ. Ror2 interacts via its C-terminal proline/
serine/threonine-rich domain with Dvl2. A Ror2 mutant that
lacks the extracellular kringle and cystein-rich domains
(Ror2⌬CRD/KR) still interacts with Dvl2. Ror2 predominantly
interacts with the C terminus of Dvl3. Note that interaction with
full-length Dvl is weak. CRD, cysteine-rich domain; IG, immunoglobulin
domain; KR, kringle domain; P, proline-rich domain;
S/T, serine/threonine-rich domain; TK, tyrosine kinase domain;
TM, transmembrane domain. C) Ror2 specifically interacts
with Dvl phosphorylated by CK1ε. Phosphorylation of Dvl by
CKIε results in a visible size shift of the protein. Addition of CKIε
increases the pulldown efficiency of Dvl3 after Ror2 immunoprecipitation
and vice versa. Note that specifically the upper,
phosphorylated band of Dvl3 is enriched in the Ror2 pulldown
experiment. CK1ε is also coprecipitated with either Ror2-HA or
Dvl3-Flag. D) CK1ε but not CK2␣, CK2␤, or Par1 increases
interaction of Ror2 and Dvl3. E) Phosphorylation of Dvl by CK1ε
increases binding of full-length Dvl3 (construct 1) to Ror2, while
binding of constructs 4 and 7 remains unaffected.
2419INTERACTION OF CK1-PHOSPHORYLATED DVL WITH Ror2
Ror2 specifically interacts with CK1-phosphorylated Dvl
On Wnt stimulus, Dvl proteins become phosphorylated,
which can be seen as a shift of the apparent molecular
weight (ps-Dvl). One major Dvl-specific kinase that
stimulates the formation of ps-Dvl is CK1ε (11, 17, 22,
30, 31). To examine the influence of Dvl phosphorylation
status on the interaction with Ror2, we coexpressed
Ror2, Dvl3, and CK1ε in Cos-7 cells and performed
coimmunoprecipitation for Ror2 or Dvl3.
Without CK1ε, Ror2-immunoprecipitation resulted in a
weak pulldown of Dvl3 (Fig. 1C, black arrowhead).
Coexpression of CK1ε strongly increased the interaction
between Ror2 and Dvl3. Interestingly, ps-Dvl3 was
the predominant form found in the Ror2 pulldown
(Fig. 1C, white arrowhead). Vice versa, immunoprecipitation
of Dvl3 yielded a weak pulldown of Ror2 and was
boosted 3 times by the coexpression of CK1ε (Fig. 1C,
values for input were compared with values for pulldown;
see Supplemental Table 1 for densitrometric
data). Thus, these results provide evidence that Ror2
preferentially binds to CK1ε-phosphorylated ps-Dvl. We
observed the increase in Ror2/Dvl3 interaction only
with CK1ε but not with other kinases known to phosphorylate
Dvl, such as CK2 or PAR1 (Fig. 1D), indicating
that this is specific for CK1ε.
To further elucidate the putative mechanism of
CK1-stimulated interaction between Ror2 and Dvl, we
used full-length Dvl3 and 2 complementary truncated
versions, the Dvl3-CT and Dvl3⌬C (constructs
1, 4, and 7 in Fig. 1B). In the absence of CK1ε, Ror2
showed weak interaction with wild-type (wt) Dvl3 and
Dvl3⌬C and more efficient binding with Dvl3-CT, as
demonstrated above. Coexpression of CK1ε resulted
in a highly enhanced interaction with full-length
Dvl3 (4.2ϫ increase; pulldown relative to input), but
had no effects on the interaction with Dvl3-CT and
Dvl3⌬C (Fig. 1E). These results support the possibility
that facilitated interaction between Ror2 and
full-length Dvl in the presence of CK1ε could be due
to phosphorylation-induced conformational changes
that result in a better accessibility of the Dvl-CT
domain. Alternatively, CK1ε -mediated phosphorylation
of serine/threonine residues in Dvl3 might be
directly required for the high-affinity interaction with
Ror2; however, the observation that CK1ε coexpression
had no effect on Dvl3-CT and Dvl3⌬C argue
against this. Therefore, our data suggest that CK1ε
phosphorylation-induced conformational changes
expose the C-terminal binding interface of Dvl, leading
to strong interaction between ps-Dvl and Ror2.
Wnt stimulus induces Ror2/ps-Dvl interaction at the
membrane dependent of CK1
Phosphorylation of Dvl by CK1ε is seen in response to
Wnt5a (noncanonical) as well as Wnt3a (canonical)
signaling (22, 32, 33), As shown in Fig. 2A, the interaction
of endogenous Ror2 with Dvl3-Flag was markedly
enhanced by addition of recombinant Wnt5a. This
demonstrates that Dvl3 can more efficiently bind to
Ror2 not only after overexpression of CK1ε but also
after Wnt5a stimulus, which is one physiological activator
of CK1ε activity toward Dvl (22). To identify where
in the cell the Wnt5a-dependent interaction between
Ror2-Dvl is taking place, we transfected untagged human
Ror2 (20) into Cos-1 cells and monitored the
subcellular localization of endogenous Dvl2. Dvl proteins
locate in small cytoplasmic puncta and were
shown to be recruited to the membrane in noncanonical
PCP signaling (8, 34), as well as during canonical
Wnt signaling in Lrp6 signalosomes (35, 36).
Without stimulation, Ror2 localized to the membrane,
and endogenous Dvl2 showed a granular cytoplasmic
distribution (Fig. 2B). After 30 min of stimulation
with recombinant Wnt5a, a robust signal for Dvl2
was present at the membrane that colocalized with
Ror2 in a punctate pattern (Fig. 2C; quantifications
shown in Fig. 2E). This association of Dvl2 with Ror2 at
the membrane was also clearly detectable after Wnt3a
stimulus (Fig. 2D). Using the intracellular truncated
Ror2 reflecting the human BDB1 mutation Ror2W749X,
we were not able to detect Wnt5a- or Wnt3ainduced
colocalization of Dvl2 and Ror2 at the membrane
(Fig. 2F and Supplemental Fig. 2). Taken
together, these results for the first time visualize an
interaction of full-length Ror2 with Dvl2 at the cell
membrane induced by either Wnt5a or Wnt3a.
Based on the coimmunoprecipitations, we assume
that the fraction of Dvl2 that colocalizes with Ror2 at
the cell membrane represents ps-Dvl2. Indeed, it was
possible to induce such colocalization by cotransfection
of CK1ε (Fig. 2G). The involvement of endogenous
CK1 in the Wnt5a-induced colocalization of
Dvl2 and Ror2 was verified by the use of the CK1specific
inhibitor D4476, which blocks both ps-Dvl2
formation (22) and double-positive Dvl2/Ror2 punctae
formation at the membrane (Fig. 2H). Similar
results were obtained after Wnt3a stimulus (Supplemental
Fig. 2). This indicated that the punctae
represented an interaction of Ror2 with ps-Dvl phosphorylated
by CK1ε; however, effects of other CK1
isoforms cannot be ruled out.
CK1␧ kinase activity phosphorylating Dvl, but not
Ror2, is required for the interaction of Dvl and Ror2
at the cell membrane
A kinase-deficient variant of CK1ε (CK1ε-KD) was not
able to increase coprecipitation of Dvl with Ror2 (Fig.
1D). We thus tested whether the kinase activity of CK1ε
is also required for recruitment of Dvl to the cell
membrane by Ror2. Although expression of CK1ε
induced a strong overlap between Dvl2 and Ror2 at the
membrane, CK1ε-KD was not able to do so (Fig. 3A, B).
Notably, CK1ε-KD appeared to function as a dominant-negative
in this context, because it interfered
with the colocalization of Dvl2 and Ror2 induced by
either Wnt3a or Wnt5a (Fig. 3A, B), further emphasizing
the importance of CK1ε for Wnt-induced Dvl/
Ror2 interaction.
CK1ε interacts with both Ror2 and Dvl (17, 19);
hence it is conceivable that the interaction between
Ror2 and Dvl is mediated by CK1ε. However, the
2420 Vol. 24 July 2010 WITTE ET AL.The FASEB Journal ⅐ www.fasebj.org
CK1ε-KD isoform interacts with both Ror2 and Dvl
with comparable efficiency as wt CK1ε (19, 22).
Because CK1ε-KD neither increases Dvl pulldown
after precipitation of Ror2 (Fig. 1D) nor induces
Dvl2/Ror2 colocalization at the cell membrane, this
appears unlikely.
CK1ε has been previously described as a priming
kinase for Ror2 tyrosine kinase activity, phosphorylating
Ror2 on serine/threonine residues in the PST
domain (19). To exclude the possibility that phosphorylation
of Ror2 by CK1ε might be required for the
interaction with ps-Dvl, we performed pulldown assays
with a Ror2 mutant, where 13 serine and threonine
residues in the PST domain have been changed to
alanine (Ror2–13S/T), which prevents phosphorylation
by CK1ε (19). Following CK1ε overexpression,
this mutant is coimmunoprecipitated with Dvl2-Myc
with the same efficiency as wt Ror2 (Fig. 3C). Kani et
al. (19) postulated that Ror2 is in a complex with
Frizzled proteins at the cell membrane, which mediate
activation of CK1ε. So far it is unclear whether
binding of the Wnt ligand to Ror2 is also involved in
Figure 2. Wnt ligands induce Ror2-Dvl interaction at the cell membrane via a CK1-dependent mechanism. A) IP of endogenous
Ror2 from Cos-7 cells results in efficient pulldown of Dvl3-Flag only after treatment with Wnt5a. B–D) Wnt5a and Wnt3a lead
to recruitment of endogenous Dvl2 to the cell membrane in a punctate pattern overlapping with Ror2 expression in Cos-1 cells.
Untreated cells (B) and cells treated with Wnt5a (C) or Wnt3a (D) were transfected with hRor2 and immunolabeled with
anti-Ror2 and anti-Dvl2 antibodies. E) Quantification of Dvl/Ror2 membrane staining; percentage of cells showing overlapping
surface staining for Ror2 and Dvl2. Data are derived from 3 independent experiments. Error bars ϭ se. F) Truncated BDB1 mutant
of human Ror2 (Ror2-W749X) is unable to recruit Dvl to the membrane. G, H) CK1ε overexpression induces association of Ror2 and
Dvl2 (G), while CK1 inhibitor D4476 inhibits positive effects of Wnt5a on Ror2 and Dvl2 association at the cell membrane (H).
2421INTERACTION OF CK1-PHOSPHORYLATED DVL WITH Ror2
this process. As shown above, Dvl interacts with
Ror2⌬CRD/KR, which lacks the extracellular ligand
binding domains. In Cos-7 cells we also observed
Ror2⌬CRD and Dvl2 colocalization at the membrane
after Wnt5a and Wnt3a stimulus (Supplemental Fig.
3). This indicates that the Ror2/ps-Dvl association is
independent of Wnt binding to Ror2, supporting the
notion that activation of CK1ε is mediated by Wnt/
Frizzled signaling. Taken together it is likely that Ror2 is
located at the cell membrane in association with Wnt/
Frizzled/CK1ε complexes and can bind ps-Dvl emanating
from Wnt/Frizzled signaling.
Ror2 inhibits canonical Wnt signaling in vitro and in
vivo dependent on its C terminus
It is known that Ror2 can inhibit canonical Wnt signaling
(3, 37, 38), although the mechanism of this inhibition
remains somewhat elusive. We thus analyzed at which
level Ror2 can inhibit the canonical pathway using TOPflash
assays in HEK 293 cells. TOPflash activity induced by
overexpression of Dvl2 was further potentiated by coexpression
of CK1ε. Full-length Ror2 was able to inhibit
reporter activity induced by Dvl2 ϩ CK1ε or Dvl3 ϩ CK1ε
by ϳ70% (Fig. 4A and Supplemental Fig. 4). This was not
increased by addition of recombinant Wnt5a (data not
shown), indicating that overexpression of Ror2 alone was
sufficient to activate downstream signaling. The truncated
Ror2 mutant lacking the PST-rich domain, Ror2⌬745,
showed a strongly reduced inhibitory potential (Fig. 4A
and Supplemental Fig. 4). The Ror2–13ST/A mutant,
which cannot be phosphorylated by CK1ε, and the 5YF
mutant, which shows no autophosphorylation on CK1ε
stimulus (19), both exhibited an inhibitory potential
comparable to wt Ror2 in TOPflash assays (Fig. 4A and
Supplemental Fig. 4), indicating that phosphorylation
and activation of Ror2 by CK1ε is not required for the
inhibition of canonical Wnt signaling. Stimulation of
TCF/LEF-reporter activity with constitutively active (ca-)
␤-catenin obtained similar results (Fig. 4B), indicating
that in mammalian cells Ror2 can inhibit Wnt/␤-catenin
signaling downstream of ␤-catenin.
We then wanted to test whether Ror2 is able to antagonize
canonical Wnt-signaling in vivo. Axis duplication
assays in Xenopus embryos are a well-established readout
for canonical Wnt signaling. XWnt8a mRNA injection on
the ventral side of the embryo robustly induced secondary
axes in Xenopus embryos, which was inhibited by coinjection
of mRor2-wt mRNA, confirming that Ror2 acts as an
antagonist of canonical Wnt signaling in this assay (Fig.
4C). XDvl induced secondary axes to a much lower
percentage, which was still inhibited by coinjection of
mRor2 to a significant extent. Ror2⌬745, in contrast to wt
mRor2, was not able to bind XDvl in coimmunoprecipitation
experiments (Supplemental Fig. 6), and concordantly
had no significant effect on axis induction by
XWnt8a or XDvl (Fig. 4C). Ror2 was unable to significantly
inhibit secondary axes induced by injection of
X␤-catenin in this assay, although wt Ror2 (and not
Ror2⌬745) induced a slight decrease, which suggests that
a similar mechanism might act in both Xenopus and
mammalian cells.
Both data sets congruently show that the PST domain
of Ror2 is essential for the efficient inhibition of canonical
Wnt signaling, supporting the assumption that the interaction
of ps-Dvl with the Ror2-PST might be involved in
antagonizing canonical Wnt signaling.
Dvl-CT is a negative regulator of canonical Wnt
signaling dependent on Ror2
We then tested the role of the Dvl-CT in the canonical
Wnt pathway using the TOPflash assay. To this
end we stimulated TOPflash activity with either Dvl3
Figure 3. CK1ε kinase activity is required for Dvl2/Ror2 interaction. A) Immunolabeling
for transfected Ror2 and endogenous Dvl2 on Cos-1 cells. Transfection of CK1ε but not of
CK1ε-KD induces Dvl2/Ror2 colocalization at the membrane. CK1ε-KD also interferes
with Wnt3a- or Wnt5a-induced Dvl2/Ror2 colocalization. B) Quantification of Dvl/Ror2
membrane staining; percentage of cells showing overlapping surface staining for Ror2 and
Dvl2. Data are derived from 3 independent experiments. Error bars ϭ se. C) Equal
interaction of Dvl2 with wt-Ror2 or a Ror2 mutant that cannot be phosphorylated by CK1ε
(Ror2–13S/T). Cells were transfected with indicated constructs; lysates were subjected to immunoprecipitation against
Dvl2-Myc.
2422 Vol. 24 July 2010 WITTE ET AL.The FASEB Journal ⅐ www.fasebj.org
or Dvl3⌬C in the presence or absence of CK1ε. Both
Dvl3 constructs alone induced only a weak TOPflash
signal (Fig. 5A). Coexpression of CK1ε together with
Dvl3 strongly promoted TOPflash activity, and, interestingly,
CK1ε boosted the activity of Dvl3⌬C much
more efficiently than it did for wt Dvl3 (Fig. 5A).
Next, we tested whether the Dvl-CT alone, which is
able to bind Ror2 (Fig. 1B, E), is sufficient to inhibit
the canonical Wnt pathway. In TOPflash assays, the
coexpression of Dvl3-CT inhibited reporter activation
induced by Dvl3/CK1ε in a dose-dependent
manner (Fig. 5B). This indicates that in full-length
Dvl, the C terminus, exposed by CK1ε-mediated
phosphorylation, may act as a domain mediating a
negative feedback on canonical signaling, potentially
by its binding to Ror2.
In the next step we wanted to know whether Ror2
is necessary for the inhibitory effect elicited by the
Dvl-CT. We tested 3 different siRNAs directed against
human ROR2. All 3 siRNAs efficiently reduced the
expression of ROR2 in HEK293 cells (Supplemental
Fig. 7A). Using all 3 siRNAs, knockdown of Ror2
alone increased reporter activity in HEK293 cells
stimulated with Dvl3 ϩ CK1ε significantly (Fig. 5C,
Supplemental Fig. 7B), demonstrating that endogenous
Ror2 is an intrinsic negative regulator of the
canonical pathway. Moreover, knockdown of Ror2
completely abolished the negative regulatory potential
of Dvl-CT (Fig. 5C). Notably, Dvl-CT was also able
to inhibit TOPflash activation stimulated by Dvl⌬C ϩ
CK1ε (Fig. 5D) or ca-␤-catenin (Fig. 5E). Again, the
inhibitory effects of Dvl-CT on TCF/LEF reporter
activity driven by ca-␤-catenin were diminished by
Ror2 knockdown (Fig. 5F). These results suggest that
the inhibitory effect of Dvl-CT is not mediated via
direct competition with FL Dvl for downstream effectors,
but rather that Dvl-CT, mimicking the exposed
C terminus in ps-Dvl, triggers a Ror2-dependent
pathway, which inhibits canonical Wnt signaling
downstream of ␤-catenin in mammalian cells.
CK1/ps-Dvl negatively regulates the Wnt5a/Ror2/
ATF2 pathway
Ror2 was described as an inhibitor of canonical Wnt/␤catenin
signaling (3, 24, 37, 38), but it can also activate
alternative Wnt cascades. In Xenopus, XWnt5a triggers a
noncanonical cascade via XRor2, utilizing Akt, JNK, and
ATF2 (hereafter termed Wnt5a/Ror2/ATF2 pathway),
leading to the expression of XPAPC (4). In parallel,
XWnt5a also leads to the production of ps-Dvl (39). To
test the role of the ps-Dvl/Ror2 interaction for the
Wnt5a/Ror2/ATF2 pathway, we first used Xenopus Animal
Cap explants and investigated the influence of
CK1ε and hDvl3 or Dvl3-CT (which is supposed to
mimic the effect of ps-Dvl) on XPAPC expression.
XPAPC is not expressed in Animal Caps endogenously,
but its expression is induced by overexpression of
XWnt5a (4) and more robustly by coinjection of
XWnt5a and low amounts of XRor2 RNA. CK1ε
overexpression did not induce XPAPC expression in
AC explants, but significantly inhibited XPAPC upregulation
in response to XWnt5a/XRor2 (Fig. 6A).
Treatment with the CK1 inhibitor D4476 had no
effect on basal or XWnt5a/XRor2-induced XPAPC
levels. Concordantly, coinjection of hDvl3 ϩ CK1ε
completely blocked XPAPC up-regulation. Expression of
hDvl3-CT alone abolished XPAPC up-regulation. This was
not significantly affected by D4476 or coinjection of CK1ε,
although in the latter we observed slightly elevated XPAPC
levels (Fig. 6A). In accordance with the assumption that
Dvl-CT mimics the effects of ps-Dvl, overexpression of
Figure 4. Inhibition of canonical Wnt signaling by Ror2 in
vitro and in vivo. A, B) TOPflash reporter assays in HEK293
cells stimulated with Dvl2 ϩ CK1ε (A) or ␤-catenin (B). In
mammalian cells, Ror2 inhibits canonical Wnt signaling
induced by either Dvl2 ϩ CK1ε or ␤-catenin; C terminus of
Ror2 is required for this inhibition. Ror2 mutants defective
for serine/threonine or tyrosine phosphorylation (Ror2–
13S/T, Ror2–5YF) show inhibitory activity comparable to
wt-Ror2. C) Top panel: Ror2, but not C-terminal truncated
Ror2⌬745, significantly inhibits secondary axes induced by
XWnt-8 or XDvl, but not axis induction by X␤-catenin. Bottom
panel: embryos injected with either XWnt-8 alone or XWnt-8
and Ror2 or Ror2⌬745. Chart shows averages of Ն3 independent
experiments. N, total numbers of embryos analyzed. Error
bars ϭ sem. *P Ͻ 0.05, **P Ͻ 0.01, ***P Ͻ 0.001; Student’s
t test.
2423INTERACTION OF CK1-PHOSPHORYLATED DVL WITH Ror2
hDvl3-CT also abolished XWnt5a/XRor2-induced phosphorylation
of endogenous ATF2 in Xenopus embryos
(Fig. 6B).
These effects on XPAPC gene expression were
confirmed by XPAPC in situ hybridization of singleside
injected embryos (Fig. 6C, D). Knockdown of
XWnt5a down-regulated XPAPC, as shown previously
(4). Similar down-regulation was observed after CK1ε
overexpression, while expression of a dominantnegative
(dn-) CK1ε up-regulated XPAPC on the
injected side in 32% of the embryos (Fig. 6C, D).
With this construct, however, we observed also reduced
(18%) or mislocalized (25%) expression, indicating
not unexpectedly that dnCK1ε does not act
specifically on the regulation of XPAPC expression
but also affects other processes. Overexpression of
hDvl3CT induced strong gastrulation defects. The
embryos failed to close the blastopore and showed
necrotic patches in the organizer region (Fig. 6C).
We also observed severely reduced XPAPC expression
in these embryos; however, with the disruption of
development we are unable to clearly attribute this
phenotype to a pathway-specific inhibitory effect.
We next analyzed Cos-1 cells, which express endogenous
Ror2, and found that Wnt5a stimulation induced
a rapid, transient increase of pAKT (a PI3K
target), pJNK, and pATF2 (Fig. 6E). This is reminiscent
of the Wnt5a/Ror2/ATF2 pathway that we previously
defined in Xenopus (4) and indicates that
recombinant Wnt5a stimulates the same Ror2/ATF2
signaling cascade also in mammalian cells. Interestingly,
the phosphorylation of AKT, JNK, and ATF2
already occurs after 15 min of Wnt5a stimulation
(Fig. 6E). An increase of endogenous ps-Dvl was
observed in our assay between 30 and 60 min of
Wnt5a stimulation and persisted until 120 min of
stimulation (Fig. 6F), comparable to previous observations
(22). Conversely, pAKT, pJNK, and pATF2
decreased back to basal levels in the same time
interval between 30 and 60 min (Fig. 6E). We thus
hypothesized that the interaction of ps-Dvl with Ror2
might represent a negative regulatory mechanism of
Wnt5a/Ror2/ATF2 signaling, as suggested by the
timely correlation of ps-Dvl appearance and pATF2
decrease. In this line, inhibition of CK1 (i.e., inhibition
of ps-Dvl formation) should relieve this inhibition.
Indeed, stimulation of Cos-1 cells with Wnt5a
and concomitant inhibition of CK1 with D4476 resulted
in a prolonged activation of the pathway,
because pAKT and pATF2 could be detected even
after 60 and 120 min of stimulation in the presence
of D4476 (Fig. 6F). In these samples the formation of
ps-Dvl was not detectable even after 120 min of
stimulation, supporting the hypothesis that the activation
of CK1 and the formation of ps-Dvl could
represent a negative autoregulatory loop.
Our data provide the first evidence that the appearance
of ps-Dvl, most likely emanating from Wnt/Frizzled
signaling, might be a general negative feedback
Figure 5. Dvl-CT is an intrinsic negative regulator of
Wnt/␤-catenin signaling dependent on Ror2. A) TOPflash
assay stimulated with Dvl3 and CK1ε. CK1ε increases reporter
activity stimulated by wt Dvl3 and strongly increases
activity induced by Dvl lacking the C terminus, Dvl3⌬C.
Dvl-CT has no stimulating activity alone or in combination
with CK1ε. B–F) Isolated C terminus of Dvl3 (Dvl3-CT)
negatively regulates canonical Wnt signaling induced by
Dvl3 ϩ CK1ε (B), Dvl3⌬C ϩ CK1ε (D), or ␤-catenin (E) in a
dose-dependent manner (0.2– 0.8 ␮g); siRNA-mediated
knockdown of Ror2 increases TOPflash activation by Dvl3
(C) or ␤-catenin (F). Inhibitory effect of Dvl3-CT is abrogated
by siRor2, demonstrating that the inhibitory function
of the Dvl-CT is dependent on the presence of Ror2. Charts
show combined data from Ն3 independent experiments.
Error bars ϭ sem. *P Ͻ 0.05, **P Ͻ 0.01, ***P Ͻ 0.001 vs. Dvl3 ϩ CK1ε (B), Dvl3⌬C ϩ CK1ε (D), ␤-catenin (E);
Student’s t test.
2424 Vol. 24 July 2010 WITTE ET AL.The FASEB Journal ⅐ www.fasebj.org
mechanism for different branches of Wnt signaling
acting via interaction with Ror2.
The authors thank Kathrin Seidel for excellent technical
assistance. This work was funded by grants from the
Deutsche Forschungsgemeinschaft (DFG) to S.S. and S.M.
(SFB 577) and to A.S. (SCHA965/2–3 and 6–1). V.B. is
supported by MSM0021622430 (Ministry of Education,
Youth and Sports of the Czech Republic), KJB501630801,
AVOZ50040507, AVOZ50040702 (Academy of Sciences of
the Czech Republic), 204/09/H058, 204/09/0498, 204/
09/J030 (Czech Science Foundation), and an EMBO installation
grant. A.M. is supported by the Berlin-Brandenburg
School for Regenerative Therapies (BSRT).
Figure 6. CK1ε and Dvl-CT antagonize the Wnt5a/Ror2/ATF2 pathway. A) Relative expression of the XWnt5a/XRor2 target
XPAPC in Xenopus Animal Cap explants injected with indicated constructs. Chart shows averages of Ն3 independent
experiments. Error bars ϭ se. *P Ͻ 0.05 vs. XWnt5a/XRor2; t test. B) Dvl3-CT is able to inhibit ATF2 phosphorylation in Xenopus
embryos. XWnt5a and XWnt5a ϩ XRor2 induce phosphorylation of ATF2, which is prevented by coinjection of Dvl3-CT.
Morpholinos against XWnt5a or XRor2 serve as controls. C) In situ hybridization for XPAPC on Xenopus embryos injected in one
blastomere at the 2-cell stage with mRNA for LacZ and constructs as indicated. Injected side is identified by LacZ staining and
oriented to the left. D) Quantification of XPAPC expression determined by ISH. N, numbers of embryos analyzed. E) Stimulation
of Cos-1 cells with recombinant Wnt5a leads to rapid activation of PI3-kinase after 15 min (monitored by AKT phosphorylation),
phosphorylation of JNK and ATF2 indicating activation of the Wnt5a/Ror2/ATF2 pathway. Note that pAKT, pJNK, and pATF2
decrease back to basal levels between 30 and 60 min. F) Phosphorylation of Dvl2 and Dvl3 appears between 30 and 60 min of
Wnt5a treatment, which is prevented by addition of CK1 inhibitor D4476. Treatment with D4476 results in prolonged activation
of the Wnt5a/Ror2/ATF2 pathway monitored by AKT and ATF2 phosphorylation.
2425INTERACTION OF CK1-PHOSPHORYLATED DVL WITH Ror2
REFERENCES
1. MacDonald, B. T., Tamai, K., and He, X. (2009) Wnt/beta-catenin
signaling: components, mechanisms, and diseases. Dev. Cell 17, 9–26
2. Angers, S., and Moon, R. T. (2009) Proximal events in Wnt
signal transduction. Nat. Rev. Mol. Cell. Biol. 10, 468–477
3. Mikels, A. J., and Nusse, R. (2006) Purified Wnt5a protein
activates or inhibits beta-catenin-TCF signaling depending on
receptor context. PLoS Biol. 4, e115
4. Schambony, A., and Wedlich, D. (2007) Wnt-5A/Ror2 regulate
expression of XPAPC through an alternative noncanonical
signaling pathway. Dev. Cell 12, 779–792
5. Yamamoto, H., Yoo, S. K., Nishita, M., Kikuchi, A., and Minami, Y.
(2007) Wnt5a modulates glycogen synthase kinase 3 to induce phosphorylation
of receptor tyrosine kinase Ror2. Genes Cells 12, 1215–1223
6. Liu, Y., Ross, J. F., Bodine, P. V., and Billiard, J. (2007)
Homodimerization of Ror2 tyrosine kinase receptor induces
14–3-3(beta) phosphorylation and promotes osteoblast differentiation
and bone formation. Mol. Endocrinol. 21, 3050–3061
7. Masiakowski, P., and Carroll, R. D. (1992) A novel family of cell
surface receptors with tyrosine kinase-like domain. J. Biol. Chem.
267, 26181–26190
8. Wallingford, J. B., and Habas, R. (2005) The developmental
biology of Dishevelled: an enigmatic protein governing cell fate
and cell polarity. Development 132, 4421–4436
9. Semenov, M. V., Habas, R., Macdonald, B. T., and He, X. (2007)
SnapShot: noncanonical Wnt signaling pathways. Cell 131, 1378
10. Chen, W., ten Berge, D., Brown, J., Ahn, S., Hu, L. A., Miller,
W. E., Caron, M. G., Barak, L. S., Nusse, R., and Lefkowitz, R. J.
(2003) Dishevelled 2 recruits beta-arrestin 2 to mediate Wnt5Astimulated
endocytosis of Frizzled 4. Science 301, 1391–1394
11. Cong, F., Schweizer, L., and Varmus, H. (2004) Casein kinase
Iepsilon modulates the signaling specificities of dishevelled.
Mol. Cell. Biol. 24, 2000–2011
12. Kibardin, A., Ossipova, O., and Sokol, S. Y. (2006) Metastasisassociated
kinase modulates Wnt signaling to regulate brain
patterning and morphogenesis. Development 133, 2845–2854
13. Ossipova, O., Dhawan, S., Sokol, S., and Green, J. B. (2005)
Distinct PAR-1 proteins function in different branches of Wnt
signaling during vertebrate development. Dev. Cell 8, 829–841
14. Sun, T. Q., Lu, B., Feng, J. J., Reinhard, C., Jan, Y. N., Fantl,
W. J., and Williams, L. T. (2001) PAR-1 is a Dishevelledassociated
kinase and a positive regulator of Wnt signalling. Nat.
Cell Biol. 3, 628–636
15. Willert, K., Brink, M., Wodarz, A., Varmus, H., and Nusse, R.
(1997) Casein kinase 2 associates with and phosphorylates
dishevelled. EMBO J. 16, 3089–3096
16. Rothbacher, U., Laurent, M. N., Deardorff, M. A., Klein, P. S.,
Cho, K. W., and Fraser, S. E. (2000) Dishevelled phosphorylation,
subcellular localization and multimerization regulate its
role in early embryogenesis. EMBO J. 19, 1010–1022
17. Peters, J. M., McKay, R. M., McKay, J. P., and Graff, J. M. (1999)
Casein kinase I transduces Wnt signals. Nature 401, 345–350
18. Sammar, M., Stricker, S., Schwabe, G. C., Sieber, C., Hartung,
A., Hanke, M., Oishi, I., Pohl, J., Minami, Y., Sebald, W.,
Mundlos, S., and Knaus, P. (2004) Modulation of GDF5/BRI-b
signalling through interaction with the tyrosine kinase receptor
Ror2. Genes Cells 9, 1227–1238
19. Kani, S., Oishi, I., Yamamoto, H., Yoda, A., Suzuki, H., Nomachi,
A., Iozumi, K., Nishita, M., Kikuchi, A., Takumi, T., and Minami, Y.
(2004) The receptor tyrosine kinase Ror2 associates with and is
activated by casein kinase Iepsilon. J. Biol. Chem. 279, 50102–50109
20. Schwarzer, W., Witte, F., Rajab, A., Mundlos, S., and Stricker, S.
(2009) A gradient of ROR2 protein stability and membrane
localization confers brachydactyly type B or Robinow syndrome
phenotypes. Hum. Mol. Genet. 18, 4013–4021
21. Bryja, V., Gradl, D., Schambony, A., Arenas, E., and Schulte, G.
(2007) Beta-arrestin is a necessary component of Wnt/betacatenin
signaling in vitro and in vivo. Proc. Natl. Acad. Sci.
U. S. A. 104, 6690–6695
22. Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007)
Wnt-5a induces Dishevelled phosphorylation and dopaminergic
differentiation via a CK1-dependent mechanism. J. Cell Sci. 120,
586–595
23. Nieuwkoop, P. D., and Faber, J. (1975) Normal Table of Xenopus
laevis (Daudin), Elsevier, Amsterdam
24. Hollemann, T., Panitz, F., and Pieler, T. (1999) In situ hybridization
techniques with Xenopus embryos. In A Comparative
Methods Approach to the Study of Oocytes and Embryos (Richter, J. D.,
ed) pp. 279–290, Oxford University Press, Oxford
25. Billiard, J., Way, D. S., Seestaller-Wehr, L. M., Moran, R. A.,
Mangine, A., and Bodine, P. V. (2005) The orphan receptor
tyrosine kinase Ror2 modulates canonical Wnt signaling in
osteoblastic cells. Mol. Endocrinol. 19, 90–101
26. Hikasa, H., Shibata, M., Hiratani, I., and Taira, M. (2002) The
Xenopus receptor tyrosine kinase Xror2 modulates morphogenetic
movements of the axial mesoderm and neuroectoderm via
Wnt signaling. Development 129, 5227–5239
27. Oishi, I., Suzuki, H., Onishi, N., Takada, R., Kani, S., Ohkawara,
B., Koshida, I., Suzuki, K., Yamada, G., Schwabe, G. C., Mundlos,
S., Shibuya, H., Takada, S., and Minami, Y. (2003) The receptor
tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK
signalling pathway. Genes Cells 8, 645–654
28. Schwabe, G. C., Tinschert, S., Buschow, C., Meinecke, P., Wolff,
G., Gillessen-Kaesbach, G., Oldridge, M., Wilkie, A. O., Komec,
R., and Mundlos, S. (2000) Distinct mutations in the receptor
tyrosine kinase gene ROR2 cause brachydactyly type B. Am. J.
Hum. Genet. 67, 822–831
29. Angers, S., Thorpe, C. J., Biechele, T. L., Goldenberg, S. J.,
Zheng, N., MacCoss, M. J., and Moon, R. T. (2006) The
KLHL12-Cullin-3 ubiquitin ligase negatively regulates the Wntbeta-catenin
pathway by targeting Dishevelled for degradation.
Nat. Cell Biol. 8, 348–357
30. Kishida, M., Hino, S., Michiue, T., Yamamoto, H., Kishida, S.,
Fukui, A., Asashima, M., and Kikuchi, A. (2001) Synergistic
activation of the Wnt signaling pathway by Dvl and casein kinase
Iepsilon. J. Biol. Chem. 276, 33147–33155
31. Swiatek, W., Tsai, I. C., Klimowski, L., Pepler, A., Barnette, J., Yost,
H. J., and Virshup, D. M. (2004) Regulation of casein kinase I
epsilon activity by Wnt signaling. J. Biol. Chem. 279, 13011–13017
32. Schulte, G., Bryja, V., Rawal, N., Castelo-Branco, G., Sousa,
K. M., and Arenas, E. (2005) Purified Wnt-5a increases differentiation
of midbrain dopaminergic cells and dishevelled phosphorylation.
J. Neurochem. 92, 1550–1553
33. Gonzalez-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A., and
Brown, A. M. (2004) Wnt proteins induce dishevelled phosphorylation
via an LRP5/6- independent mechanism, irrespective of
their ability to stabilize beta-catenin. Mol. Cell. Biol. 24, 4757–4768
34. Wallingford, J. B., Fraser, S. E., and Harland, R. M. (2002)
Convergent extension: the molecular control of polarized cell
movement during embryonic development. Dev. Cell 2, 695–706
35. Bilic, J., Huang, Y. L., Davidson, G., Zimmermann, T., Cruciat,
C. M., Bienz, M., and Niehrs, C. (2007) Wnt induces LRP6
signalosomes and promotes dishevelled-dependent LRP6 phosphorylation.
Science 316, 1619–1622
36. Schwarz-Romond, T., Fiedler, M., Shibata, N., Butler, P. J.,
Kikuchi, A., Higuchi, Y., and Bienz, M. (2007) The DIX domain
of Dishevelled confers Wnt signaling by dynamic polymerization.
Nat. Struct. Mol. Biol. 14, 484–492
37. Green, J. L., Inoue, T., and Sternberg, P. W. (2007) The C.
elegans ROR receptor tyrosine kinase, CAM-1, non-autonomously
inhibits the Wnt pathway. Development 134, 4053–4062
38. Winkel, A., Stricker, S., Tylzanowski, P., Seiffart, V., Mundlos, S.,
Gross, G., and Hoffmann, A. (2008) Wnt-ligand-dependent
interaction of TAK1 (TGF-beta-activated kinase-1) with the
receptor tyrosine kinase Ror2 modulates canonical Wnt-signalling.
Cell. Signal. 20, 2134–2144
39. Bryja, V., Schambony, A., Cajanek, L., Dominguez, I., Arenas, E.,
and Schulte, G. (2008) Beta-arrestin and casein kinase 1/2
define distinct branches of non-canonical WNT signalling pathways.
EMBO Rep. 9, 1244–1250
Received for publication November 18, 2009.
Accepted for publication February 4, 2010.
2426 Vol. 24 July 2010 WITTE ET AL.The FASEB Journal ⅐ www.fasebj.org
Supplemental Data
Supplemental Figure 1. Western blots for schematic depictions of Ror2 / Dvl
interaction (Fig. 1A, B). Cells were co-transfected with indicated constructs and
pulldown was performed against Ror2-Flag (A) or Dvl3-Flag (B). (C) Interaction of
Dvl3 with Ror2. Cells were co-transfected with indicated constructs and pulldown
was performed against Dvl3-Flag. Dvl3 interacts with full length Ror2 but not with
Ror2∆745 lacking the PST-rich domain.
Supplemental Figure 2. Wnt3a-induced Dvl2 / Ror2 colocalization at the cell
membrane is dependent on the C-terminus of Ror2 and CK1 activity. Upper panel:
cells have been transfected with the BDB1 mutant form Ror2W749X and stimulated
with Wnt3a for 30 min. Lower panel: cells have been transfected with wt Ror2,
treated with CK1 inhibitor D4476 and stimulated with Wnt3a for 30 min. In both
cases, no co-localization of Ror2 and endogenous Dvl2 at the cell membrane is
observed.
Supplemental Figure 3. Recruitment of Dvl to the cell membrane by Ror2 is not
dependent on the ligand-binding cysteine-rich (CRD) domain of Ror2. A mutant form
of human Ror2 that lacks the Wnt-binding CRD (Ror2∆CRD) shows colocalization
with endogenous Dvl2 at the cell membrane after stimulus with Wnt3a (upper panel)
or Wnt5a (lower panel).
Supplemental Figure 4. Inhibition of TOPFLASH activity induced by Dvl2 + CK1e
by wt and mutant forms of Ror2. Error bars depict standard errors. Statistical
significance determined by Student’s t-test. One asterisk: p<0,05; two asterisks:
p<0,01; three asterisks: p<0,001.
Supplemental Figure 5. Western blot analysis of cell transfections used for TOPFLASH
reporter assays. (A) Cells were transfected with plasmids encoding Dvl2-Myc, CK1ε and
Ror2-FLAG mutants as indicated in the identical amounts as in the Fig. S4, and the
expression levels were analyzed by Western blotting against Flag and CK1ε. The blot
demonstrates equal expression of individual Ror2 mutants. (B) Cells were transfected with
plasmids encoding Dvl3-Flag, Dvl3∆C-Flag and CK1ε in identical amounts as in the Fig. 5A.
The kinase-dead variant CK1ε-KD was used as control. The blot demonstrates equal
expression of Dvl3-Flag and Dvl3∆C-Flag, and the kinase activity of CK1ε towards both
constructs, visible as phosphorylation-dependent mobility shift. Both pictures originate from
the same blot membrane. (C) Cells were transfected with plasmids encoding Dvl3-Flag, CK1ε
and Dvl3-C-terminus (Dvl3-CT) in identical amounts as in the Fig. 5B, and analyzed by
Western blotting. The blot demonstrates activity of CK1ε visible as Dvl shift, increasing
doses of Dvl3-CT and no effect of Dvl3-CT on the levels of Dvl3-Flag. (D) Cells were
transfected with the plasmids encoding HA-S33A-beta-catenin and increasing doses of FlagDvl3-CT,
in the amounts identical to Fig. 5E and analyzed by Western blotting.
Supplemental Figure 6. Interaction of mouse Ror2 (mRor2), but not the truncated
mRor2∆745 lacking the PST domain, with Xenopus Dvl (XDvl).
Supplemental Figure 7. Validation of Ror2 siRNAs. (A) Western blot from HEK293
cells transfected with control or 3 human-Ror2-specific siRNAs probed for
endogenous Ror2. (B) TOPFLASH assays stimulated with Dvl3 + CK1ε. All three
hRor2-siRNAs enhanced reporter activation.
Supplemental Table 1. Densitrometric quantification of western blot band intensities
from Figures 1 C, D, E. and Supplemental Figure 1B. See arrows for pulldown
differences mentioned in the manuscript text.
Vítězslav Bryja, 2014    Attachments 
 
 
#10 
 
 
Foldynova‐Trantirkova  S1
,  Sekyrova  P1
,  Tmejova  K,  Brumovska  E,  Bernatik  O, 
Blankenfeldt  W,  Krejci  P,  Kozubik  A,  Dolezal  T,  Trantirek  L*,  Bryja  V*  (2010):  Breast 
cancer‐specific  mutations  in  CK1epsilon  inhibit  Wnt/beta‐catenin  and  activate  the 
Wnt/Rac1/JNK  and  NFAT  pathways  to  decrease  cell  adhesion  and  promote  cell 
migration. Breast Cancer Res. 12(3):R30. 
1
 equal contribution, * corresponding authors 
 
 
Impact factor (2010): 5.785 
Times cited (without autocitations, WoS, Feb 21st 2014): 13 
Significance: This work demonstrates that CK1 inhibition leading to the activation of 
Rac1 (desribed by us in the work #6) has clinical consequences. Specifically, we 
show that CK1 mutations identified in breast cancer inactivate CK1, are dominant 
negative, activate non‐canonical Wnt/Dvl/Rac1 pathway and inhibit canonical Wnt 
signaling. As such they promote Rac1‐driven migration of breast cancer cells. 
Contibution  of the author/author´s team:  Experimental design, functional testing of 
CK1epsilon mutants in biochemical and biological experiments. 
 
 
   
 
 
 
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Open AccessRESEARCH ARTICLE
© 2010 Foldynová-Trantírková et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative
Commons Attribution License http://creativecommons.org/licenses/by/2.0, which permits unrestricted use, distribution, and reproduction
in any medium, provided the original work is properly cited.
Research article
Breast cancer-specific mutations in CK1ε inhibit
Wnt/β-catenin and activate the Wnt/Rac1/JNK and
NFAT pathways to decrease cell adhesion and
promote cell migration
Silvie Foldynová-Trantírková†1, Petra Sekyrová†1, Kateřina Tmejová2,3, Eva Brumovská1, Ondřej Bernatík2,
Wulf Blankenfeldt4, Pavel Krejčí2,3, Alois Kozubík2,3, Tomáš Doležal1, Lukáš Trantírek*1,5 and Vítězslav Bryja*2,3
Abstract
Introduction: Breast cancer is one of the most common types of cancer in women. One of the genes that were found
mutated in breast cancer is casein kinase 1 epsilon (CK1ε). Because CK1ε is a crucial regulator of the Wnt signaling
cascades, we determined how these CK1ε mutations interfere with the Wnt pathway and affect the behavior of
epithelial breast cancer cell lines.
Methods: We performed in silico modeling of various mutations and analyzed the kinase activity of the CK1ε mutants
both in vitro and in vivo. Furthermore, we used reporter and small GTPase assays to identify how mutation of CK1ε
affects different branches of the Wnt signaling pathway. Based on these results, we employed cell adhesion and cell
migration assays in MCF7 cells to demonstrate a crucial role for CK1ε in these processes.
Results: In silico modeling and in vivo data showed that autophosphorylation at Thr 44, a site adjacent to the breast
cancer point mutations in the N-terminal lobe of human CK1ε, is involved in positive regulation of the CK1ε activity.
Our data further demonstrate that, in mammalian cells, mutated forms of CK1ε failed to affect the intracellular
localization and phosphorylation of Dvl2; we were able to demonstrate that CK1ε mutants were unable to enhance
Dvl-induced TCF/LEF-mediated transcription, that CK1ε mutants acted as loss-of-function in the Wnt/β-catenin
pathway, and that CK1ε mutants activated the noncanonical Wnt/Rac-1 and NFAT pathways, similar to
pharmacological inhibitors of CK1. In line with these findings, inhibition of CK1 promoted cell migration as well as
decreased cell adhesion and E-cadherin expression in the breast cancer-derived cell line MCF7.
Conclusions: In summary, these data suggest that the mutations of CK1ε found in breast cancer can suppress Wnt/βcatenin
as well as promote the Wnt/Rac-1/JNK and Wnt/NFAT pathways, thus contributing to breast cancer
development via effects on cell adhesion and migration. In terms of molecular mechanism, our data indicate that the
breast cancer point mutations in the N-terminal lobe of CK1ε, which are correlated with decreased phosphorylation
activities of mutated forms of CK1ε both in vitro and in vivo, interfere with positive autophosphorylation at Thr 44.
Introduction
Mammary carcinomas are one of the most common neoplasias
in women. Several improvements in understanding
the molecular pathology of breast cancer have been
achieved in the past decade. In most cases, however, the
molecular mechanisms underlying this malignancy are
still unknown.
Sequencing of mammary carcinoma samples by Fuja
and colleagues revealed that the casein kinase 1 epsilon
(CK1ε) gene was mutated in this disease; CK1ε was found
to be mutated within its N-terminal region with approximately
15% incidence [1]. CK1ε is a Ser/Thr kinase with
* Correspondence: L.Trantirek@uu.nl, bryja@sci.muni.cz
1 Biology Centre AS CR, v.v.i. AND University of South Bohemia, Branisovska 31,
37005 Ceske Budejovice, Czech Republic
2 Institute of Experimental Biology, Faculty of Science, Masaryk University,
Kotlarska 2, CZ-61137 Brno, Czech Republic
† Contributed equally
Full list of author information is available at the end of the article
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 2 of 14
many known functions and substrates. CK1ε phosphorylates
several regulators of crucial processes, such as cell
proliferation, differentiation, migration, and circadian
rhythms. The key known targets of CK1ε involve p53, key
components of the circadian clock, the Wnt signaling
pathway, and cell division machinery (for a review, see
[2]). In the original sequencing study, 19 nonsynonymous
mutations were identified in the CK1ε gene in ductal carcinoma
samples [1]. The identified mutations were
shown to have a significant association with the loss of
heterozygosity and decreased staining of CK1ε in the
tumor sections. Some of the mutations in CK1ε were
found repeatedly in several patients, such as L39Q
(detected five times), L49Q (detected three times), and
S101R (detected twice) [1]. These observations suggest
that these mutations may affect CK1ε function and may
be favored during the microevolution of the tumor, and
thus may contribute to tumor progression.
Importantly, nothing is known about how these mutations
affect the kinase activity and signaling potential of
CK1ε and the behavior of mammary cells. In the present
study, we characterized three CK1ε mutants that were
previously identified in mammary carcinoma. We demonstrated
that these CK1ε mutants had limited kinase
activity and failed to phosphorylate the physiological targets
of CK1ε in vitro and in vivo. The analyzed mutations
acted as loss of function in the Wnt/β-catenin pathway
and promoted the alternative Wnt/Rac1 pathway, which
in turn decreased cell adhesion and promoted cell migra-
tion.
Materials and methods
Plasmids
ORFs of the wild-type (WT), full-length human CKIε
cDNA (residues 1 to 416), two mutants mimicking either
nonphosphorylatable Thr 44 (Thr44Ala) or constitutively
phosphorylated Thr 44 (Thr44Asp), and three mutated
versions (P3, P4, and P6) were cloned into pcDNA3. The
truncated versions of CKIεΔC (residues 1 to 315) were
cloned into pHAK-B3. Plasmids encoding mDvl2-Myc [3]
and human Dvl3-Flag [4] have been previously described.
Details and bacterial overexpression vectors are presented
in Additional file 1.
Structural modeling
The three-dimensional model for CK1ε was obtained via
template-based homology modeling using the program
PHYRE [5]. The mutated sites and kinase-specific functional
domains were mapped onto a three-dimensional
model of CK1ε using the program CHIMERA [6]. The
kinase-specific functional domains in CK1ε were predicted
using the NCBI Conserved Domain Database [7].
Predictions of changes in protein stability upon point
mutations were conducted using CUPSTAT [8].
(Auto)Phosphorylation sites were predicted using GPS v.
2.1 [9].
Western blot analysis, immunoprecipitation, and small
GTPase activity assays
Western blot analysis, immunoprecipitation, and small
GTPase activity assays were performed as previously
described [10,11]. The antibodies used for the western
blot analysis were as follows: mouse anti-Flag (M2;
Sigma, Schnelldorf, Germany), goat anti-CK1e (sc6471;
Santa Cruz Biotechnology, Heidelberg, Germany), mouse
anti-Myc (sc-40) and anti-actin (sc-1615-R) (both Santa
Cruz Biotechnology), anti-HA (HA.11; Nordic Biosite,
Täby, Sweden), mouse anti-Rac (05-389; Upstate,
Waltham, Massachusetts, USA), and mouse anti-Cdc42
(610928, 1:1,000; BD Biosciences, San Jose, California,
USA). The antibodies used for immunoprecipitation were
as follows: anti-CK1ε (sc-6471; Santa Cruz Biotechnology),
anti-MYC (C3965; Sigma), and anti-FLAG (F1804;
Sigma).
Immunohistochemistry
Transfected cells were grown on glass coverslips, washed
with PBS, fixed for 15 minutes in 4% paraformaldehyde,
washed with PBS, and blocked in 1.5% BSA, 0.1% Triton
X-100 in PBS for 1 hour. After overnight incubation at
4°C with the primary antibody, cells were washed with
PBS, 0.1% Triton X-100, incubated for 2 hours at room
temperature with secondary antibody, washed with PBS,
0.1% Triton X-100, and counterstained with 4 μg/ml 4'',6 Diamidino
- 2 - phenylindole, dihydrochloride. Phalloidin-Alexa488
(1:66; Molecular Probes, Carlsbad, CA,
USA) was added in the last 30 minutes of incubation with
the secondary antibody. Samples were analyzed with a
FV1000 confocal microscope (Olympus). The following
antibodies were used: mouse anti-Myc (1:150) and goat
anti-CK1ε (1:100) (both from Santa Cruz Biotechnology),
anti-goat-Cy5 (1:500; Molecular Probes), and antimouse-Alexa488
(1:1,000; Molecular Probes).
Real-time impedance measurements
AceaE-plates®96 were used for non-invasive real-time
measurements with an xCELLigence RTCA SP system
and RTCA software version 1.1 (both Roche Applied Science,
Indianapolis, IN, USA). First, a background measurement
was performed using 100 μl complete
cultivation media with or without CK1 inhibitors incubated
for 30 minutes in the incubator (37°C, 5% CO2).
MCF7 cells were trypsinized, quantified, and seeded
(15,000 cells/well) in an additional 100 μl cultivation
media. The impedance was then monitored continually
for a period of 20 hours. Data are presented as a cell
index. In parallel to xCELLigence measurements, cells
were seeded (15,000 cells/well) in 24-well plates, and the
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 3 of 14
effects of IC261 on cell number and cell viability were
determined after 20 hours. The cell number was measured
using a Coulter Counter (Immunotech a. s., A
Beckman Coulter Company, Praque, Czech Republic).
Cell viability was determined using eosin staining.
Hanging drop assay
MCF7 cells (4 × 105 cells/ml) with or without CK1ε inhibitors
were seeded in 30 μl drops on the inner side of a 10
cm plate lid. The lid of the plate was then turned upside
down and placed on top of the plate filled with 10 ml PBS.
MCF7 cells under the force of gravity aggregated at the
bottom of the hanging drop. After 24 hours, cell clusters
were photographed, collected, and resuspended by
pipetting up and down seven times, and single cells
released from the clusters were counted.
Luciferase assays
HEK293 and MCF7 cells were transfected in a 24-well
plate format with the indicated combinations of plasmids
using polyethylene-imine (HEK293) or FuGENE (MCF7).
The amounts used per well were as follows: vectors
encoding Dvl2, Dvl3, and CK1ε, 300 ng; pRLtkLuc
(Renilla Promega, Madison, WI, USA), 50 ng; and firefly
luciferase reporters, 200 ng. The following luciferase
reporters were used: pSuperTopFlash [12], p-E-cadherinLuc
[13], pNFAT-Luc, and pAP1-Luc (Stratagene, La
Jolla, CA, USA). The total amount of plasmid DNA per
well was kept constant in all conditions. Twenty-four
hours post transfection, cells were harvested and processed
using the Dual Luciferase kit (Promega, Madison,
WI, USA) according to the manufacturer's protocol. To
normalize for the efficiency of transfection, firefly
luciferase values were normalized to Renilla luciferase in
each well.
Each data point was run in duplicate, and at least three
independent experiments were performed. Datasets from
each experiment were normalized to the control, and all
individually normalized experiments were statistically
analyzed by analysis of variance and Tukey's multiple
comparison post tests (GraphPad Prism software, La
Jolla, CA, USA The graphs indicate the mean ± standard
deviations from at least three independent replicates.
Transwell assay
MCF7 cells (5 × 104 cells) were seeded into the upper
chamber of Transwell plates (Transwell 96-well plate, 5.0
μm polycarbonate membrane; Corning (Corning, MY,
USA)). The inhibitors (D4476 or IC261; Calbiochem,
Darmstadt, Germany) were added into the bottom chamber
at the indicated concentrations. Identical amounts of
dimethylsulfoxide were used as a control. After 24 hours,
cells that migrated through the filter into the bottom
chamber were counted with a Coulter Counter. The number
of migrating cells was normalized to control conditions
and expressed as a migration index.
Results
CK1ε mutants can bind but fail to phosphorylate
Dishevelled
L39Q is the most frequently occurring mutation found in
patients with breast cancer. In these patients, this mutation
occurs alone (Patient P6) or in combination with
other mutations - L39Q and S101R (Patient P3), or L39Q,
L49Q, and N78T (Patient P4) (Figure 1a). Leu 39 and Leu
49, as well as Ser 101 (occupied exclusively by Ser or Thr),
are absolutely conserved among CK1 paralogs and CK1ε
orthologs (data not shown).
One of the best defined functions of CK1ε is the Wntinduced
phosphorylation of Dvl, a crucial component of
the Wnt signaling cascades [11,14-20]. In the first step,
we analyzed the capacity of individual CK1ε mutants to
phosphorylate Dvl in mammalian HEK293 cells. As
shown in Figure 1b, WT CK1ε promoted the formation of
phosphorylated and shifted (PS) Dvl2, whereas mutant
forms did not. A partial shift was observed with the P6
mutant, but the P3/P4 mutants were indistinguishable
when compared with the control-transfected sample.
Deletion of the C-terminus of CK1e, which inhibits CK1e
kinase activity when phosphorylated [20], did not affect
these results (Figure 1c). Importantly, using immunoprecipitation
we were able to detect the presence of overexpressed
Dvl2 or Dvl3, and both WT and mutated CK1e
kinases in one protein complex (Figure 2a and Additional
file 2), suggesting that the CK1e mutants still possess the
ability to bind Dvl.
Phosphorylation of Dvl by CK1ε leads not only to the
formation of PS-Dvl but also to changes in the intracellular
distribution of Dvl [11,19]. Dvl is usually present in
dynamic multiprotein aggregates [21,22] called Dvl dots.
Based on the cellular context and activity of CK1e, which
promotes the dissolution of Dvl aggregates, Dvl is usually
present either in dots or in an even distribution (see Figure
2b for COS7 cells; see Additional file 2 for HEK293
cells). WT CK1ε strongly promoted an even localization
of Dvl2-Myc (Figure 2c, d and Additional file 2). In contrast,
all of the analyzed mutants (P3, P4, and P6) promoted
the formation/maintenance of Dvl dots in COS7
cells and co-localized with Dvl in these multiprotein
complexes (Figure 2c, d), similar to earlier observations
with dominant negative CK1ε or CK1 inhibitors [11,19].
All CK1ε proteins were evenly distributed in the absence
of Dvl (Figure 2c, e). These data together show that
despite the fact that CK1ε mutants bind and co-localize
with Dvl, they cannot phosphorylate Dvl or efficiently
promote its even localization.
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 4 of 14
In silico modeling of ductal carcinoma-specific CK1ε
mutations
To understand how individual mutations are spatially
related to functionally conserved regions in CK1ε, we
developed three-dimensional models for individual CK1ε
mutants. In the single-point mutant (P6), the mutated
site (Leu 39) directly adjoins conserved residues that participate
in ATP binding (Figure 3a). The CK1ε mutant P3
contains two mutations, L39Q and S101R. These mutated
sites are distant from each other not only in sequence but
also spatially (Figure 3b). While Leu 39 is located in the βstrand-rich
N-terminal lobe, Ser 101 is located at the Cterminal
end of helix I in the primarily helical C-terminal
subdomain. The S101R mutation is predicted to destabilize
and alter local protein structure, thus affecting the
structural integrity of the four-helix bundle, which forms
the structurally conserved core of the C-terminal subdomain
[23].
The last analyzed mutant, P4, contains three point
mutations: L39Q, L49Q, and N78T. Although the individually
mutated sites are distant in primary sequence, when
mapped onto the three-dimensional structure of CK1ε
they cluster into a very small area with a radius <10 Å that
is located between strands four and five as well as into αhelix
B of the N-terminal lobe (Figure 3c). Interestingly,
all of these mutations surround a conserved predicted
autophosphorylation site at Thr 44 in the N-terminal catalytic
domain. This site is localized within a loop region
between the terminus of the fourth β-strand (only five
residues upstream from the mutation site L39Q) and αhelix
B (five residues downstream from the second mutation
site L49Q) (Figure 3d).
To assess kinase activities of the individual CK1ε
mutants, we attempted to heterologously express individual
mutants of human CK1ε as affinity tagged recombinant
proteins lacking the autoinhibitory domain in
Escherichia coli. Despite significant efforts, we were
unable to obtain soluble overexpression for all of the constructs
when we expressed them with the same affinity
tag. Soluble expressions were feasible for WT, P3, P4, and
P6, however, when the recombinant proteins were tagged
to His6, to maltose binding protein, to maltose binding
protein, and to Small Ubiquitin-like Modifier (SUMO),
respectively. The individual recombinant fusion proteins
were assayed for their ability to phosphorylate Dvl in
vitro. Although the data from this in vitro phosphorylation
assay were in qualitative agreement with our in vivo
data (see above), we considered these in vitro data inconclusive
since the presence of multiple different tags has
made direct interpretation impossible (see Additional
files 1 and 3).
CK1ε mutants act as loss-of-function in the Wnt/β-catenin
pathway
To test the role of mutated CK1ε proteins in the canonical
Wnt pathway, we induced Wnt/β-catenin signaling via
the overexpression of several of the components of this
pathway - such as Dvl2, Dvl3, β-catenin, Wnt3a, and the
Lrp6 co-receptor - and analyzed TCF/LEF-driven transcription
using the TopFlash reporter system [24]. As
shown in Figure 4, Dvl2-Myc weakly activated the TopFlash
reporter in HEK293 and MCF7 cells, but the signal
Figure 1 Casein kinase 1 epsilon mutant phosphorylation of Dishevelled.
All three mutants of casein kinase 1 epsilon (CK1ε) bind Dvl
but are unable to cause the typical phosphorylation-dependent shift
of the Dvl protein. (a) Schematic representation of the CK1ε mutants
used in this study. (b) HEK293 cells were transfected with a plasmid encoding
Dvl2-Myc and the CK1ε variants. CK1ε phosphorylates Dvl proteins,
which subsequently exhibit a mobility shift in western blot
analysis. The P6 mutant maintains residual activity, while the P3 and P4
mutants are unable to promote a Dvl2-Myc shift. (c) Truncated versions
of CK1ε that lack the C-terminal autoinhibitory domain do not
differ from full-length proteins in their ability to shift the Dvl2 protein.
B.
WT P4P3 P6
CK1 C
CTRL
C.
Dvl2Myc
HA-CK1
actin
WT P4P3 P6 CTRL
CK1
CK1
Dvl2Myc
actin
Patient/mutation #
Changes predicted
by mutations
P3 L39Q,S101R
P4 L39Q, L49Q, N78T
P6 L39Q
A.
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 5 of 14
Figure 2 Interaction of casein kinase 1epsilonmutants andDishevelled2. Casein kinase 1 epsilon (CK1ε) mutants associate with Dvl2, co-localize
with Dvl2, and promote the punctate cytoplasmic localization of Dvl2. (a) HEK293 cell lysates transfected with either wild-type (WT) CK1ε or the P3,
P4, and P6 mutants together with Dvl2-Myc were lysed and immunoprecipitated using an anti-Myc antibody. WT CK1ε and all of the CK1ε mutants
efficiently bind the Dvl2 protein. (b) Dvl2-Myc protein localization in transfected COS7 cells was observed by confocal microscopy using an anti-Myc
antibody. Dvl2 is either found in cytoplasmic inclusions or evenly dispersed within the cytoplasm. (c) WT CK1ε co-transfected with Dvl2-Myc into COS7
cells dissolves most of the Dvl2 punctae, resulting in the predominance of evenly distributed Dvl2 protein. In contrast, the P3, P4, and P6 mutants
enhance the formation of Dvl2 clusters with a punctate appearance in the cytoplasm. A localization pattern of CK1ε was observed with an anti-CK1e
antibody. All CK1ε forms show even cytoplasmic distribution when transfected alone. (d), (e) Cells with an even or punctate distribution of Dvl2 and
CK1e were counted. For each condition, at least 150 cells were examined.
2
Dvl2Myc+WT
Dvl2-Myc CK1¡ merge
Dvl2-Myc
A.
C.
D.
D
vl2-M
ycD
vl2-M
yc
/W
TD
vl2-M
yc
/P3D
vl2-M
yc
/P4D
vl2-M
yc
/P6
0.0
0.2
0.4
0.6
0.8
1.0 even
punctate
Dvl2-Myclocalization
W
T
P3
P4
P6
0.0
0.2
0.4
0.6
0.8
1.0 even
punctate
CK1!localization
CK1¡
P4
P6
P3
WT
Dvl2Myc+P3Dvl2Myc+P4Dvl2Myc+P6
E.
Dvl2Myc
B.
WT P4P3 P6
Dvl2-Myc
CK1¡
CK1¡
Dvl2-Myc
TCL
IP: Myc
WTCK1¡ +
++ +-+
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 6 of 14
was boosted when WT CK1e was co-expressed. The
CK1e mutants P3 and P4 failed to synergize with Dvl2,
and P6 promoted Dvl2-driven TopFlash only moderately
(Figure 4a, b). Very similar results have been obtained
with Dvl3-Flag (Additional file 4).
Importantly, the effects of CK1e were Dvl dependent
because the overexpression of any form of CK1e had only
negligible effects (Additional file 4). The inhibitory
effects of the CK1e mutants were found at the level of Dvl
because the activation of TopFlash by constitutively
active (S33A)-β-catenin could not be significantly modulated
by the overexpression of any CK1e (Figure 4c). Cocultivation
with fibroblasts producing Wnt3a or overexpression
of crucial Wnt co-receptor Lrp6 efficiently
induced TCF/LEF-dependent transcription. Co-expression
of WT CK1e promoted TopFlash even further,
whereas the expression of the P3, P4, and P6 CK1e
mutants were able to reduce the Wnt3a/Lrp6-induced
signal. This effect was obvious in Wnt-3a-stimulated cells
and became statistically significant in cells overexpressing
Lrp6 (Figure 4d, e). These analyses demonstrate that
the P3, P4, and P6 mutants of CK1e are dysfunctional in
the Wnt/β-catenin pathway and act upstream of β-
catenin.
Our structural modeling (Figure 3) suggested that
CK1e mutations found in breast cancer may affect the
predicted autophosphorylation site at Thr 44. To test the
function of Thr 44 we generated two mutants mimicking
Figure 3 Homology model of the catalytic domain of casein kinase 1 epsilon mutants. Three-dimensional representation of a homology model
of the catalytic domain of casein kinase 1 epsilon (CK1ε) (residues 1 to 295). Phylogenetically conserved functional sites across the serine/threonine
kinase superfamily are indicated: pink, substrate binding pocket; yellow, ATP binding site; red, catalytic loop; blue, activation loop. The individual point
mutations that were found in patients (a) P6 (L39Q), (b) P3 (L39Q, S101R), and (c) P4 (L39Q, L49Q, N78T) are indicated in orange. (d) A mutation cluster
region in P4. The mutations and ATP binding region are indicated in orange and yellow, respectively. A blue sphere indicates a predicted autophosphorylation
site (Thr 44).
P4
P3
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 7 of 14
Figure 4 Casein kinase 1 epsilon mutants downregulate Wnt/β-catenin signaling at the level of the Dishevelled protein. HEK293 or MCF7
cells were transfected with the indicated plasmids, and after 24 hours TCF/LEF-driven transcription was measured using the SuperTopFlash dual luciferase
reporter assay. (a) Dvl2 enhances TCF/LEF-dependent transcription when co-transfected with wild-type (WT) casein kinase 1 epsilon (CK1ε)
in HEK293 cells. In contrast, all CK1ε mutants are unable to promote Dvl-mediated TopFlash. (b) Similar results to those obtained for HEK293 cells have
been obtained for the breast cancer cell line MCF7. (c) β-Catenin induces the TCF/LEF transcriptional response in the cell by recruiting transcriptional
cofactors directly to the TCF/LEF complex. Neither WT CK1ε nor the CK1ε mutants could influence the high TopFlash signal caused by constitutively
active β-catenin, confirming that CK1ε and its mutants operate upstream of β-catenin (HEK293 cells). (d) The Wnt signaling pathway was induced by
seeding B1A-wnt3a cells (fibroblasts that constitutively produce the Wnt3a protein) over transfected HEK293 cells. Wnt3a induces the Wnt/β-catenin/
TCF/LEF pathway in control cells transfected with empty plasmid. The Wnt3-induced signal is enhanced by overexpression of WT CK1ε but is strongly
depleted by overexpression of the CK1ε mutants. (e) Constitutively activation of the co-receptor LRP6 in transfected HEK293 cells confirmed the regulatory
function of CK1ε downstream of the Wnt-receptor complex. WT CK1ε transduces the signal from the activated receptor towards TCF/LEF-driven
transcription, while mutant CK1ε proteins abolish downstream signaling. Neither WT nor mutant CK1ε are able to markedly activate the TCF/LEF
signal when Wnt stimulation is blocked by the mutant LRP6. (f) Nonphosphorylatable (T44A) and phospho-mimicking (T44D) mutants of CK1ε were
co-expressed with Dvl2-Myc in HEK293 cells. The effects on TCF/LEF-dependent transcription show that T44 D behaves as overactive CK1ε. (a) to (f)
Data represent the mean ± standard deviation from normalized values. *P < 0.05, ***P < 0.001; n.s., not significant; one-way analysis of variance, Tukey
post-test, n ≥ 3.
Dvl2-Myc (MCF-7)
control
D
vl2
D
vl2+W
T
D
vl2+P3
D
vl2+P4
D
vl2+P6
0
5
10
TopFlash(foldchange)
Dvl2-Myc (HEK293)
0
1
2
3
4
5
6
7
8TopFlash(foldchange)
D.
B.
C.
`-catenin
control
-catenin
`
-catenin+
W
T-catenin+P3-catenin+P4-catenin+P6
0.0
0.5
1.0
1.5
TopFlash(foldchange)
Wnt3a
- + - + - + - + - +
0.0
0.5
1.0
1.5
pCDNA3
WT
P3
P4
P6
Wnt3a
TopFlash(foldchange)
E.
Lrp6
Lrp6 WT Lrp6 MUT
0.0
0.5
1.0
1.5
2.0
no CK1"
WT
P6
P3
P4
TopFlash(foldchange)
***
A.
***n.s.
***
n.s.
Dvl2 Myc/CK1-T44
control
D
vl2
D
vl2+W
T
D
vl2+T44A
D
vl2+T44D
0
1
2
3
**
TopFlash(foldchange)
F.
control
D
vl2
D
vl2+W
T
D
vl2+P3
D
vl2+P4
D
vl2+P6
`
`
`
`
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 8 of 14
either nonphosphorylatable Thr 44 by replacing Thr 44
for alanine (T44A) or constitutively phosphorylated Thr
44 by replacing Thr 44 for aspartic acid (T44D). As
shown in Figure 4f, T44D-CK1e is a more potent activator
and T44A a less potent activator of TCF/LEF-driven
transcription than WT CK1e when co-expressed with
Dvl2-Myc. This finding confirms the positive functional
role of Thr 44 phosphorylation in the modulation of
CK1e activity, and explains how L39Q mutation contributes
to the diminishing of CK1e activity in the Wnt/βcatenin
pathway.
CK1ε mutants activate small GTPase Rac-1 and AP1-driven
transcription
Our laboratory and others have previously shown that
CK1e can act as a switch that promotes Wnt signaling
pathways that are dependent on PS-Dvl (such as the Wnt/
β-catenin or PS-Dvl-dependent noncanonical pathways)
and blocks the Wnt/Rac1/JNK pathway [10,19]. We
hypothesized that the CK1e mutants may mimic CK1e
inhibition. To test this prediction, we tested the effects of
WT and P3 CK1e on Rac1 activation. As shown in Figure
5a, WT CK1e slightly downregulated Rac1 activity,
whereas expression of the P3 mutant or inhibition of CK1
by D4476 promoted this activity. We were not able to
detect any effects of CK1e on the activity of another small
GTPase, Cdc42 (Additional file 5), and we also failed to
detect active RhoA in HEK293 cells (data not shown).
Importantly, the CK1e mutants also promoted Dvl2Myc-induced
AP1-mediated transcription, which is
downstream of the Rac1/JNK pathway (Figure 5b, c).
Similar results were obtained with Dvl3-Flag (Additional
file 4). We also tested the effects of the CK1e mutants on
the noncanonical Wnt/Ca2+ pathway. As shown in Figure
5d, WT CK1e did not affect the transcriptional activity of
NFAT, a transcription factor that is activated by calcium
waves. The activity of the NFAT reporter was promoted
by the CK1e mutants, however, suggesting that mutant
forms of CK1e can promote the Wnt/Ca2+ pathway.
In summary, our data demonstrate that mutant CK1e,
which is present in ductal carcinoma, can act as an inhibitor
of the Wnt/β-catenin and an activator of the noncanonical
Wnt/Rac1/JNK and Wnt/Ca2+ pathways.
CK1ε inhibition decreases cell adhesion and promotes
migration in MCF7 cells
To date, whether mutations in CK1e that are associated
with breast cancer have any effect on the behavior of
breast adenocarcinoma cells is not clear. Our results
show that mutated forms of CK1e behaved identically to
CK1 inhibition in all tested assays - compare Figure 2 and
[11], and compare Figure 5 and [10]. Based on these analyses,
one could expect that the presence of CK1e mutants
Figure 5 Casein kinase 1 epsilon mutants act as loss of function in
the Wnt/β-catenin pathway. Casein kinase 1 epsilon (CK1ε) mutants
activate small GTPase Rac1 and the transcriptional activity of AP1 and
NFAT. (a) Lysates from HEK293 cells transfected with Rac1-Myc were
subjected to pull-down of the active GTP-Rac1 form with agarose-PAK
beads. HEK293 cells were either co-transfected with wild-type (WT) or
mutant CK1ε or treated with 100 μM D4476 inhibitor for 4 hours prior
to lysis. The P3 mutant promotes Rac1 activation, as a higher amount
of GTP-Rac1 was pulled from the lysate (as compared with WT CK1ε).
Consistently, D4476 inhibits the function of WT CK1ε and elevates the
level of GTP-Rac1 in cells. Rac1 protein was detected with an anti-Myc
antibody. Western blots were quantified by densitometry, and the
GTP-Rac1/Rac1 ratios are indicated by the numbers below the panel.
After probing, membranes were stained with amidoblack to confirm
equal protein loading. (b) HEK293 cells or (c) MCF7 cells were transfected
with an AP1-luciferase reporter, Dvl2-Myc, and CK1ε as indicated.
Cells were lysed, and luciferase activity was analyzed the next day.
(d) HEK293 cells were transfected with a NFAT-luciferase reporter and
CK1ε as indicated. Cells were lysed, and luciferase activity was analyzed
the next day. (b) to (d) Data represent the mean ± standard deviation.
*P < 0.05, **P < 0.01; one-way analysis of variance, Tukey post-test, n ≥
3.
A.
B.
D.
AP1-Luc (HEK 293)
pcD
N
A
D
vl2
D
vl2+W
T
D
vl2+P3
D
vl2+P4
D
vl2+P6
0
1
2
3
Foldchange
* **
***
NFAT reporter
C
ontrol
W
T
P3
P4
P6
0
1
2
3
4
5
Foldchange
*
*
*
P3 WT-
D4476
total Rac1
GTP-Rac1
WTCK1¡ -
++--
Rac1-Myc + ++++
-
-
-
1.0 0.9 2.6 1.7 2.5
GST-PAK
total
protein
C.
* **
AP1-Luc (MCF-7)
pC
D
N
A
3
D
vl2
D
vl2+W
T
D
vl2+P3
D
vl2+P4
D
vl2+P6
0.0
0.5
1.0
1.5
2.0
Foldchange
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 9 of 14
is functionally equivalent to the pharmacological inhibition
of CK1e.
Taking advantage of this finding, we tested the effects
of the CK1 inhibitors D4476 and IC261 on the cell adhesion
of MCF7 epithelial breast cancer cells. The MCF7
cell line retains several characteristics of differentiated
mammary epithelium, including the ability to process
estradiol via cytoplasmic estrogen receptors and the
capability of forming domes [25], and is suitable for analyzing
cellular changes during tumor progression. D4476
is the most specific inhibitor of CK1 known to date
[26,27], whereas IC261 specifically inhibits the CK1δ and
CK1ε isoforms at doses <10 μM [27,28]. MCF7 cells efficiently
aggregated in hanging drops and usually formed
one cell cluster per drop (Figure 6a) after overnight aggregation.
Inhibition of CK1 interfered with aggregate formation
and caused the MCF7 cells to become more
loosely attached to each other (Figure 6a, c). To quantify
the level of adhesion, we mechanically resuspended the
cell clusters and counted the number of single cells,
which was increased by CK1 inhibition (Figure 6b, d).
Similar results were obtained when we downregulated
the levels of CK1δ and CK1ε in MCF7 cells via siRNAmediated
knockdown (Additional file 6). Next, we seeded
the MCF7 cells in the presence of 5 μM IC261 and compared
the morphology of the adherent cells after 20
hours. Control cells efficiently adhered to the plastic surface,
spread out, and formed cytoskeletal actin networks
that were visible as stress fibers and cytoplasmic protrusions
(Figure 6e, f). In contrast, IC261-treated cells
attached only loosely to the surface and exhibited a predominantly
rounded morphology with no detectable
stress fibers and protrusions (Figure 6e, f).
To quantify the intensity of cell adhesion to the cell surface,
we employed direct measurements of impedance
caused by cell adhesion using the xCELLigence System
(Roche Applied Science). This technology measures
changes in the electrical conductivity produced by cells,
which attach to golden electrodes that cover the surface
of the well. The changes correspond to the area of cell
that is in direct contact with the bottom of the well. These
parameters allow for quantification of adhesion intensity
(termed cell index) given the prerequisite that cell number
and cell viability are identical between samples. CK1
inhibition dramatically decreased the cell index (Figure
6g). Because 2.5 μM IC261 did not affect the cell number
(Figure 6h) or cell viability (89% vs. 87.6% for dimethylsulfoxide
vs. 2.5 μM IC261), we interpreted changes in
the cell index as decreased adhesion to the dish surface.
In summary, these results suggest inhibition of CK1δ/ε
prevents the formation of cell-cell and cell-surface contacts
in epithelial MCF7 cells.
The decrease in cell adhesion that was induced by CK1
inhibition and observed in different experimental setups
(Figure 6) might be relevant to cell behavior associated
with tumor progression, such as epithelial-mesenchymal
transition or increased cell migration. This view is supported
by our analysis of the E-cadherin promoter (Figure
7a). E-cadherin mediates intracellular contacts and is
commonly used as a marker of epithelial fate, whose
downregulation contributes to a shift towards mesenchymal
fate [29]. Overexpression of WT CK1e in MCF7 cells
slightly increased the activity of the E-cadherin promoter.
In contrast, mutant forms of CK1e decreased reporter
activity, and the effects of the P6 mutant were statistically
significant from WT (Figure 7a). Similar results were
obtained in HEK293 cells (Additional file 7). These data
suggest that mutation of CK1e contributes to decreased
adhesion through the regulation of E-cadherin expres-
sion.
Treatment with the CK1e inhibitor IC261 decreased
the expression of endogenous E-cadherin in a dosedependent
manner in MCF7 cells (Figure 7b). These
changes in cell adhesion translate into changes of the
migratory capacity of MCF7 cells in Transwell assays. As
shown in Figure 7c, the dose-dependent inhibition of
CK1δ/ε by IC261 promoted the migration of MCF7 cells.
Similar effects were obtained with 10 μM D4476, which
also increased the migration of MCF7 cells (Figure 7d).
These results demonstrate that inhibition of CK1e or
analogically mutants of CK1e can decrease cell adhesion
and promote cell migration via mechanisms involving the
activation of Wnt/Rac1 and Wnt/Ca2+ and the repression
of E-cadherin expression.
Discussion
CK1ε is a crucial regulator of both the canonical Wnt/βcatenin
pathway [14,15,17] and noncanonical Wnt pathways
[10,11,30-32]. Wnt ligands from both classes which
either activate β-catenin or do not - activate CK1e,
which in turn phosphorylates Dvl [11,20]. Phosphorylated
PS-Dvl is thought to mediate downstream signaling,
which results in the stabilization and nuclear translocation
of β-catenin or in the activation of some noncanonical
pathways [11,32].
Our results demonstrate that the three CK1ε mutants
analyzed in this study that were identified in samples of
breast cancer efficiently bind, but fail to phosphorylate,
Dvl and act as loss of function in the Wnt/β-catenin pathway.
We demonstrate that cells expressing these mutants
are biased towards Rac1/JNK and NFAT activation at the
expense of the Wnt/β-catenin pathway. Importantly,
phosphorylation of Dvl by CK1e was shown to be inhibitory
for the noncanonical Wnt/Dvl/Rac1/JNK pathway
[10,19]. CK1e can thus act as a switch that directs signaling
away from the Wnt/Rac1/JNK branch of noncanonical
signaling towards the Wnt/β-catenin and PS-Dvldependent
noncanonical pathways. Wnt/Ca2+, the other
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 10 of 14
Figure 6 Casein kinase 1 epsilon inhibition decreases the cell adhesion of MCF7 breast epithelial cells. (a) to (d) MCF7 cells grown in hanging
drop culture tend to form compact cell clusters under control conditions (dimethylsulfoxide (DMSO)). With increasing amounts of the casein kinase
1 epsilon (CK1ε) inhibitors - (a), (b) D4476, and (c), (d) IC261 - the large single-cluster formation is disrupted, and cells form smaller and disintegrated
aggregates. After resuspending these aggregates by pipetting up and down seven times, a significantly higher number of single cells was observed
to be released from clusters in conditions treated with (b) D4476 and (d) IC261, as normalized to control. ***P < 0.001, Student's t test, n = 3. (e), (f)
MCF7 cells were seeded in the presence or absence of 5 μM IC261. Cell morphology was analyzed after 20 hours in (e) phase contrast or (f)after staining
of actin filaments (phalloidin, green) and cell nuclei (Hoechst, blue). (g), (h) Dynamics of MCF7 cell adhesion was monitored for 20 hours using the
xCELLigence System (Roche Applied Science). Cell adhesion is expressed as the cell index for two control wells (DMSO) and two experimental wells
(2.5 μM IC261). (h) Treatment with IC261 did not affect the cell number (compared with control) during 20 hours of stimulation.
DMSO D4476 (25 μM) D4476 (50 μM)
DMSO IC261 (0.6 μM) IC261 (2.5 μM)
A. B.
D.
E.
DMSO IC261 (5 μM)
F.DMSO IC261 (5 μM)
0
0,2
0,4
0,6
0,8
1
1,2
0 5 10 15 20
Time (hours)
Cellindex
DMSO I
DMSO II
IC261 (2.5 μM) - I
IC261 (2.5 μM) - II
H.
D
M
SO
IC
261
0
2000
4000
6000
8000
Numberofcells
G.
C.
D
M
SO
D
4476
10
+M
D
4476
25
0.0
0.5
1.0
1.5
2.0
2.5
Numberofsinglecells
***
D
M
SO
IC
261
2.5
0
1
2
3
4
5
Numberofsinglecells
+M
+M
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 11 of 14
branch of noncanonical Wnt signaling, was shown to be
antagonized by CK1 [33]. Our results confirm this observation
and show that the CK1e mutants tested here
increase the transcriptional activity of NFAT. These
effects are not promoted by co-expression of Dvl (data
not shown), suggesting that CK1e can repress NFAT
directly. Indeed, phosphorylation by CK1e was shown to
promote the cytoplasmic localization of NFAT and
reduce its transcriptional activity in other experimental
systems [34]. Together, our results provide the first evidence
that the switch function of CK1ε, which was predicted
based on Xenopus and cell culture experiments, is
physiologically relevant and may contribute to cancer
progression in ductal carcinoma.
The observation that ductal carcinoma-specific
mutants of CK1ε promote the Wnt/Rac1/JNK and NFAT
pathways and, on the other hand, inhibit the Wnt/βcatenin
pathway are in good agreement with some clinical
observations. The expression of β-catenin in breast
cancer is usually low and was shown by several laboratories
to correlate with poor prognosis [35-38]. Moreover,
β-catenin is not localized within the cell nucleus in breast
tumors [35-38], suggesting that Wnt/β-catenin signaling
is in the off state in most breast cancers. Important to
note, however, is the fact that there are also reports supporting
a positive role for Wnt/β-catenin signaling in
breast cancer (for a review, see [39]).
Wnt itself was first identified as an oncogene that is
activated by the insertion of the mouse mammary tumor
virus; and the mouse mammary tumor virus-Wnt-1
transgenic mouse is a well-established model for studies
of the genetic basis of breast cancer (for a review, see
[40]). Moreover, increased nuclear β-catenin levels,
which correlate with cyclin D1 levels and a poor prognosis,
were found in a subset of patients [41]. In contrast to
other cancers, such as colon or skin cancer, the key components
of the Wnt/β-catenin pathway, such as axin, adenomatous
polyposis coli, or β-catenin are mutated in only
a small portion of cases (for a review, see [39]). The levels
of Wnt pathway components, which are common to both
the canonical and noncanonical pathways, are altered
more often; Dvl1 is upregulated in 50% of ductal breast
cancer cases [42], and sFRP1 - a soluble Wnt antagonist
that can block both Wnt/β-catenin and noncanonical
pathways - is repressed in more than 80% of breast carcinomas
[43]. These observations suggest that modulators
of Wnt signaling, both at the extracellular level (sFRP1)
and intracellular level (Dvl and CK1ε), will have a critical
role in the biological outcome.
Figure 7 Blocking casein kinase 1 epsilon function decreases E-cadherin expression and promotes cell migration. (a) Wild-type (WT) and mutant
casein kinase 1 epsilon (CK1ε) were expressed in MCF7 cells together with the reporter encoding E-cadherin-promoter coupled to luciferase. Cells
were lysed and the activity of luciferase was analyzed next day. (b) MCF7 cells were treated after seeding out by increasing concentrations of IC261
(2.5 μM, 5 μM and 10 μM) for 48 hours and the expression of E-cadherin was analyzed by western blotting. Empty arrowhead, unspecific band, which
confirms equal protein loading. (c), (d) MCF7 cells were seeded out in the upper part of the Transwell migration chamber and were stimulated with
indicated doses of (c) IC261 and (d) D4476. The number of migrating cells in the bottom chamber was counted next day, and is expressed as the migration
index. Data represent mean ± standard deviation. *P< 0.05; one-way analysis of variance; (a), (c)Tukey post test, (d) Student's ttest; n = 3. DMSO,
dimethylsulfoxide.
A. D.
Transwell assay
D
M
SOD
4476
(10
μM
)
0.0
0.5
1.0
1.5
2.0
2.5
Migrationindex
Transwell assay
D
M
SO
M
)
IC
261
(1
M
)
IC
261
(2.5
M
)
IC
261
(10
0
1
2
3
Migrationindex
C.E-cadherin reporter
C
TR
L
W
T
P3
P4
P6
0.0
0.5
1.0
1.5
Foldchange
* *
*
B.
DMSO
E-cadherin
IC261
μ
μ
μ
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 12 of 14
CK1ε has been shown to be highly expressed in noninvading
ductal carcinoma in situ [1], which is also highly
positive for β-catenin staining [36]. Based on our findings,
we can speculate that the high activity of CK1ε in
ductal carcinoma in situ reduces Rac-1/JNK and NFAT
activity, keeping the cells tightly attached and blocking
tumor invasion. CK1ε function can be compromised by
somatic mutations [1], which dramatically affect CK1ε
kinase activity (present study). The functional importance
of this event supports the fact that samples with
mutations in CK1ε show an increased frequency of loss of
heterozygosity at the CSNK1ε locus [1]. Lack of CK1ε
activity/expression leads to the activation of the Rac1/
JNK/AP1 and NFAT pathways, which mediates the invasion
of breast cancer cells and correlates with increased
aggressiveness of the breast cancer [33,44-47]. Based on
our data and other published information, we propose
that mutation of CK1ε might be important for the transition
between ductal carcinoma in situ and invasive carci-
noma.
The effect of mutation or lack of CK1ε on Wnt signaling
remains to be tested. In this context, it is especially
important to determine how the status of CK1ε affects
Wnt5a. Although Wnt5a is implicated in breast cancer
pathology, its functional mechanism remains unclear.
First, Wnt5a expression was shown to positively correlate
with disease-free survival [48], and Wnt5a blocks breast
cancer cell invasion [49-51]. On the other hand, Wnt5a is
frequently upregulated in breast tumors in comparison
with surrounding tissues [52] and was shown to promote
the invasion of MCF7 cells via the JNK pathway [47]. We
can speculate in cells with mutated CK1ε that Wnt5a will
predominantly signal via the Rac-1/JNK and NFAT pathways,
thus promoting breast cancer cell invasion and
tumor aggressivity [44,45]. In contrast, in cells with abundant
and intact CK1ε, Wnt5a principally stimulates other
noncanonical signaling pathways that involve CK1, such
as the Wnt/CK1ε/Rap1 [32] and Wnt/Yes-Cdc42-CK1α
[33] pathways, and promotes cell adhesion [33].
In summary, our data demonstrate that the CK1ε
mutants found in breast cancer act as loss of function,
suppress jWnt/β-catenin, and promote Wnt/Rac-1-mediated
and NFAT-mediated pathways. Furthermore, we
show that inhibition of CK1ε reduces the intracellular
adhesion and increases the migration of breast cancer
cells. Our findings show that CK1ε has the potential to
act as a tumor suppressor in breast cancer via its negative
effects on the Wnt/Rac1/JNK and NFAT pathways. These
results demonstrate for the first time how mutations in
CK1ε affect cell behavior and may provide a general paradigm
for consequences of CK1ε alteration in cancer.
Conclusions
In the present study, we functionally analyzed mutations
in CK1ε that are frequently found in breast cancer. Our
data demonstrate that breast cancer-specific mutants of
CK1ε act as loss of function in the Wnt/β-catenin pathway
but activate the Wnt/Rac1/JNK and Wnt/Ca2+ pathways.
Physiological consequences of these signaling
events in MCF7 breast cells include increased migratory
capacity and decreased E-cadherin expression and cell
adhesion.
Additional material
Additional file 1 Supplementary materials and methods. Materials and
methods for construction of the recombinant protein expression constructs,
for recombinant protein overexpression and purification, for in vitro
kinase assays, for construction of vectors for mammalian expression, and for
siRNA-mediated knockdown of CK1ε. Notes: pOPIN vectors [54] were used
for bacterial overexpression. The GST-bPDZ construct was prepared as
described previously [55]. siRNA-mediated knockdown performed as
described previously [11].
Additional file 2 Interaction between casein kinase 1 epsilon mutants
and Dishevelled. (a) HEK293 cell lysates transfected with either WT CK1ε or
the P3, P4, and P6 mutants together with Dvl3-Flag were lysed and immunoprecipitated
using an anti-Flag antibody. WT CK1ε and all of the CK1ε
mutants efficiently bind the Dvl3 protein. (b) HEK293 cells were transfected
with WT CK1ε or P3, P4 and P6 mutants together with Dvl2-Myc. Dvl2 protein
localization in transfected HEK293 cells was observed by confocal
microscopy using anti-Myc antibody. Dvl2 is either found in cytoplasmic
inclusions or evenly dispersed within cytoplasm. Wt CK1ε co-transfected
with Dvl2-Myc dissolves most of Dvl2 punctae, resulting in predominance
of evenly distributed Dvl2 protein. In contrast, P3, P4 and P6 mutants are
not able to promote even localization to the extent of WT CK1ε. The graphs
indicate localization patterns (%) in 150 cells.
Additional file 3 Recombinant CK1εΔC mutants exhibit different
kinase activity. (a) His6-WT CK1εΔC phosphorylates the α and β isoforms
of its natural substrate casein (1 to 3), while the kinase activity of the
mutants maltose binding protein (MBP)-P3ΔC (L39Q, S101R) and MBP-P4ΔC
(L39Q, L49Q, N78T) is strongly reduced (4 to 9). A single mutation in SUMOP6ΔC
(L39Q) results in partial kinase activity of the CK1ε enzyme (10 to 12).
(b) The bPDZ domain of Dvl is phosphorylated by individual recombinant
kinases similarly as casein. (c) The CK1ε target sequence in Dvl2, which corresponds
to residues 145 to 168 of hDvl1 (ENLEPETETESVVSLRRERPRRR),
was prepared as a synthetic peptide. This sequence was phosphorylated by
His6-WT CK1εΔC and partially phosphorylated by the SUMO-P6ΔC mutant.
The MBP-P3ΔC and MBP-P4ΔC mutants were unable to phosphorylate this
peptide.
Additional file 4 Reporter assays with Dishevelled 3 protein. TopFlash
and AP1 luciferase assays with Dvl3 protein confirm results obtained with
Dvl2. Graphs indicate the mean ± standard deviation from three independent
replicates. (a) Co-expression of Dvl3-Flag and WT CK1ε in HEK293
potentiates Wnt/β-catenin signaling, while CK1ε mutants have opposite
effects and downregulate TCF/LEF mediated luciferase transcription. (b) Coexpression
of Dvl3-Flag and WT CK1ε in MCF7 potentiates Wnt/β-catenin
signaling, while CK1ε mutants are unable to do so, similarly to the situation
in HEK293 cells. (c) CK1ε forms without Dvl overexpression do not elevate
TCF/LEF-dependent transcription as compared with control empty plasmid.
(d) Dvl3-Flag and WT CK1ε transfected in HEK293 cells decrease JNK/
AP1 signaling. In contrast, each mutant CK1ε together with Dvl3-Flag
induces transcription from AP1 luciferase reporter.
Additional file 5 Casein kinase 1 epsilon does not activate Cdc42.
HEK293 cells were either transfected with CK1e forms or treated with 100
μM D4476 inhibitor 4 hours prior to lysis. Lysates from HEK293 cells were
subjected to pull-down of active GTP-Cdc42 form with agarose-GST-WASP
beads, which specifically interact only with the activated form of Cdc42.
Amount of Cdc42 in pull-down (GTP-Cdc42) and in the original lysate
(Cdc42) were detected by Cdc42 specific antibody using western blotting.
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 13 of 14
Abbreviations
BSA: bovine serum albumin; CKIε: casein kinase 1 epsilon; Dvl: Dishevelled; GST:
glutathione S-transferase; ORF: open reading frame; PBS: phosphate-buffered
saline; PS-Dvl: phosphorylated and shifted Dishevelled; siRNA: small interfering
RNA; WT: wild type.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
SF-T, PS, KT, OB, and VB carried out the molecular genetic and biochemical
studies. SF-T, EB, WB, and LT participated in cloning, plasmid production and
protein purification. PK, AK, and TD designed and coordinated the study. LT
and VB designed and coordinated the study, and drafted the manuscript. All
authors read and approved the final manuscript.
Acknowledgements
Molecular graphics images were produced using the UCSF Chimera package
from the Resource for Biocomputing, Visualization, and Informatics at the University
of California, San Francisco (supported by NIH P41 RR-01081). The
authors thank Dr Christina Modak for providing cDNA templates for CK1ε and
P3, P4 and P6 mutants. They also thank Dr Marek Mlodzik for GST-bPDZ constructs,
Dr S Yanagawa (Kyoto University, Japan) for expression vectors encoding
Dvl2-Myc, Dr Jan Kitajewski (Columbia University) for HA-Wnt3a-B1A cells,
Dr Mikhail Semenov and Dr Xe He (Harvard Medical School) for vectors encoding
mLrp6, Dr Saitoh (University of Tokyo, Japan) for E-cadherin reporter, and Dr
Randy Moon (University of Washington, Seattle) for SuperTopFlash, ca-βcatenin
and hDvl3 constructs. Plasmids for the overexpression of recombinant
CK1ε were generated at the Dortmund Protein Facility [53]. The project was
supported by the Grant Agency of the Czech Republic (301/07/0814 to LT and
TD, 204/09/0498 and 204/09/H058 to VB, 301/09/0587 to PK), the Academy of
Sciences of the Czech Republic (KJB501630801, AVOZ50040507,
AVOZ50040702), the Ministry of Education, Youth and Sports
(MSM0021622430) and by an EMBO Installation Grant to VB.
Author Details
1Biology Centre AS CR, v.v.i. AND University of South Bohemia, Branisovska 31,
37005 Ceske Budejovice, Czech Republic, 2Institute of Experimental Biology,
Faculty of Science, Masaryk University, Kotlarska 2, CZ-61137 Brno, Czech
Republic, 3Department of Cytokinetics, Institute of Biophysics AS CR,
Kralovopolska 135, 60200 Brno, Czech Republic, 4Max-Planck-Institute of
Molecular Physiology, Otto-Hahn-Straße 11, 44227 Dortmund, Germany and
5Current address: Department of Chemistry, Faculty of Science, Utrecht
University, Padualaan 8, NL-3584 CH Utrecht, The Netherlands
References
1. Fuja TJ, Lin F, Osann KE, Bryant PJ: Somatic mutations and altered
expression of the candidate tumor suppressors CSNK1 epsilon, DLG1,
and EDD/hHYD in mammary ductal carcinoma. Cancer Res 2004,
64:942-951.
2. Knippschild U, Gocht A, Wolff S, Huber N, Lohler J, Stoter M: The casein
kinase 1 family: participation in multiple cellular processes in
eukaryotes. Cell Signal 2005, 17:675-689.
3. Lee JS, Ishimoto A, Yanagawa S: Characterization of mouse dishevelled
(Dvl) proteins in Wnt/Wingless signaling pathway. J Biol Chem 1999,
274:21464-21470.
4. Angers S, Thorpe CJ, Biechele TL, Goldenberg SJ, Zheng N, MacCoss MJ,
Moon RT: The KLHL12-Cullin-3 ubiquitin ligase negatively regulates the
Wnt-β-catenin pathway by targeting Dishevelled for degradation. Nat
Cell Biol 2006, 8:348-357.
5. Kelley LA, Sternberg MJ: Protein structure prediction on the Web: a case
study using the Phyre server. Nat Protoc 2009, 4:363-371.
6. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC,
Ferrin TE: UCSF Chimera - a visualization system for exploratory
research and analysis. J Comput Chem 2004, 25:1605-1612.
7. Marchler-Bauer A, Bryant SH: CD-Search: protein domain annotations on
the fly. Nucleic Acids Res 2004, 32:W327-W331.
8. Parthiban V, Gromiha MM, Schomburg D: CUPSAT: prediction of protein
stability upon point mutations. Nucleic Acids Res 2006, 34:W239-W242.
9. Xue Y, Ren J, Gao X, Jin C, Wen L, Yao X: GPS 2.0, a tool to predict kinasespecific
phosphorylation sites in hierarchy. Mol Cell Proteomics 2008,
7:1598-1608.
10. Bryja V, Schambony A, Cajanek L, Dominguez I, Arenas E, Schulte G: Betaarrestin
and casein kinase 1/2 define distinct branches of noncanonical
WNT signalling pathways. EMBO Rep 2008, 9:1244-1250.
11. Bryja V, Schulte G, Rawal N, Grahn A, Arenas E: Wnt-5a induces
Dishevelled phosphorylation and dopaminergic differentiation via a
CK1-dependent mechanism. J Cell Sci 2007, 120:586-595.
12. Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT: Zebrafish prickle,
a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation
movements. Curr Biol 2003, 13:680-685.
13. Horiguchi K, Shirakihara T, Nakano A, Imamura T, Miyazono K, Saitoh M:
Role of Ras signaling in the induction of snail by transforming growth
factor-beta. J Biol Chem 2009, 284:245-253.
14. Peters JM, McKay RM, McKay JP, Graff JM: Casein kinase I transduces Wnt
signals. Nature 1999, 401:345-350.
15. Sakanaka C, Leong P, Xu L, Harrison SD, Williams LT: Casein kinase
iepsilon in the wnt pathway: regulation of β-catenin function. ProcNatl
Acad Sci USA 1999, 96:12548-12552.
16. McKay RM, Peters JM, Graff JM: The casein kinase I family in Wnt
signaling. Dev Biol 2001, 235:388-396.
17. Kishida M, Hino S, Michiue T, Yamamoto H, Kishida S, Fukui A, Asashima M,
Kikuchi A: Synergistic activation of the Wnt signaling pathway by Dvl
and casein kinase Iepsilon. J Biol Chem 2001, 276:33147-33155.
18. Gonzalez-Sancho JM, Brennan KR, Castelo-Soccio LA, Brown AM: Wnt
proteins induce dishevelled phosphorylation via an LRP5/6independent
mechanism, irrespective of their ability to stabilize βcatenin.
Mol Cell Biol 2004, 24:4757-4768.
19. Cong F, Schweizer L, Varmus H: Casein kinase Iepsilon modulates the
signaling specificities of dishevelled. Mol Cell Biol 2004, 24:2000-2011.
20. Swiatek W, Tsai IC, Klimowski L, Pepler A, Barnette J, Yost HJ, Virshup DM:
Regulation of casein kinase I epsilon activity by Wnt signaling. J Biol
Chem 2004, 279:13011-13017.
21. Schwarz-Romond T, Merrifield C, Nichols BJ, Bienz M: The Wnt signalling
effector Dishevelled forms dynamic protein assemblies rather than
stable associations with cytoplasmic vesicles. J Cell Sci 2005,
118:5269-5277.
22. Smalley MJ, Signoret N, Robertson D, Tilley A, Hann A, Ewan K, Ding Y,
Paterson H, Dale TC: Dishevelled (Dvl-2) activates canonical Wnt
signalling in the absence of cytoplasmic puncta. J Cell Sci 2005,
118:5279-5289.
23. Scheeff ED, Bourne PE: Structural evolution of the protein kinase-like
superfamily. PLoS Comput Biol 2005, 1:e49.
24. Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW,
Vogelstein B, Clevers H: Constitutive transcriptional activation by a betacatenin-Tcf
complex in APC-/- colon carcinoma. Science 1997,
275:1784-1787.
25. Dickson RB, Bates SE, McManaway ME, Lippman ME: Characterization of
estrogen responsive transforming activity in human breast cancer cell
lines. Cancer Res 1986, 46:1707-1713.
Additional file 6 siRNA-mediated knockdown of casein kinases
decreases cell adhesion. MCF7 cells were transfected with either control
siRNA or mixture of siRNAs targeted against CK1δ and CK1ε, and were subjected
to the hanging drop assay next day. Cells were photographed 24
hours after seeding; cell clusters with typical morphology are presented.
Knockdown of CK1δ and CK1ε decreases cell adhesion, which leads to the
formation of looser cell aggregates. The efficiency of knockdown of CK1ε
has been determined by western blotting, actin used as a loading control.
Additional file 7 The effects of casein kinase 1 epsilon mutants on Ecadherin
expression in HEK293 cells. WT and mutant CK1ε were
expressed in HEK cells together with the reporter encoding E-cadherin-promoter
coupled to luciferase. Cells were lysed and the activity of firefly
luciferase, which reflects the activity of E-cadherin promoter, was analyzed
next day. Renilla luciferase was used as an internal control. All results were
normalized to Renilla and to the control transfection. Graph shows mean ±
standard error of the mean from three independent experiments.
Received: 6 November 2009 Revised: 4 April 2010
Accepted: 27 May 2010 Published: 27 May 2010
This article is available from: http://breast-cancer-research.com/content/12/3/R30© 2010 Foldynová-Trantírková et al.; licensee BioMed Central Ltd.This is an open access article distributed under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/2.0, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Breast Cancer Research 2010, 12:R30
Foldynová-Trantírková et al. Breast Cancer Research 2010, 12:R30
http://breast-cancer-research.com/content/12/3/R30
Page 14 of 14
26. Rena G, Bain J, Elliott M, Cohen P: D4476, a cell-permeant inhibitor of
CK1, suppresses the site-specific phosphorylation and nuclear
exclusion of FOXO1a. EMBO Rep 2004, 5:60-65.
27. Bain J, Plater L, Elliott M, Shpiro N, Hastie CJ, McLauchlan H, Klevernic I,
Arthur JS, Alessi DR, Cohen P: The selectivity of protein kinase inhibitors:
a further update. Biochem J 2007, 408:297-315.
28. Mashhoon N, DeMaggio AJ, Tereshko V, Bergmeier SC, Egli M, Hoekstra
MF, Kuret J: Crystal structure of a conformation-selective casein kinase-
1 inhibitor. J Biol Chem 2000, 275:20052-20060.
29. Huber MA, Kraut N, Beug H: Molecular requirements for epithelialmesenchymal
transition during tumor progression. Curr Opin Cell Biol
2005, 17:548-558.
30. Klein TJ, Jenny A, Djiane A, Mlodzik M: CKIepsilon/discs overgrown
promotes both Wnt-Fz/β-catenin and Fz/PCP signaling in Drosophila.
Curr Biol 2006, 16:1337-1343.
31. Strutt H, Price MA, Strutt D: Planar polarity is positively regulated by
casein kinase Iepsilon in Drosophila. Curr Biol 2006, 16:1329-1336.
32. Tsai IC, Amack JD, Gao ZH, Band V, Yost HJ, Virshup DM: A Wnt-CKIvarεRap1
pathway regulates gastrulation by modulating SIPA1L1, a Rap
GTPase activating protein. Dev Cell 2007, 12:335-347.
33. Dejmek J, Safholm A, Kamp Nielsen C, Andersson T, Leandersson K: Wnt-
5a/Ca2+-induced NFAT activity is counteracted by Wnt-5a/Yes-Cdc42casein
kinase 1α signaling in human mammary epithelial cells. Mol Cell
Biol 2006, 26:6024-6036.
34. Okamura H, Garcia-Rodriguez C, Martinson H, Qin J, Virshup DM, Rao A: A
conserved docking motif for CK1 binding controls the nuclear
localization of NFAT1. Mol Cell Biol 2004, 24:4184-4195.
35. Dolled-Filhart M, McCabe A, Giltnane J, Cregger M, Camp RL, Rimm DL:
Quantitative in situ analysis of β-catenin expression in breast cancer
shows decreased expression is associated with poor outcome. Cancer
Res 2006, 66:5487-5494.
36. Bankfalvi A, Terpe HJ, Breukelmann D, Bier B, Rempe D, Pschadka G, Krech
R, Lelle RJ, Boecker W: Immunophenotypic and prognostic analysis of Ecadherin
and β-catenin expression during breast carcinogenesis and
tumour progression: a comparative study with CD44. Histopathology
1999, 34:25-34.
37. Bukholm IK, Nesland JM, Karesen R, Jacobsen U, Borresen-Dale AL: Ecadherin
and α-, β-, and γ-catenin protein expression in relation to
metastasis in human breast carcinoma. J Pathol 1998, 185:262-266.
38. Nakopoulou L, Gakiopoulou H, Keramopoulos A, Giannopoulou I,
Athanassiadou P, Mavrommatis J, Davaris PS: c-met tyrosine kinase
receptor expression is associated with abnormal β-catenin expression
and favourable prognostic factors in invasive breast carcinoma.
Histopathology 2000, 36:313-325.
39. Cowin P, Rowlands TM, Hatsell SJ: Cadherins and catenins in breast
cancer. Curr Opin Cell Biol 2005, 17:499-508.
40. Li Y, Hively WP, Varmus HE: Use of MMTV-Wnt-1 transgenic mice for
studying the genetic basis of breast cancer. Oncogene 2000,
19:1002-1009.
41. Lin SY, Xia W, Wang JC, Kwong KY, Spohn B, Wen Y, Pestell RG, Hung MC:
Beta-catenin, a novel prognostic marker for breast cancer: its roles in
cyclin D1 expression and cancer progression. Proc Natl Acad Sci USA
2000, 97:4262-4266.
42. Nagahata T, Shimada T, Harada A, Nagai H, Onda M, Yokoyama S, Shiba T,
Jin E, Kawanami O, Emi M: Amplification, up-regulation and overexpression
of DVL-1, the human counterpart of the Drosophila
disheveled gene, in primary breast cancers. Cancer Sci 2003,
94:515-518.
43. Ugolini F, Charafe-Jauffret E, Bardou VJ, Geneix J, Adelaide J, Labat-Moleur
F, Penault-Llorca F, Longy M, Jacquemier J, Birnbaum D, Pebusque MJ:
WNT pathway and mammary carcinogenesis: loss of expression of
candidate tumor suppressor gene SFRP1 in most invasive carcinomas
except of the medullary type. Oncogene 2001, 20:5810-5817.
44. Yiu GK, Toker A: NFAT induces breast cancer cell invasion by promoting
the induction of cyclooxygenase-2. J Biol Chem 2006, 281:12210-12217.
45. Jauliac S, Lopez-Rodriguez C, Shaw LM, Brown LF, Rao A, Toker A: The role
of NFAT transcription factors in integrin-mediated carcinoma invasion.
Nat Cell Biol 2002, 4:540-544.
46. Schnelzer A, Prechtel D, Knaus U, Dehne K, Gerhard M, Graeff H, Harbeck
N, Schmitt M, Lengyel E: Rac1 in human breast cancer: overexpression,
mutation analysis, and characterization of a new isoform, Rac1b.
Oncogene 2000, 19:3013-3020.
47. Pukrop T, Klemm F, Hagemann T, Gradl D, Schulz M, Siemes S, Trumper L,
Binder C: Wnt 5a signaling is critical for macrophage-induced invasion
of breast cancer cell lines. Proc Natl Acad Sci USA 2006, 103:5454-5459.
48. Jonsson M, Dejmek J, Bendahl PO, Andersson T: Loss of Wnt-5a protein is
associated with early relapse in invasive ductal breast carcinomas.
Cancer Res 2002, 62:409-416.
49. Safholm A, Leandersson K, Dejmek J, Nielsen CK, Villoutreix BO, Andersson
T: A formylated hexapeptide ligand mimics the ability of Wnt-5a to
impair migration of human breast epithelial cells. J Biol Chem 2006,
281:2740-2749.
50. Safholm A, Tuomela J, Rosenkvist J, Dejmek J, Harkonen P, Andersson T:
The Wnt-5a-derived hexapeptide Foxy-5 inhibits breast cancer
metastasis in vivo by targeting cell motility. Clin Cancer Res 2008,
14:6556-6563.
51. Medrek C, Landberg G, Andersson T, Leandersson K: Wnt-5a-CKIα
signaling promotes β-catenin/E-cadherin complex formation and
intercellular adhesion in human breast epithelial cells. J Biol Chem
2009, 284:10968-10979.
52. Lejeune S, Huguet EL, Hamby A, Poulsom R, Harris AL: Wnt5a cloning,
expression, and up-regulation in human primary breast cancers. Clin
Cancer Res 1995, 1:215-222.
53. Dortmund Protein Facility [http://www.mpi-dortmund.mpg.de/misc/
dpf/]
54. Berrow NS, Alderton D, Sainsbury S, Nettleship J, Assenberg R, Rahman N,
Stuart DI, Owens RJ: A versatile ligation-independent cloning method
suitable for high-throughput expression screening applications.
Nucleic Acids Res 2007, 35:e45.
55. Jenny A, Reynolds-Kenneally J, Das G, Burnett M, Mlodzik M: Diego and
Prickle regulate Frizzled planar cell polarity signalling by competing for
Dishevelled binding. Nat Cell Biol 2005, 7:691-697.
doi: 10.1186/bcr2581
Cite this article as: Foldynová-Trantírková et al., Breast cancer-specific mutations
in CK1? inhibit Wnt/?-catenin and activate the Wnt/Rac1/JNK and NFAT
pathways to decrease cell adhesion and promote cell migration Breast Cancer
Research 2010, 12:R30
1
SUPPLEMENTARY INFOMATION
Breast cancer-specific mutations in CK1ε inhibit Wnt/β-catenin and activate the
Wnt/Rac1/JNK and NFAT pathways to decrease cell adhesion and promote cell
migration.
Silvie Foldynová-Trantírková, Petra Sekyrová, Kateřina Tmejová, Eva Brumovská, Ondřej
Bernatík, Wulf Blankenfeldt, Pavel Krejčí, Alois Kozubík, Tomáš Doležal, Lukáš Trantírek,
Vítězslav Bryja
Supplementary – FIGURE CAPTION
Supplementary Figure 1
A. HEK 293 cell lysates transfected with either WT CK1ε or the P3, P4, and P6 mutants
together with Dvl3-Flag were lysed and immunoprecipitated using an anti-Flag
antibody. WT CK1ε and all of the CK1ε mutants efficiently bind the Dvl3 protein
B. HEK 293 cells were transfected with wt CK1ε or P3, P4 and P6 mutants together with
Dvl2-Myc. Dvl2 protein localization in transfected HEK293 cells was observed by
confocal microscopy using anti-Myc antibody. Dvl2 is either found in cytoplasmic
inclusions or evenly dispersed within cytoplasm. Wt CK1ε co-transfected with Dvl2Myc
dissolves most of Dvl2 punctae resulting in predominance of evenly distributed
Dvl2 protein. In contrast, P3, P4 and P6 mutants are not able to promote even
localization to the extent of WT CK1ε. The graphs indicate localization patterns (%)
in 150 cells.
Supplementary Figure 2
TopFlash and AP-1 luciferase assays with Dvl3 protein confirm results obtained with
Dvl2. Graphs indicate mean+SD from three independent replicates.
A. Coexpression of Dvl3-Flag and wt CK1ε in HEK293 potentiates Wnt/β-catenin
signaling, while CK1ε mutants have opposite effects and downregulate TCF/LEF
mediated luciferase transcription.
2
B. Coexpression of Dvl3-Flag and wt CK1ε in MCF-7 potentiates Wnt/β-catenin
signaling, while CK1ε mutants are unable to do so, similarly to the situation in
HEK293 cells.
C. CK1ε forms without Dvl overexpression do not elevate TCF/LEF dependent
transcription as compared to control empty plasmid.
D. Dvl3-Flag and wt CK1ε transfected in HEK 293 cells decrease JNK/AP-1 signaling.
In contrast, each mutant CK1ε together with Dvl3-Flag induces transcription from AP-
1 luciferase reporter.
Supplementary Figure 3
HEK 293 were either transfected with CK1ε forms or treated with 100 µM D4476
inhibitor 4 hours prior to lysis. Lysates from HEK 293 cells were subjected to pull-down
of active GTP-Cdc42 form with agarose-GST-WASP beads, which specifically interact
only with the activated form of Cdc42. Amount of Cdc42 in pulldown (GTP-Cdc42) and
in the original lysate (Cdc42) were detected by Cdc42 specific antibody using Western
blotting.
Supplementary Figure 4
MCF-7 cells were transfected with either control siRNA or mixture of siRNAs targeted
against CK1δ and CK1ε, and subjected to the hanging drop assay next day. Cells were
photographed 24 hours after seeding, cell clusters with typical morphology are presented.
Knockdown of CK1δ and CK1ε decreases cell adhesion, which leads to the formation of
looser cell aggregates. The efficiency of knockdown of CK1ε has been determined by
Western blotting, actin is used as a loading control.
Supplementary Figure 5
WT and mutant CK1ε were expressed in HEK cells together with the reporter encoding Ecadherin-promoter
coupled to luciferase. Cells were lysed and the activity of firefly
luciferase, which reflects the activity of E-cadherin promoter was analyzed next day.
Renilla luciferase was used as an internal control. All results were normalized to Renilla
and to the control transfection. Graph shows mean+SEM from three independent
experiments.
3
4
5
Supplementary information - Material and Methods
Construction of the expression constructs, protein over-expression and purification
The CKIε DNAs corresponding to truncated forms of CKIε lacking auto-inhibition domain in
a forms of wild type and P3, P4, and P6 mutants were generated from full-lengths constructs,
courtesy of Dr. C. Modak, by PCR. The constructs of CK1ε catalytical domain corresponding
to wild-type, P3, P4, and P6 mutants were introduced via homologous recombination into four
different bacterial expression vectors, pOPINE, pOPINF, pOPINM, and pOPINS [1],
producing C-terminally His6-, N-terminally His6-, N-terminally maltose binging protein-, and
N-terminally SUMO-tagged fusion proteins, respectively. All PCR products were sequenced
in their entirety. The vectors were introduced into the (DE3)RIL E.coli over-expression strain.
Subsequently, the transfected bacteria were screened for soluble expression of the individual
proteins under three different growth and induction conditions. Soluble over-expression of
CKIεΔC wild-type was observed only for C-terminally His6-tagged protein. Soluble P3ΔC
and P4ΔC mutants were obtained in a form of N-terminally MBP-tagged fusion proteins.
P6ΔC mutants provided soluble over-expression as N-terminally SUMO-tagged fusion
protein.
The CKIe gene constructs were expressed in E. coli BL21(DE3) Codon Plus RIL cells
(Novagen). An overnight culture from a single colony was diluted (1:100) into fresh Terrific
Broth (TB) auto-induction medium supplemented with 50 mg l−1
ampicillin and 34 mg l−1
chloramphenicol. The cells were grown at 310 K in the TB medium with vigorous shaking for
4 hours. Then, the temperature was set to 298 K and auto-induced gene expression was
allowed for 24 hours. The cells were harvested by centrifugation for 15 min at 6000g,
resuspended in 50 mM Na2HPO4 pH 7.5 300 mM NaCl supplemented with 2 mM βmercaptoethanol
and then lysed with a fluidizer. The lysate was then centrifuged at 150 000g
(Beckmann Optima L-­70K ultracentrifuge; Ti-45 rotor) for 30 min and the resulting
supernatant filtered, adsorbed and eluted from Ni–NTA affinity resin. Fractions containing
CKIε fusion proteins, as judged by sodium dodecyl sulfate (SDS) gel electrophoresis, were
pooled, dialyzed against 50 mM sodium phosphate buffer (pH=7) and 150 mM NaCl and
concentrated prior to purification using gel filtration on Superdex 75 (GE Healthcare) in the
same buffer. The purified protein was then transferred into the storage buffer (50 mM sodum
phosphate buffer pH=8.0, 300 mM NaCl, 0.1% Tween, 10% glycerol) and stored at -80 ºC.
For all mutants, any attempt to cleave off the tags resulted in the protein precipitation.
Therefore, fusion, recombinant proteins (His6-CKIεΔC, MBP-P3ΔC, MBP-P4ΔC, SUMO-
6
P6ΔC) were purified and used in in vitro phosphorylation assays in the uncleaved form. The
GST-bPDZ construct was prepared as described previously [2].
Construction of vectors for mammalian expression
Open reading frames of human CKIε cDNA wt full-length (residues: 1-416) and three
mutated versions (P3, P4, and P6) in pET vectors, were amplified by PCR using following
specific primers: CKIεFW sense 5’-aagcttatggagctacgtgtggg-3’, and CKIεRV antisense 5’tctagattacttcccgagatggtcaa-3’.
The PCR products were purified and inserted into pGEM-Teasy
vector. All fragments were subsequently cloned into pcDNA3 vector by HindIII – XbaI sites.
The truncated versions of CKIεΔC wt and P3ΔC, P4ΔC, and P6ΔC mutants (residues: 1-315)
were amplified by PCR using primers CKIε-NFW sense 5’-aagcttgagctacgtgtgggg-3’, and
CKIε-NRV antisense 5’-tctagattacctctcctcgcgttcg-3’, cloned into pGEM-T easy followed by
subcloning at the HindIII/PstI site of pHAK-B3.
siRNA-mediated knockdown
siRNA-mediated knockdown has been performed as described previously ([3]). Following
siRNAs have been used: control (sc37007), CK1δ (sc29910) and CK1ε (sc29914) (all from
Santa Cruz Biotechnology)
References
1. Berrow NS, Alderton D, Sainsbury S, Nettleship J, Assenberg R, Rahman N, Stuart
DI, Owens RJ: A versatile ligation-independent cloning method suitable for highthroughput
expression screening applications. Nucleic Acids Res 2007, 35(6):e45.
2. Jenny A, Reynolds-Kenneally J, Das G, Burnett M, Mlodzik M: Diego and Prickle
regulate Frizzled planar cell polarity signalling by competing for Dishevelled
binding. Nat Cell Biol 2005, 7(7):691-697.
3. Bryja V, Schulte G, Rawal N, Grahn A, Arenas E: Wnt-5a induces Dishevelled
phosphorylation and dopaminergic differentiation via a CK1-dependent
mechanism. J Cell Sci 2007, 120(Pt 4):586-595.
Vítězslav Bryja, 2014    Attachments 
 
 
#11 
 
 
K. Tanneberger, A.S. Pfister, K. Brauburger, J. Schneikert, M.V. Hadjihannas, V. Kriz, G. 
Schulte, V. Bryja and J. Behrens (2011): Amer1/WTX couples Wnt‐induced formation of 
PtdIns(4,5)P2 to LRP6 phosphorylation. EMBO J. 30: 1433‐1443.  
 
 
Impact factor (2011): 9.205 
Times cited (without autocitations, WoS, Feb 21st 2014): 19 
Significance: The first analysis of the mechanism behind the positive role of Amer1 in 
Wnt/β‐catenin  signaling.  This  study  shows  that  Amer1  can  bridge  Dishevelled‐
controlled  formation  of  phosphatidyl  inositol  phosphates  with  downstream 
phosphorylation of Lrp6, a key step in the activation of the pathway. 
Contibution of the author/author´s team: Fluorescence recovery after photobleaching 
(FRAP) assays describing Wnt‐3a‐induced Amer1 membrane dynamics. 
 
 
   
 
 
 
Amer1/WTX couples Wnt-induced formation
of PtdIns(4,5)P2 to LRP6 phosphorylation
Kristina Tanneberger1
, Astrid S Pfister1
,
Katharina Brauburger1
, Jean Schneikert1
,
Michel V Hadjihannas1
, Vitezslav Kriz2,3
,
Gunnar Schulte4
, Vitezslav Bryja2,3
and Ju¨ rgen Behrens1,
*
1
Nikolaus-Fiebiger-Center, University Erlangen-Nu¨rnberg, Erlangen,
Germany, 2
Faculty of Science, Institute of Experimental Biology,
Masaryk University, Brno, Czech Republic, 3
Department of Cytokinetics,
Institute of Biophysics, Academy of Sciences of the Czech Republic,
Brno, Czech Republic and 4
Department of Physiology and
Pharmacology, Karolinska Institutet, Stockholm, Sweden
Phosphorylation of the Wnt receptor low-density lipoprotein
receptor-related protein 6 (LRP6) by glycogen
synthase kinase 3b (GSK3b) and casein kinase 1c (CK1c)
is a key step in Wnt/b-catenin signalling, which requires
Wnt-induced formation of phosphatidylinositol 4,5bisphosphate
(PtdIns(4,5)P2). Here, we show that adenomatous
polyposis coli membrane recruitment 1 (Amer1)
(also called WTX), a membrane associated PtdIns(4,5)P2binding
protein, is essential for the activation of Wnt
signalling at the LRP6 receptor level. Knockdown of
Amer1 reduces Wnt-induced LRP6 phosphorylation,
Axin translocation to the plasma membrane and formation
of LRP6 signalosomes. Overexpression of Amer1 promotes
LRP6 phosphorylation, which requires interaction of
Amer1 with PtdIns(4,5)P2. Amer1 translocates to the plasma
membrane in a PtdIns(4,5)P2-dependent manner after
Wnt treatment and is required for LRP6 phosphorylation
stimulated by application of PtdIns(4,5)P2. Amer1 binds
CK1c, recruits Axin and GSK3b to the plasma membrane
and promotes complex formation between Axin and
LRP6. Fusion of Amer1 to the cytoplasmic domain of
LRP6 induces LRP6 phosphorylation and stimulates
robust Wnt/b-catenin signalling. We propose a mechanism
for Wnt receptor activation by which generation of PtdIns
(4,5)P2 leads to recruitment of Amer1 to the plasma
membrane, which acts as a scaffold protein to stimulate
phosphorylation of LRP6.
The EMBO Journal advance online publication, 8 February
2011; doi:10.1038/emboj.2011.28
Subject Categories: signal transduction
Keywords: Amer1; LRP6; PtdIns(4,5)P2; Wnt; WTX
Introduction
The Wnt/b-catenin signalling pathway regulates cell proliferation,
differentiation and apoptosis, and has an important
role during embryonic development, adult tissue homoeostasis
and various diseases including cancer (Lustig and
Behrens, 2003; Clevers, 2006). In the absence of extracellular
Wnt ligands the levels of cytoplasmic b-catenin are kept low
by the action of a multiprotein destruction complex that
targets b-catenin for proteasomal degradation. The core
components of this complex are the scaffold proteins Axin
and its homologue Conductin (Axin2), the tumour suppressor
adenomatous polyposis coli (APC) and glycogen synthase
kinase 3b (GSK3b), which phosphorylates b-catenin and
thereby earmarks it for ubiquitin-mediated degradation in
the proteasome (MacDonald et al, 2009). The binding of Wnt
ligands to the transmembrane receptors Frizzled (Fz) and
low-density lipoprotein receptor-related protein 6 (LRP6)
initiates a signalling cascade that results in the inhibition of
b-catenin phosphorylation and degradation leading to the
activation of b-catenin-dependent transcription (Huang and
He, 2008; Angers and Moon, 2009; MacDonald et al, 2009).
A key step after Wnt stimulation is the phosphorylation of
the intracellular domain (ICD) of LRP6 at five reiterated
PPPSPxS motifs and adjacent Ser/Thr clusters (Tamai et al,
2004; Davidson et al, 2005; Zeng et al, 2005; MacDonald et al,
2008; Supplementary Figure S7A). Phosphorylation at the
PPPSPxS motifs (e.g., at Ser1490) is mediated by GSK3b,
whereas the Ser/Thr clusters (e.g., at Thr1479) are
phosphorylated by casein kinase 1g (CK1g) (Davidson et al,
2005; Zeng et al, 2005). The phosphorylated PPPSPxS motifs
provide docking sites for Axin (Mao et al, 2001; Tamai et al,
2004; Davidson et al, 2005) and can directly inhibit the
activity of GSK3b (Cselenyi et al, 2008; Piao et al, 2008; Wu
et al, 2009).
Phosphorylation of LRP6 by GSK3b requires binding of
Dishevelled (Dvl) to Fz, which in turn leads to recruitment of
the Axin/GSK3b complex (Zeng et al, 2008). In contrast,
CK1g is constitutively localized to the plasma membrane
(Davidson et al, 2005). It was recently suggested that coclustering
of Fz-LRP6 receptors together with Axin and Dvl in
so-called LRP6 signalosomes is involved in LRP6 phosphorylation
(Bilic et al, 2007). Signalosome formation depends on
the ability of Dvl to dynamically polymerize, which might
provide a high density of phosphorylation sites for GSK3b
and CK1g (Bilic et al, 2007; Schwarz-Romond et al, 2007a, b).
Recent evidence indicates that the Wnt-induced generation of
phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) at the
plasma membrane is required for LRP6 phosphorylation by
GSK3b as well as CK1g and for signalosome formation (Pan
et al, 2008). This process is mediated by Dvl, which binds
and activates phosphatidylinositol 4-kinase type IIa (PI4KIIa)
and phosphatidylinositol-4-phosphate 5-kinase type Ib
(PIP5KIb) sequentially acting to produce PtdIns(4,5)P2 (Pan
et al, 2008; Qin et al, 2009).Received: 9 August 2010; accepted: 18 January 2011
*Corresponding author. Nikolaus-Fiebiger-Center, University ErlangenNu¨rnberg,
Glu¨ckstr. 6, 91054 Erlangen, Germany.
Tel.: þ 49 9131 8529109; Fax: þ 49 9131 8529111;
E-mail: jbehrens@molmed.uni-erlangen.de
The EMBO Journal (2011), 1–11 | & 2011 European Molecular Biology Organization |All Rights Reserved 0261-4189/11
www.embojournal.org
&2011 European Molecular Biology Organization The EMBO Journal
EMBO
THE
EMBO
JOURNAL
THE
EMBO
JOURNAL
1
Amer1 (APC membrane recruitment 1) was initially
described by our group as an APC-binding protein, which
can associate with the plasma membrane via two N-terminal
PtdIns(4,5)P2-binding domains (Grohmann et al, 2007).
Amer1 is identical to the tumour suppressor WTX (Wilms
Tumour gene on the X chromosome) mutated in a significant
fraction of Wilms tumours (Rivera et al, 2007) and in the
inherited disease OSCS (osteopathia striata congenita
with cranial sclerosis) (Jenkins et al, 2009). Amer1 is found
in complexes with b-catenin and components of the b-catenin
destruction machinery such as APC, Axin and b-TrCP, and
can block canonical Wnt signalling by inducing proteasomal
degradation of b-catenin (Major et al, 2007). Studies in
Zebrafish and Xenopus also suggest a negative role of
Amer1 in Wnt signalling (Major et al, 2007).
Several key players involved in LRP6 phosphorylation
have been identified (Fz, Dvl, Axin, GSK3b, CK1g and
PtdIns(4,5)P2), but a coherent picture of their interactions
and the sequence of events are still missing. In particular, the
mechanism by which Wnt-induced PtdIns(4,5)P2 formation
results in LRP6 phosphorylation has remained elusive. In the
present study, we identify an unexpected role of Amer1 as a
positive regulator of Wnt signalling acting at the LRP6
receptor level by showing that Amer1 links Wnt-induced
formation of PtdIns(4,5)P2 to LRP6 phosphorylation.
Results
Amer1 is required for Wnt-induced LRP6
phosphorylation
To investigate whether Amer1 has a function in Wnt signalling
at the receptor level, we knocked down its expression
using two different siRNAs and analysed Wnt-induced phosphorylation
of LRP6 in plasma membrane fractions by western
blotting. We found that Amer1 knockdown prevented
LRP6 phosphorylation at Ser1490 and Thr1479 in Wnt3Atreated
HEK293T cells (Figure 1A and B; Supplementary
Figure S1A). Amer1 knockdown also prevented LRP6
phosphorylation in SW480 colon carcinoma cells
(Supplementary Figure S1B). Reciprocally, overexpression
Figure 1 Amer1 is required for Wnt-induced LRP6 phosphorylation and signalosome formation. (A, B) Amer1 is required for LRP6
phosphorylation at Ser1490 (A) and Thr1479 (B). HEK293T cells stably expressing LRP6-EGFP were transfected with the indicated siRNAs
and incubated with Wnt3A for 1 h. Membrane fractions were analysed by western blotting. (C) Overexpression of Amer1 promotes LRP6
phosphorylation at Ser1490. HEK293T cells stably expressing VSVG-LRP6 were transiently transfected with EGFP-Amer1 and treated with
Wnt3A for 20 min. Note that Amer1 is expressed in two splice variants represented by the two bands on the anti-GFP western blot (cf.
Supplementary Figure S3A). In panels (A) and (B), the anti-Amer1 antibody detects only the larger splice variant of endogenous Amer1. (D, E)
Amer1 is required for Wnt-induced signalosome formation. (D) Signalosome formation in HeLa cells co-expressing LRP6-EYFP and Fz8-EYFP
transfected with the indicated siRNAs. Images show EYFP fluorescence with and without Wnt3A treatment for 1 h. Right-hand panels represent
higher magnifications of the boxed regions from the left. Arrowheads point to signalosomes. Scale bar is 10 mm. (E) Quantification of
signalosome formation in cells from (D). Error bars indicate s.e.m. from three independent experiments.
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
The EMBO Journal &2011 European Molecular Biology Organization2
of Amer1 stimulated LRP6 phosphorylation at Ser1490
(Figure 1C; Supplementary Figure S1C). Notably, the
previously described recruitment of Axin to the plasma
membrane after Wnt stimulation was also abolished after
knockdown of Amer1 (Figure 1A; Mao et al, 2001). These
data show that Amer1 is essential for Wnt-induced LRP6
phosphorylation and Axin translocation to the plasma membrane
and point to a positive role of Amer1 in the activation
of Wnt signalling at the receptor level.
Amer1 is required for Wnt-induced signalosome
formation
Given the role of Amer1 in Wnt receptor activation we
analysed whether it is involved in signalosome formation.
Signalosomes were detected by monitoring the aggregation
of YFP-tagged LRP6 and Fz8 after Wnt3A stimulation. Indeed
knockdown of Amer1 efficiently reduced formation of LRP6
signalosomes (Figure 1D and E). These results show that
Amer1 is required for Wnt-induced signalosome formation
and corroborate a role for Amer1 in the activation of the Wnt
pathway at the receptor level.
Membrane localization of Amer1 through PtdIns(4,5)P2
binding is required for its effect on LRP6
phosphorylation
We next analysed whether LRP6 activation depends on
plasma membrane localization of Amer1, which is mediated
by two short domains in its N-terminus. These domains bind
to PtdIns(4,5)P2 and are characterized by a high proportion
of highly conserved lysine residues known for their capacity
to interact with PtdIns(4,5)P2 (Kagan and Medzhitov, 2006;
Grohmann et al, 2007; Supplementary Figure S2A). Mutation
of seven of these lysine residues to alanine (Amer1(7mLys))
abolished interaction with PtdIns(4,5)P2 as well as membrane
association of Amer1 (Supplementary Figure S2B and C).
Importantly, this mutant was defective in stimulating LRP6
phosphorylation in HEK293T cells (Figure 2A, left panels).
Because the Amer1(7mLys) mutant is enriched in the nucleus,
this experiment does not rule out a role of Amer1 in the
cytoplasm. Fusion of the Amer1(7mLys) mutant to a nuclear
export sequence (NES-Amer1(7mLys)) led to cytoplasmic
localization of Amer1, but did not restore its ability to
stimulate LRP6 phosphorylation (Figure 2A, right panels;
Supplementary Figure S2C). Together, these results show
that PtdIns(4,5)P2-mediated membrane association of
Amer1 is required for its effect on LRP6 phosphorylation
and that cytoplasmic localization alone is not sufficient.
Amer1 is expressed in two splice isoforms termed Amer1-S1
or Amer1-S2, which differ by the presence or absence of
amino acids 50–326, comprising a large part of the membrane
association/PtdIns(4,5)P2-binding domain (Supplementary
Figure S3A; Jenkins et al, 2009). While Amer1-S1, which
binds to the plasma membrane, stimulated LRP6 phosphorylation,
Amer1-S2 lacking the membrane association failed
to do so (Supplementary Figure S3B and C). Importantly,
specific knockdown of the Amer1-S1 isoform reduced
Wnt-induced LRP6 phosphorylation, whereas knockdown of
Amer1-S2 had no effect (Figure 2B; Supplementary Figure
S3A and D). These data further support the importance of
membrane localization of Amer1 for its effect on LRP6
phosphorylation.
Wnt induces plasma membrane translocation of Amer1,
which requires the formation of PtdIns(4,5)P2
Next, we studied whether activation of Wnt signalling alters
the association of Amer1 with the plasma membrane and
whether PtdIns(4,5)P2 is involved. Wnt3A treatment induced
a rapid increase of endogenous Amer1 in the plasma membrane
fraction of HEK293T cells, whereas total amounts of
Amer1 in whole cell lysates were not altered (Figure 3A).
To determine whether Wnt-induced association of Amer1
with the plasma membrane depends on the formation of
PtdIns(4,5)P2 we knocked down PI4KIIa, which was shown
to be essential for PtdIns(4,5)P2 synthesis after Wnt stimulation
(Pan et al, 2008). Wnt-induced plasma membrane
recruitment of Amer1 was strongly reduced when PI4KIIa
was knocked down by two different siRNAs (Figure 3B;
Supplementary Figure S4). Neomycin binds PtdIns(4,5)P2
and can block its interaction with proteins (Gabev et al,
1989; Pilot et al, 2006). Pre-treatment of cells with neomycin
abolished Wnt-induced membrane association of Amer1 and
at the same time strongly reduced LRP6 phosphorylation and
Figure 2 Membrane localization of Amer1 through PtdIns(4,5)P2 binding is required for its effect on LRP6 phosphorylation. (A) N-terminal
lysine mutants of Amer1 (EGFP-Amer1(7mLys), EGFP-NES-Amer1(7mLys)) lacking PtdIns(4,5)P2 binding and membrane association are
deficient for LRP6 phosphorylation. HEK293T cells stably expressing VSVG-LRP6 were transiently transfected with EGFP-tagged Amer1
constructs as indicated and treated with Wnt3A for 20 min. For details on the constructs, see Supplementary Figure S2A–C. (B) Effect of specific
knockdown of Amer1 splice variants Amer1-S1 and Amer1-S2 on LRP6 phosphorylation. HeLa cells transfected with the indicated Amer1
siRNAs were incubated with Wnt3A for 1 h and endogenous LRP6 was examined by western blotting (WB). Specific RT–PCR for expression of
the splice variants is shown below. See also Supplementary Figure S3A–D. In (A) and (B) numbers below the lanes reflect relative levels of
phosphorylated LRP6 (pS1490) normalized to LRP6 as determined by densitometry. Experiments were repeated at least three times.
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
&2011 European Molecular Biology Organization The EMBO Journal 3
Wnt-induced recruitment of Axin to the plasma membrane
(Figure 3C). Together, these data demonstrate that Amer1 is
translocated to the plasma membrane in a PtdIns(4,5)P2dependent
manner after Wnt stimulation.
Wnt3A decreases membrane dynamics of Amer1
In order to test for effects of Wnt stimulation on the membrane
dynamics of Amer1, we employed fluorescence recovery
after photobleaching (FRAP) methodology. Selected
membrane regions of EGFP-Amer1-expressing cells were
bleached by a laser pulse and the recovery of EGFP fluorescence
was analysed for 150 s (see Figure 3D for a typical
experiment). Pre-incubation with Wnt3A decreased the
mobile pool of Amer1 from B74% (95% confidence interval:
73.1–75.1%) to 55% (95% confidence interval: 54.4–56.7%)
and at the same time increased the halftime required for
recovery of Amer1 from 13 to 18 s (Figure 3E; Supplementary
Table). This indicates that Wnt signalling generates an
immobile pool of Amer1 at the plasma membrane that does
not readily exchange with neighbouring or cytoplasmic
Amer1. Interestingly, pre-treatment of cells with neomycin
restored recovery in the presence of Wnt3A suggesting that
Wnt-induced changes in the mobility of membrane Amer1
are dependent on PtdIns(4,5)P2 (Figure 3E).
Amer1 is required for PtdIns(4,5)P2-induced LRP6
phosphorylation
We previously found that treatment of cells with ionomycin
which activates phospholipase C and thereby leads to breakdown
of PtdIns(4,5)P2 resulted in release of Amer1 from the
plasma membrane (Varnai and Balla, 1998; Grohmann et al,
2007). Interestingly, ionomycin treatment abolished LRP6
phosphorylation after Wnt treatment (Figure 4A). In line,
inhibition of PtdIns(4,5)P2 formation by knockdown of
PI4KIIa prevents LRP6 phosphorylation after Wnt stimulation
(Pan et al, 2008; Figure 4B). To analyse whether this is due to
loss of Amer1 from the plasma membrane we asked whether
tethering of Amer1 to the membrane independently of
PtdIns(4,5)P2 would be able to restore LRP6 phosphorylation.
Indeed, reduced LRP6 phosphorylation after knockdown of
PI4KIIa was prevented by Amer1 when fused to the transmembrane
domain from the low-density lipoprotein (LDL)
receptor (Figure 4B; Zeng et al, 2005). Recent data
demonstrate that carrier-mediated transfer of exogenous
PtdIns(4,5)P2 lipids into cells enhances Wnt-induced LRP6
phosphorylation (Pan et al, 2008). We found that knockdown
of Amer1 abolished the stimulation of LRP6 phosphorylation
by PtdIns(4,5)P2 (Figure 4C). These data demonstrate that
Amer1 mediates the effect of PtdIns(4,5)P2 on LRP6 phos-
phorylation.
Figure 3 Wnt induces plasma membrane translocation of Amer1, which requires the formation of PtdIns(4,5)P2. (A) Wnt3A induces plasma
membrane translocation of Amer1. HEK293T cells stably expressing LRP6-EGFP were incubated with Wnt3A for 1 h and then subjected to
subcellular fractionation. Cytoplasmic fractions (C), membrane fractions (M) and whole cell lysates (WCL) were analysed by western blotting.
a-Tubulin and LRP6 were used to mark cytoplasmic and membrane fractions, respectively. (B) Knockdown of PI4KIIa prevents Wnt-induced
plasma membrane recruitment of Amer1. siRNA transfected HeLa cells were incubated with Wnt3A for 1 h and membrane fractions were
analysed by western blotting. (C) Neomycin abolishes Wnt-induced membrane translocation of Amer1. HEK293Tcells stably expressing VSVGLRP6
were treated with 10 mM neomycin for 30 min before incubation with Wnt3A plus neomycin for 1 h and membrane fractions were
analysed by western blotting. (D, E) Wnt decreases membrane dynamics of Amer1. HEK293 cells transiently transfected with EGFP-Amer1
were subjected to FRAP analysis. (D) Typical example of EGFP-Amer1 distribution and changes in EGFP fluorescence before and after
bleaching. Scale bar is 10 mm. (E) Statistical analysis of FRAP experiments using cells pre-stimulated with PBS (control) or Wnt3A with or
without 10 mM neomycin as indicated (N, number of cells analysed per condition). The graphs show mean values and s.e.m., and the best
fitting curve model, which was used for calculation of the mobile pool of EGFP-Amer1 (% of fluorescence recovered) and of the recovery
halftime (T1/2).
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
The EMBO Journal &2011 European Molecular Biology Organization4
Amer1 recruits Axin and GSK3b to the plasma
membrane and promotes complex formation between
Axin and LRP6
Our data show that Amer1 is required for Wnt-induced Axin
translocation to the plasma membrane (see Figure 1A).
Therefore, Amer1 might stimulate LRP6 phosphorylation
through recruitment of Axin (Zeng et al, 2005, 2008). It is
possible, however, that membrane association of Axin is a
consequence rather than a cause of increased LRP6 phosphorylation
induced by Amer1 because the phosphorylated
PPPSPxS motifs in the cytoplasmic domain of LRP6 can serve
as docking sites for Axin (Mao et al, 2001; Tamai et al, 2004;
Davidson et al, 2005). To rule out this possibility, we treated
cells with LiCl in order to inhibit GSK3b-mediated LRP6
phosphorylation and monitored Wnt-induced Axin translocation
to the plasma membrane. LiCl treatment efficiently
inhibited LRP6 phosphorylation but had no effect on Axin
recruitment (Figure 5A). This shows that phosphorylation of
LRP6 is not required for the association of Axin with the
plasma membrane after Wnt treatment, suggesting that
Amer1 promotes Axin translocation independently of prior
LRP6 phosphorylation. We therefore analysed whether
Amer1 can directly recruit Axin and the associated GSK3b.
Amer1 formed endogenous complexes with Axin as
shown by immunoprecipitation (Supplementary Figure
S5A). In agreement with previous reports, Axin was diffusely
distributed in the cytoplasm in a dotty pattern when exogenously
expressed in MCF-7 cells (e.g., Schwarz-Romond et al,
2005; Figure 5B). In contrast, Axin was localized to the
plasma membrane when Amer1 was expressed (Figure 5B;
Supplementary Figure S5B). Similarly, endogenous Conductin
was redistributed by Amer1 to the plasma membrane
in SW480 colon carcinoma cells (Supplementary Figure S5C).
Axin and Conductin were not redirected to the plasma
membrane by Amer1(7mLys) mutants, indicating that membrane
association of Amer1 is required (Supplementary
Figure S5B and C). Importantly, in the presence but not in
the absence of Axin Amer1 was also able to recruit GSK3b to
the plasma membrane (Figure 5B). In line, GSK3b co-immunoprecipitated
with Amer1 in the presence of wild-type Axin
but not in the presence of a mutant that lacks GSK3b binding
(AxinL396Q; Zeng et al, 2008), indicating that Axin proteins
link GSK3b to Amer1 (Figure 5C). Together, these data
suggest that Amer1 stimulates LRP6 phosphorylation by
recruiting the Axin/GSK3b complex. In support of this, a
C-terminal deletion mutant of Amer1 that retains Axin/
Conductin binding (Amer1(2–601)) stimulated LRP6 phosphorylation
whereas a mutant lacking the Axin/Conductinbinding
region (Amer1(2–530)) failed to do so (Figure 5D;
Supplementary Figure S6A–C).
Next, we analysed whether Amer1 binds to LRP6 by coimmunoprecipitation
experiments. We found that Amer1 and
Figure 4 Amer1 is required for PtdIns(4,5)P2-induced LRP6 phosphorylation. (A) Ionomycin treatment prevents Wnt-induced LRP6
phosphorylation. HEK293T cells stably expressing VSVG-LRP6 were treated with Wnt3A in the presence or absence of 10 mM ionomycin for
30 min. (B) Amer1DN (amino acids 207–1135) linked to the transmembrane domain of the LDL receptor (RFP-TMD-Amer1DN) rescues
phosphorylation of endogenous LRP6 after knockdown of PI4KIIa. HeLa cells stably expressing RFP or RFP-TMD-Amer1DN were transfected
with the indicated siRNAs and incubated with Wnt3A for 1 h. The numbers below the lanes reflect relative levels of phosphorylated LRP6
(pS1490) normalized to LRP6 as determined by densitometry. Data are representative of four independent experiments. (C) Amer1 is required
for LRP6 phosphorylation stimulated by PtdIns(4,5)P2. HEK293Tcells stably expressing VSVG-LRP6 and transfected with the indicated siRNAs
were treated with PtdIns(4,5)P2 for 10 min before Wnt3A conditioned medium was added for another 20 min (left). Quantification of LRP6
phosphorylation from four independent experiments (right). Statistical analysis was done using an unpaired Student’s t-test. The P-value
reflects statistically significant differences. The black bars represent the experiment shown on the left.
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
&2011 European Molecular Biology Organization The EMBO Journal 5
LRP6 form complexes after overexpression and at the endogenous
level (Figure 5E and F). Amer1 also co-immunoprecipitated
with LRP6 lacking the extracellular domain
(LRP6DE(1–4); Supplementary Figure S7A and B). Immunoprecipitation
with serial LRP6 C-terminal deletion mutants
(Davidson et al, 2005) showed that Amer1 interacts with a
fragment retaining the membrane proximal PPPSPxS motif
and flanking Ser/Thr clusters (LRP6DE(1–4)D87; Supplementary
Figure S7A and B). Deletion of the PPPSPxS motif
abolished the interaction (LRP6DE(1–4)D127). Amer1 did
not interact with a fragment consisting only of the PPPSPxS
motif and Ser/Thr clusters, indicating that these motifs are
not sufficient for Amer1 binding (LDLRDN-miniC; Supplementary
Figure S7A and B). Moreover, alanine substitutions
Figure 5 Amer1 recruits Axin and GSK3b to the plasma membrane and promotes complex formation between Axin and LRP6. (A) Inhibition
of LRP6 phosphorylation by LiCl does not prevent Wnt-induced Axin translocation to the plasma membrane. HEK293T cells stably expressing
EGFP-LRP6 were incubated with 50 mM LiCl for 30 min before Wnt3A treatment for 1 h and membrane fractions were analysed by western
blotting. (B, C) Amer1 associates with GSK3b and recruits it to the plasma membrane via the interaction with Axin. (B) MCF-7 cells were cotransfected
as indicated above the panels. Expressed proteins were detected by CFP and YFP fluorescence and anti-Flag immunofluorescence.
Scale bar is 20 mm. (C) GSK3b co-immunoprecipitates with EGFP-Amer1 in the presence of Flag-Axin but not Flag-AxinL396Q, which is
defective in GSK3b binding. (D) The binding of Amer1 to Axin/Conductin is required for its effect on LRP6 phosphorylation. HEK293T
cells stably expressing VSVG-LRP6 were transiently transfected with EGFP or EGFP-tagged Amer1 mutants as detailed in Supplementary
Figure S6A–C. The numbers below the lanes reflect relative levels of phosphorylated LRP6 (pS1490) normalized to LRP6 as determined by
densitometry. Data are representative of four independent experiments. (E, F) Amer1 interacts with LRP6. (E) Co-immunoprecipitation of LRP6
with EGFP-Amer1 upon transient transfection of HEK293T cells stably expressing VSVG-LRP6. (F) Co-immunoprecipitation of endogenous
Amer1 and LRP6 from lysates of HEK293T cells. Immunoprecipitations were performed with mouse anti-Amer1 or control IgG antibodies. (G)
Amer1 links Axin to LRP6. VSVG-LRP6 stably expressed in HEK293Tcells co-immunoprecipitated with Flag-Axin in the presence but not in the
absence of EGFP-Amer1. (H) Amer1 interacts with CK1g. Co-immunoprecipitation of endogenous CK1g and Amer1 from lysates of SW480
cells. Immunoprecipitations were performed with mouse anti-Amer1 or control IgG antibodies. As CK1g levels in lysates were very low,
immunoprecipitation with anti-CK1g antibodies is shown.
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
The EMBO Journal &2011 European Molecular Biology Organization6
of serines and threonines in the PPPSPxS motifs (LRP6m10;
Zeng et al, 2005) did not affect Amer1 binding to LRP6 (data
not shown). Together, these data demonstrate that Amer1
binds close to the signalling motifs phosphorylated by GSK3b
and CK1g, but that phosphorylation of these motifs is not
required for Amer1 binding. Deletion analysis of Amer1
demonstrated that both central and C-terminal parts interact
with LRP6, suggesting that there are multiple LRP6 interaction
sites in Amer1 (data not shown).
Axin is suggested to form a complex with LRP6 (Mao et al,
2001; Tamai et al, 2004; Davidson et al, 2005). Because
Amer1 binds to both Axin and LRP6, it might promote
complex formation between the two proteins. Indeed, while
LRP6 was only poorly co-immunoprecipitated with Axin in
the absence of Amer1, it was strongly immunoprecipitated
when Amer1 was present (Figure 5G). Conversely, Axin
might link LRP6 to Amer1. However, this is unlikely, because
Axin did not increase the amounts of LRP6 co-immunoprecipitated
with Amer1 (Supplementary Figure S7C).
In co-immunoprecipitation experiments endogenous complexes
of Amer1 and CK1g were found (Figure 5H). Amer1
did not interact with a CK1g mutant lacking the membrane
association domain (Supplementary Figure S8A and B).
These results are consistent with the finding that Amer1 is
necessary for LRP6 phosphorylation at the CK1g site Thr1479
(cf. Figure 1B; Supplementary Figure S1A).
An Amer1–LRP6 fusion protein activates downstream
Wnt/b-catenin signalling independently of Wnt
Our data indicate that Amer1 acts by recruiting the Axin/GSK3b
complex to LRP6. To test whether close proximity between
Amer1 and LRP6 would be sufficient to trigger LRP6 phosphorylation
and, consequently, downstream b-catenin signalling, we
fused Amer1 to the ICD of LRP6 (Supplementary Figure S9).
After transfection in HEK293T cells phosphorylation of the
LRP6-ICD was strongly stimulated by fusion to Amer1, but
not by fusion to the membrane targeting domain of Amer1
(amino acids 2–209) or to Amer1DN lacking this domain
(Figure 6A and B). Consistent with this, the LRP6-ICD–Amer1
fusion protein robustly induced stabilization of cytoplasmic
b-catenin and activation of a TCF/b-catenin-dependent transcriptional
reporter (Figure 6C). In contrast, the LRP6-ICD alone
or its fusion to the Amer1 deletion mutants had no or only a
minor stimulatory activity. Thus, Amer1 can directly induce
LRP6 phosphorylation and activation of downstream Wnt/
b-catenin signalling when fused to the cytoplasmic domain of
LRP6. Notably, Amer1 alone did not stimulate b-catenin stabilization
or reporter gene expression in spite of its ability to
induce LRP6 phosphorylation (see Figure 1C; Supplementary
Figure S1C). This is presumably due to its concurrent function
in promoting b-catenin degradation (Major et al, 2007), and
indicates that its negative regulatory activity is abolished in the
LRP6-ICD–Amer1 fusion construct (see Discussion).
Figure 6 Fusion of Amer1 to the cytoplasmic domain of LRP6 induces LRP6 phosphorylation and stimulates downstream Wnt/b-catenin
signalling. (A, B) Amer1 fused to the LRP6 intracellular domain (ICD) suffices to induce LRP6 phosphorylation. (A) Phosphorylation of the
EGFP-LRP6-ICD–Amer1 fusion constructs (Supplementary Figure S9) as determined by anti-pS1490 western blotting. The band indicated by
the asterisk most likely represents the Amer1-S2 splice variant generated from the LRP6-ICD–Amer1 fusion, which does not stimulate
phosphorylation of the LRP6-ICD. (B) Quantification of the experiment from (A) as determined by densitometry. The intensity of the pS1490
bands was normalized to the intensity of the GFP bands with the LRP6-ICD set to 1. (C) The LRP6-ICD–Amer1 fusion protein activates
a b-catenin-dependent luciferase reporter stably expressed in HEK293T cells (Major et al, 2007) and induces stabilization of cytoplasmic
b-catenin. Fold changes of luciferase activity were determined by normalization to the EGFP control. Error bars indicate s.d.
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
&2011 European Molecular Biology Organization The EMBO Journal 7
Discussion
It is meanwhile well established that LRP6 phosphorylation is
a key and early event in Wnt signalling. However, although
several key players are known in this process it has remained
elusive how LRP6 is linked to the activating kinases GSK3b
and CK1g and how Wnt-induced formation of PtdIns(4,5)P2
is involved. We propose that Amer1 is an essential intermediate
in the process of Wnt receptor activation and that
it has a specific role in connecting PtdIns(4,5)P2 to LRP6
phosphorylation.
Mechanism of LRP6 phosphorylation induced by Amer1
Our knockdown and overexpression experiments showed
that Amer1 is necessary and sufficient for LRP6 phosphorylation.
We suggest that this function is based on the complex
formation of Amer1 with Axin/GSK3b and CK1g, and on the
Wnt-regulated dynamic interaction of these complexes with
the plasma membrane. It was previously shown that Axin
and its relative Conductin are crucial for LRP6 phosphorylation
through binding to GSK3b (Zeng et al, 2005, 2008). We
found that Amer1 interacts with Axin and the associated
GSK3b and can link Axin to LRP6. When directly fused to the
cytoplasmic domain of LRP6 Amer1 promotes phosphorylation
of LRP6 at the GSK3b phosphorylation site Ser1490,
and induces downstream Wnt/b-catenin signalling. This
suggests that Amer1 acts as a scaffold protein to recruit
GSK3b to LRP6 via Axin, and thereby promotes LRP6 phosphorylation,
very much like Axin acts as a scaffold for
b-catenin phosphorylation (Behrens et al, 1998; Ikeda et al,
1998). Amer1 also interacts with CK1g, the second kinase
responsible for LRP6 phosphorylation. Unlike GSK3b, CK1g is
constitutively present at the plasma membrane (Davidson
et al, 2005) and it is not known how it is activated by Wnt
signalling. It is possible that Amer1 recruits CK1g from the
lateral plasma membrane to the vicinity of LRP6 receptors
and thereby positions CK1g for optimal phosphorylation of
LRP6. In line with a scaffolding role, Amer1 binds close to the
membrane proximal phosphorylation sites of GSK3b and
CK1g in LRP6 (Supplementary Figure S7A and B).
Of interest, Amer1 was initially identified as an APCbinding
protein, which contains three independent APC
interaction sites (Supplementary Figure S3A). We noticed
that Wnt-induced LRP6 phosphorylation does not depend
on APC (Supplementary Figure S10), suggesting that this
interaction is not of relevance for the function of Amer1 in
LRP6 phosphorylation.
From our immunoprecipitation experiments and published
proteomic studies (Major et al, 2007), Amer1/Axin/GSK3b
and Amer1/CK1g complexes seem to form constitutively in
cells. This raises the question why these complexes are
inactive with respect to LRP6 phosphorylation in the absence
of Wnts and how they become activated by Wnt signalling.
We found that Amer1 is recruited to the plasma membrane
after Wnt stimulation through formation of PtdIns(4,5)P2,
and that membrane localization of Amer1 is essential for
stimulation of LRP6 phosphorylation. Moreover, Amer1 is
required for plasma membrane localization of Axin after Wnt
stimulation and can directly recruit Axin/GSK3b to the
membrane. Altogether, this points to a crucial role of Wntinduced
membrane localization of Amer1 for activation of
LRP6 phosphorylation. In the absence of Wnts, a fraction of
Amer1 together with its associated proteins might be present
at the plasma membrane but at too low concentrations to
promote LRP6 phosphorylation, whereas after Wnt stimulation
the mere increase of plasma membrane bound Amer1
leads to activation of LRP6 phosphorylation. Moreover, it
could well be that PtdIns(4,5)P2 is preferentially formed in
the vicinity of the Fz/LRP6 receptor complexes due to local
engagement of Dvl by Fz, which stimulates PtdIns(4,5)P2
synthesis after Wnt stimulation (Pan et al, 2008). This could
generate a high density of binding sites for Amer1 and its
associated kinases at the receptors and thereby allow efficient
phosphorylation of LRP6. In support of this, increased
PtdIns(4,5)P2 levels were found to be associated with LRP6
aggregates, that is, signalosomes, as compared with nonaggregated
LRP6 in sucrose density fractions (Pan et al,
2008). Altogether, we suggest a model (Figure 7) in which
PtdIns(4,5)P2 molecules formed after Wnt stimulation
through Dvl serve as docking sites for Amer1 at the plasma
membrane and attract Amer1 to LRP6. Amer1 recruits Axin/
GSK3b and CK1g to these sites, binds to LRP6 and promotes
LRP6 phosphorylation. Thus, Amer1 seems to act as a scaffold
protein at the plasma membrane that connects LRP6
receptors to the activating kinases in a Wnt-inducible and
PtdIns(4,5)P2-dependent manner. This model implies that the
PtdIns(4,5)P2-dependent recruitment of Amer1 is of functional
relevance for LRP6 phosphorylation and positions
Amer1 within the Wnt-Dvl-PtdIns(4,5)P2 pathway described
previously (Tamai et al, 2004; Davidson et al, 2005; Zeng
et al, 2005, 2008; Pan et al, 2008). In fact, our studies show
that Amer1 is required for LRP6 phosphorylation stimulated
by PtdIns(4,5)P2 and that fusion of Amer1 to an unrelated
membrane targeting domain rescues LRP6 phosphorylation
after inhibition of PtdIns(4,5)P2 synthesis by knockdown of
PI4KIIa.
Integration of Amer1 into current models of LRP6
phosphorylation
According to an initiation-amplification model, LRP6 phosphorylation
by GSK3b occurs in two steps. Initial recruitment
of the Axin/GSK3b complex to the plasma membrane allows
phosphorylation at PPPSPxS motifs such as at Ser1490 and
thus creates docking sites for more Axin/GSK3b complexes,
which in turn induce further phosphorylation at other
Figure 7 A model for the involvement of Amer1 in PtdIns(4,5)P2mediated
LRP6 phosphorylation. Wnt binding to the Fz-LRP6
receptor complex leads to recruitment of Dvl, which induces
the formation of PtdIns(4,5)P2 by binding and activating the phosphatidylinositol
kinases PI4KII and PIP5KI. The generation of PtdIns
(4,5)P2 in regions of receptor activity triggers the recruitment of
Amer1 proteins, which in turn promote LRP6 phosphorylation by
recruiting Axin/GSK3b and CK1g to LRP6.
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
The EMBO Journal &2011 European Molecular Biology Organization8
PPPSPxS sites resulting in amplification of the signal (Zeng
et al, 2008; MacDonald et al, 2009). It was proposed that
initiation occurs through Fz/Dvl-mediated recruitment of
Axin/GSK3b complexes to LRP6 (Cliffe et al, 2003; Zeng
et al, 2008). Amer1 may have a similar role as Dvl in
mediating the initial phosphorylation steps because it can
recruit Axin/GSK3b independently of prior phosphorylation
of LRP6. In fact, Dvl and Amer1 might cooperate in the
recruitment of Axin/GSK3b: Dvl might recruit Axin by direct
interaction, and/or indirectly by promoting PtdIns(4,5)P2
synthesis and, as a consequence, Amer1 translocation to
the plasma membrane. Amer1 does not seem to be conserved
in invertebrates such as Drosophila where phosphorylation of
the LRP6 orthologue arrow is presumably also critical. This
may indicate that initiation relies entirely on the Dvl-dependent
Axin recruitment in these organisms and that Amer1
provides an additional level of regulation in vertebrates.
According to the signalosome model, Fz-LRP6 receptor
pairs aggregate due to polymerization of Dvl and co-cluster
with Axin leading to LRP6 phosphorylation (Bilic et al, 2007;
Schwarz-Romond et al, 2007a, b). We found that Amer1 is
essential for signalosome formation. This role of Amer1 is
probably independent of its function in LRP6 phosphorylation
because signalosome formation did not require LRP6
phosphorylation by CK1g (Bilic et al, 2007). Instead, Amer1
might be directly involved in receptor aggregation, for
example, through its ability to connect LRP6 to Axin, which
in turn can interact with Dvl. Our FRAP analysis shows that
Amer1 is recruited to an immobile pool at the plasma
membrane upon Wnt stimulation, which might correspond
to signalosomes. So far, we have not been able to detect
Amer1 in signalosomes probably owing to the suboptimal
stoichiometry of the many overexpressed proteins in this
assay. Of note, PtdIns(4,5)P2 was shown to be required for
signalosome formation (Pan et al, 2008), possibly through
interaction with Amer1.
Amer1 has a dual positive and negative role in Wnt
signalling
Our results show that Amer1 acts as an activator of the Wnt
signalling pathway at the LRP6 receptor level, whereas loss of
function and biochemical studies suggest a role of Amer1 as a
negative regulator of Wnt signalling by inducing degradation
of b-catenin (Major et al, 2007). Indeed, overexpression of
Amer1 repressed the activity of a TCF/b-catenin-dependent
transcriptional reporter (Supplementary Figure S11). Thus,
Amer1 has a dual functional role as an activator and inhibitor
of the Wnt pathway. Because of its downstream role in
b-catenin degradation only the negative regulatory role
becomes apparent in loss of function studies. The dual role
of Amer1 is similar to that of Axin and GSK3b, which are
required for activation of LRP receptors but are also essential
for b-catenin degradation. In the case of GSK3b, these functions
may be spatially separated between plasma membrane
and cytoplasm (Zeng et al, 2005, 2008). In contrast, both
activation and inhibition of Wnt signalling by Amer1 require
its localization in the plasma membrane (Figure 2; KT and JB
unpublished data) raising the question as to how these
activities are regulated. It is possible that the differential
localization of Amer1 between the general membrane compartment
and clustered Fz/LRP6 receptors determines the
balance between inhibiting and activating functions of Amer1
and provides a switch mechanism between these activities.
In the simplest model, a constitutive pool of Amer1 at the
plasma membrane might be involved in the steady state
degradation of b-catenin. After Wnt stimulation, Amer1 is
recruited close to LRP6 leading to its phosphorylation as
discussed above. Thereafter, phosphorylated LRP6 might
directly inhibit Amer1 function in b-catenin degradation by
blocking GSK3b via its phosphorylated PPPSPxS motifs
(Cselenyi et al, 2008; Piao et al, 2008; Wu et al, 2009) and/
or by interfering with binding of Amer1 to interaction partners
such as b-catenin and APC. In line, when present in a
fusion protein with the ICD of LRP6 Amer1 can lead to
stabilization of b-catenin and activation of Wnt/b-catenindependent
transcription, indicating that the function of
Amer1 in b-catenin degradation is blocked in the complex
with LRP6 (Figure 6C). Alternatively, Amer1 might initially
act as an activator of the signal and turn into an inhibitor,
as part of a negative feedback regulation mediated by the
TCF/b-catenin-dependent upregulation of Conductin (Lustig
et al, 2002).
Materials and methods
Cell culture, Wnt treatment and subcellular fractionation
HEK293Tcells stably expressing VSVG-LRP6 (Zeng et al, 2005) were
kindly provided by X He and HEK293T cells stably expressing
LRP6-EGFP (Kategaya et al, 2009) or pBAR/Renilla (Major et al,
2007) by RT Moon. HeLa cells stably expressing RFP-TMDAmer1DN
or RFP were selected after transfection in medium
containing 1 mg/ml geneticin (G418, Invitrogen) and enriched using
a MoFlo high-speed cell sorter (Dako Cytomation). Wnt3A
conditioned medium was produced from mouse L cells stably
expressing Wnt3A (American Type Culture Collection CRL-2647)
and added 48 h after transfection for knockdown experiments, or
16 h after transfection for overexpression experiments. Ionomycin
was obtained from Calbiochem. Subcellular fractionation of cells
was carried out using the ProteoJET Membrane Protein Extraction
Kit (Fermentas) according to the manufacturer’s instructions.
Plasmids
The pEGFP-Amer1(7mLys) mutant was obtained by PCR mutagenesis.
pEGFP-NES-Amer1(7mLys) was created by the insertion of an
oligonucleotide coding for a consensus MAPKK-NES (NLVDLQKK
LEELELDEQQ) (Henderson and Eleftheriou, 2000) between the
EGFP- and Amer1-coding sequences of pEGFP-Amer1(7mLys). To
obtain the pEGFP-LRP6-ICD–Amer1 fusion constructs, the coding
sequence of the LRP6-ICD (residues 1394–1613) was inserted
between the coding sequences of EGFP and the respective Amer1
constructs. mRFP-TMD-Amer1DN was generated by replacing the
LRP6-coding sequence of mRFP-daLRP6 (Krieghoff et al, 2006) with
the transmembrane domain of the LDL receptor (residues 781–849;
Zeng et al, 2005) fused to the Amer1(207–1135)-coding sequence.
To generate pEGFP-Amer1-S1, three single nucleotide changes (147
A4C, 150 T4C, 153 G4A) were introduced leading to the ablation
of the internal splice donor site without changing the amino-acid
sequence. pEGFP-Amer1-S2 contains an in-frame deletion of
residues 50–326. Details of the plasmids are available upon request.
Lipid-binding assay and PtdIns(4,5)P2 delivery
GST-Amer1 proteins were expressed in Escherichia coli BL21 and
freshly purified before the experiment using Glutathione Sepharose
4B beads (GE Healthcare) as described previously (Grohmann et al,
2007). Membrane Lipid Strips (Echelon Biosciences Inc.) were
incubated with the GST fusion proteins at a concentration of 1 mg/ml
at 41C overnight and detected by an anti-GST antibody, according to
the manufacturer’s instructions. For delivery of PtdIns(4,5)P2 into
cells, lipids and Carrier 3 (Echelon Biosciences Inc.) were preincubated
at a 1:1 molar ratio (100mM final concentration each) for
10min at room temperature and then added to the cells at a final
concentration of 10mM. After incubation of the cells for 10min at 371C,
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
&2011 European Molecular Biology Organization The EMBO Journal 9
the same volume of Wnt3A conditioned medium was added for
another 20min.
Immunofluorescence microscopy
Immunofluorescence stainings were performed as described
previously (Hadjihannas et al, 2006; Grohmann et al, 2007). For
signalosome experiments, cells were transfected with 100 pmol
siRNA together with 600 ng LRP6-EYFP, 200 ng MESD, 200 ng Fz8EYFP,
200 ng Flag-Axin, 200 ng Flag-GSK3b and 100 ng CFP-Dvl2
using TransIT-TKO (Mirus, Madison, WI, USA). Photographs were
taken with a CCD camera (Visitron, Munich, Germany) on a Zeiss
Axioplan 2 microscope (Zeiss, Oberkochen, Germany, Â 63 objective
or  100 objective) and MetaMorph software (Molecular
Devices).
Amer1 antibodies
The mouse monoclonal antibody against Amer1 has been described
before (Grohmann et al, 2007). The Amer1-specific rabbit polyclonal
antibody was produced by Pineda (Berlin, Germany) by
immunizing rabbits with amino acids 2–285 of recombinant
human Amer1 generated as a GST fusion in bacteria. The serum
was affinity purified using CNBr-activated Sepharose 4B beads
(GE Healthcare) coupled to GST-Amer1(2–285).
Reporter assays
b-Catenin reporter assays were carried out in HEK293T cells stably
expressing a b-catenin responsive firefly luciferase reporter (pBAR)
along with a Renilla luciferase, which serves as an internal control
(Major et al, 2007). Cells were seeded in 12-well plates, transfected
with 200 ng of the indicated constructs and harvested 24 h posttransfection.
Firefly and Renilla luciferase activities were determined
according to standard procedures, and firefly luciferase
values were normalized to Renilla values. All experiments were
performed in duplicates and reproduced at least twice.
Fluorescence recovery after photobleaching
HEK293 cells were plated on 35-mm glass bottom dish (MatTek
Corp.) pre-coated with 0.1% collagen (Sigma) and transfected with
the calcium phosphate method using 1.6 mg of EGFP-Amer1
plasmid/dish. FRAP analysis was carried out 24 h after transfection
on a Zeiss LSM710 laser scanning microscope (488 nm laser line)
with a C-Apochromat  40 water immersion objective, NA ¼ 1.2
(Zeiss, Jena, Germany). During live cell imaging, cells were kept at
371C in serum-free DMEM supplemented with 20 mM HEPES and
0.1% BSA. Stimulation with 100 ng/ml purified, recombinant
Wnt3A (R&D Systems) and/or 10 mM neomycin (Sigma) was
performed for 30 min prior image acquisition. One or two B5 mm2
square regions of interest (ROI) were selected per cell. Basal signal
intensity was measured in 1 s intervals for 18 s. Applied laser power
was 1% to minimize photobleaching. Then, the ROI was bleached
for 4 s with two scans with maximum power using the 488-nm line
argon laser. Fluorescence recovery was recorded in 1 s intervals for
154 s. Image processing and data analysis were done using the Zen
2009 software (Zeiss, Jena, Germany). The raw data were normalized
with the average fluorescence of 20 data points before
bleaching as 100% and the first value after bleaching as 0%. Sum
of all datasets with stable recovery have been statistically analysed
and the quantitative information (mobile pool, recovery halftime)
was obtained by the non-linear one phase association using the
least squares fitting method. The normalization and statistical
analysis have been performed using GraphPad Prism software
(GraphPad Software Inc.).
RT–PCR
RT–PCR was performed according to standard protocols (see
Supplementary Experimental Procedures) using the following sense
and antisense primers: Amer1-S1 (50
-GCGAATTCGGAGACCC
AAAAGGATGAAGCTGCTCAG-30
, 50
-CCTTGCTCTTCCGGTGACGGC
GGATACTGC-30
), Amer1-S2 (50
-GCGAATTCGGAGACCCAAAAGG
ATGAAGCTGCTCAG-30
, 50
-CATCATCATCTGGCAAGGCCATCTC-30
)
and GAPDH (50
-CTTCACCACCATGGAGAAGG-30
, 50
-CCTGCTTCACC
ACCTTCTTG-30
). Note that PCR for Amer1-S2 leads to the coamplification
of products from Amer1-S1 and Amer1-S2 as the
primers flank the alternatively spliced intron. GAPDH was used for
normalization.
Supplementary data
Supplementary data are available at The EMBO Journal Online
(http://www.embojournal.org).
Acknowledgements
We thank C Niehrs, X He, RT Moon, P De Camilli and A Kikuchi for
cell lines and reagents; J Masˇek for technical assistance with FRAP
analysis; I Wacker for helpful discussions; A Do¨bler for secretarial
assistance. This work was supported by the DFG research grant BE
1550/6-1 and the IZKF research grant TPD12 to Ju¨rgen Behrens and
the DFG research grant SCHN 1189/1-1 to Jean Schneikert. Vitezslav
Bryja is supported by grants from the Czech Science Foundation
(204/09/0498, 204/09/J030), EMBO Installation Grant, the Ministry
of Education Youth and Sports of the Czech Republic (MSM
0021622430) and by Academy of Sciences of the Czech Republic
(AVOZ50040507, AVOZ50040702). Gunnar Schulte is supported by
Knut and Alice Wallenberg Foundation (KAW2008.0149), Swedish
Research Council (K2008-68P-20810-01-4, K2008-68X-20805-01-4)
and The Swedish Foundation for International Cooperation in
Research and Higher Education (STINT).
Author contributions: KT planned and performed most of
the experimental work. KT, ASP, KB, MVH and JS performed
co-immunoprecipitation and immunofluorescence experiments.
ASP generated the Amer1-specific rabbit polyclonal antibody. VK,
GS and VB performed FRAP experiments. JB coordinated the project
and assisted with planning the experiments and data analysis. The
manuscript was written by JB and KT.
Conflict of interest
The authors declare that they have no conflict of interest.
References
Angers S, Moon RT (2009) Proximal events in Wnt signal transduction.
Nat Rev Mol Cell Biol 10: 468–477
Behrens J, Jerchow BA, Wurtele M, Grimm J, Asbrand C, Wirtz R,
Kuhl M, Wedlich D, Birchmeier W (1998) Functional interaction
of an axin homolog, conductin, with beta-catenin, APC, and
GSK3beta. Science 280: 596–599
Bilic J, Huang YL, Davidson G, Zimmermann T, Cruciat CM, Bienz
M, Niehrs C (2007) Wnt induces LRP6 signalosomes and promotes
dishevelled-dependent LRP6 phosphorylation. Science 316:
1619–1622
Clevers H (2006) Wnt/beta-catenin signalling in development and
disease. Cell 127: 469–480
Cliffe A, Hamada F, Bienz M (2003) A role of dishevelled in
relocating axin to the plasma membrane during wingless signalling.
Curr Biol 13: 960–966
Cselenyi CS, Jernigan KK, Tahinci E, Thorne CA, Lee LA, Lee E
(2008) LRP6 transduces a canonical Wnt signal independently of
axin degradation by inhibiting GSK3’s phosphorylation of betacatenin.
Proc Natl Acad Sci USA 105: 8032–8037
Davidson G, Wu W, Shen J, Bilic J, Fenger U, Stannek P,
Glinka A, Niehrs C (2005) Casein kinase 1 gamma couples Wnt
receptor activation to cytoplasmic signal transduction. Nature
438: 867–872
Gabev E, Kasianowicz J, Abbott T, McLaughlin S (1989) Binding of
neomycin to phosphatidylinositol 4,5-bisphosphate (PIP2).
Biochim Biophys Acta 979: 105–112
Grohmann A, Tanneberger K, Alzner A, Schneikert J, Behrens J
(2007) AMER1 regulates the distribution of the tumor suppressor
APC between microtubules and the plasma membrane. J Cell Sci
120: 3738–3747
Hadjihannas MV, Bruckner M, Jerchow B, Birchmeier W, Dietmaier
W, Behrens J (2006) Aberrant Wnt/beta-catenin signaling can
induce chromosomal instability in colon cancer. Proc Natl Acad
Sci USA 103: 10747–10752
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
The EMBO Journal &2011 European Molecular Biology Organization10
Henderson BR, Eleftheriou A (2000) A comparison of the activity,
sequence specificity, and CRM1-dependence of different nuclear
export signals. Exp Cell Res 256: 213–224
Huang H, He X (2008) Wnt/beta-catenin signalling: new (and old)
players and new insights. Curr Opin Cell Biol 20: 119–125
Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S, Kikuchi A
(1998) Axin, a negative regulator of the Wnt signalling pathway,
forms a complex with GSK-3beta and beta-catenin and
promotes GSK-3beta-dependent phosphorylation of beta-catenin.
EMBO J 17: 1371–1384
Jenkins ZA, van Kogelenberg M, Morgan T, Jeffs A, Fukuzawa R,
Pearl E, Thaller C, Hing AV, Porteous ME, Garcia-Minaur S,
Bohring A, Lacombe D, Stewart F, Fiskerstrand T, Bindoff L,
Berland S, Ades LC, Tchan M, David A, Wilson LC et al (2009)
Germline mutations in WTX cause a sclerosing skeletal dysplasia
but do not predispose to tumorigenesis. Nat Genet 41: 95–100
Kagan JC, Medzhitov R (2006) Phosphoinositide-mediated adaptor
recruitment controls Toll-like receptor signalling. Cell 125: 943–955
Kategaya LS, Changkakoty B, Biechele T, Conrad WH, Kaykas A,
Dasgupta R, Moon RT (2009) Bili inhibits Wnt/beta-catenin
signalling by regulating the recruitment of axin to LRP6. PLoS
One 4: e6129
Krieghoff E, Behrens J, Mayr B (2006) Nucleo-cytoplasmic distribution
of {beta}-catenin is regulated by retention. J Cell Sci 119:
1453–1463
Lustig B, Behrens J (2003) The Wnt signalling pathway and its role
in tumor development. J Cancer Res Clin Oncol 129: 199–221
Lustig B, Jerchow B, Sachs M, Weiler S, Pietsch T, Karsten U,
van de Wetering M, Clevers H, Schlag PM, Birchmeier W,
Behrens J (2002) Negative feedback loop of Wnt signaling
through upregulation of conductin/axin2 in colorectal and liver
tumors. Mol Cell Biol 22: 1184–1193
MacDonald BT, Tamai K, He X (2009) Wnt/beta-catenin signalling:
components, mechanisms, and diseases. Dev Cell 17: 9–26
MacDonald BT, Yokota C, Tamai K, Zeng X, He X (2008) Wnt signal
amplification via activity, cooperativity, and regulation of multiple
intracellular PPPSP motifs in the Wnt co-receptor LRP6. J Biol
Chem 283: 16115–16123
Major MB, Camp ND, Berndt JD, Yi X, Goldenberg SJ, Hubbert C,
Biechele TL, Gingras AC, Zheng N, Maccoss MJ, Angers S, Moon
RT (2007) Wilms tumor suppressor WTX negatively regulates
WNT/beta-catenin signaling. Science 316: 1043–1046
Mao J, Wang J, Liu B, Pan W, Farr III GH, Flynn C, Yuan H, Takada
S, Kimelman D, Li L, Wu D (2001) Low-density lipoprotein
receptor-related protein-5 binds to axin and regulates the canonical
Wnt signaling pathway. Mol Cell 7: 801–809
Pan W, Choi SC, Wang H, Qin Y, Volpicelli-Daley L, Swan L,
Lucast L, Khoo C, Zhang X, Li L, Abrams CS, Sokol SY, Wu D
(2008) Wnt3a-mediated formation of phosphatidylinositol 4,5-bisphosphate
regulates LRP6 phosphorylation. Science 321: 1350–1353
Piao S, Lee SH, Kim H, Yum S, Stamos JL, Xu Y, Lee SJ, Lee J, Oh S,
Han JK, Park BJ, Weis WI, Ha NC (2008) Direct inhibition of
GSK3beta by the phosphorylated cytoplasmic domain of LRP6 in
Wnt/beta-catenin signaling. PLoS One 3: e4046
Pilot F, Philippe JM, Lemmers C, Lecuit T (2006) Spatial control of
actin organization at adherens junctions by a synaptotagmin-like
protein Btsz. Nature 442: 580–584
Qin Y, Li L, Pan W, Wu D (2009) Regulation of phosphatidylinositol
kinases and metabolism by Wnt3a and Dvl. J Biol Chem 284:
22544–22548
Rivera MN, Kim WJ, Wells J, Driscoll DR, Brannigan BW, Han M,
Kim JC, Feinberg AP, Gerald WL, Vargas SO, Chin L, Iafrate AJ,
Bell DW, Haber DA (2007) An X chromosome gene, WTX, is
commonly inactivated in Wilms tumor. Science 315: 642–645
Schwarz-Romond T, Fiedler M, Shibata N, Butler PJ, Kikuchi A,
Higuchi Y, Bienz M (2007a) The DIX domain of dishevelled
confers Wnt signalling by dynamic polymerization. Nat Struct
Mol Biol 14: 484–492
Schwarz-Romond T, Merrifield C, Nichols BJ, Bienz M (2005) The
Wnt signalling effector dishevelled forms dynamic protein assemblies
rather than stable associations with cytoplasmic vesicles. J
Cell Sci 118: 5269–5277
Schwarz-Romond T, Metcalfe C, Bienz M (2007b) Dynamic recruitment
of axin by dishevelled protein assemblies. J Cell Sci 120:
2402–2412
Tamai K, Zeng X, Liu C, Zhang X, Harada Y, Chang Z, He X (2004) A
mechanism for Wnt coreceptor activation. Mol Cell 13: 149–156
Varnai P, Balla T (1998) Visualization of phosphoinositides that
bind pleckstrin homology domains: calcium- and agonist-induced
dynamic changes and relationship to myo-[3H]inositol-labeled
phosphoinositide pools. J Cell Biol 143: 501–510
Wu G, Huang H, Garcia Abreu J, He X (2009) Inhibition of GSK3
phosphorylation of beta-catenin via phosphorylated PPPSPXS
motifs of Wnt coreceptor LRP6. PLoS One 4: e4926
Zeng X, Huang H, Tamai K, Zhang X, Harada Y, Yokota C, Almeida
K, Wang J, Doble B, Woodgett J, Wynshaw-Boris A, Hsieh JC, He
X (2008) Initiation of Wnt signaling: control of Wnt coreceptor
Lrp6 phosphorylation/activation via frizzled, dishevelled and
axin functions. Development 135: 367–375
Zeng X, Tamai K, Doble B, Li S, Huang H, Habas R, Okamura H,
Woodgett J, He X (2005) A dual-kinase mechanism for Wnt
co-receptor phosphorylation and activation. Nature 438: 873–877
Amer1 regulates LRP6 phosphorylation
K Tanneberger et al
&2011 European Molecular Biology Organization The EMBO Journal 11
SUPPLEMENTARY INFORMATION
“Amer1/WTX couples Wnt-induced formation of PtdIns(4,5)P2 to
LRP6 phosphorylation”
Kristina Tanneberger, Astrid S. Pfister, Katharina Brauburger, Jean Schneikert,
Michel V. Hadjihannas, Vitezslav Kriz, Gunnar Schulte, Vitezslav Bryja and Jürgen
Behrens
SUPPLEMENTARY FIGURES
Supplementary Figure S1
(A, B) Amer1 is required for phosphorylation of endogenous LRP6 at Ser1490 and
Thr1479. Cells were transfected with the indicated siRNAs and incubated with Wnt3A
for 1 hour. Membrane fractions from HEK293T cells (A) and whole cell lysates from
SW480 cells (B) were analysed by Western blotting. (C) Overexpression of Amer1
promotes phosphorylation of endogenous LRP6 at Ser1490. HEK293T cells were
transfected with EGFP-Amer1 and treated with Wnt3A for 20 minutes. Membrane
fractions were analysed by Western blotting.
2
Supplementary Figure S2
(A) Sequence comparison of the two N-terminal PtdIns(4,5)P2 binding sites of Amer1
from different species and of Amer2 (Grohmann et al, 2007). Highly conserved basic
and aromatic residues are highlighted in red. Red boxes indicate lysine residues that
have been mutated to alanine in this study. (B) Phospholipid-binding assays of
Amer1 mutants. Membrane lipid strips were incubated with the indicated GST-Amer1
fusion proteins revealing a severely diminished ability of Amer1(7µLys) to bind to
phosphatidylinositol lipids. The Coomassie staining below shows relative amounts of
purified proteins used. (C) Fluorescence micrographs of MCF-7 cells transfected with
EGFP-tagged Amer1 constructs as indicated above the panels. Scale bar is 20 µm.
3
Supplementary Figure S3
(A) Schematic representation of Amer1 splice variants Amer1-S1 and Amer1-S2
(Jenkins et al, 2009). In Amer1-S2 amino acids 50-326 are deleted in frame. The
localization of target sequences of Amer1 siRNAs is depicted. siAmer1a targets both
Amer1 splice variants while siAmer1-S1 and siAmer1-S2 specifically target Amer1-S1
and Amer1-S2, respectively. The two N-terminal membrane localization domains
(M1, M2) are highlighted by light grey and the three APC interaction domains (A1-3)
by dark grey shading (Grohmann et al, 2007). (B) Fluorescence micrographs of
MCF-7 cells transfected with EGFP-tagged Amer1 splice variants as indicated above
the panels. Scale bar is 20 µm. (C) Effect of Amer1 splice variants on LRP6
phosphorylation when overexpressed in HEK293T cells stably expressing VSVGLRP6.
(D) Specific knockdown of Amer1 splice variants after transient transfection of
Flag-tagged Amer1 together with the indicated siRNAs into HEK293T cells.
4
Supplementary Figure S4
Knockdown of PI4KIIα prevents Wnt-induced plasma membrane recruitment of
Amer1. HEK293T cells were transfected with two different siRNAs, incubated with
Wnt3A for 1 hour and membrane fractions were analysed by Western blotting. AntiPan-Cadherin
Western blot is shown as loading control for membrane fractions.
5
Supplementary Figure S5
(A) Co-immunoprecipitation of endogenous Axin and Amer1 from lysates of SW480
cells. Immunoprecipitations were performed with mouse anti-Amer1 or control IgG
antibodies. (B, C) Amer1 leads to plasma membrane recruitment of endogenous Axin
(B) or Conductin (C). Amer1 mutants Amer1(7µLys) and NES-Amer1(7µLys), which
are defective in membrane localization, are not able to recruit Axin/Conductin. (B)
HEK293T cells were transfected with the indicated EGFP-Amer1 constructs and
membrane fractions were analysed by Western blotting. VSVG-LRP6 stably
expressed in these cells is shown as loading control for membrane fractions. (C)
Double staining of EGFP-tagged Amer1 and the indicated Amer1 mutants (left
panels, GFP fluorescence) and Conductin (middle panels, anti-Conductin
immunofluorescence) in SW480 cells. Scale bar is 20 µm.
6
Supplementary Figure S6
(A, B) Co-immunoprecipitation of Flag-tagged Axin (A) or Conductin (B) with EGFPtagged
Amer1 or Amer1 deletion mutants after immunoprecipitation with anti-GFP
antibodies in HEK293T cells. (C) Schematic representation of Amer1 deletion
mutants and their ability to bind to the indicated interaction partners. For the Amer1
scheme see Supplementary Figure S3A.
7
Supplementary Figure S7
8
(A) Structure of the LRP6 intracellular domain highlighting the five PPPSPxS motifs
(labelled A-E) and adjacent Ser/Thr clusters, which are represented by the grey and
red boxes, respectively. The sequence of PPPSPxS motif A and the two flanking CK1
clusters (cluster 1 and 2) is shown above. Red amino acids represent CK1
phosphorylation sites. Residues Thr1479 and Ser1490 detected by phospho-specific
antibodies are indicated. Schematic representation of LRP6 deletion mutants and
their ability to bind to Amer1 as shown in (B) is indicated. LRP6 mutants have been
described in Davidson et al, 2005. Scheme adapted from Davidson et al, 2009. (B)
Co-immunoprecipitation of Flag-tagged LRP6 mutants as detailed in (A) with EGFPtagged
Amer1 after immunoprecipitation with anti-GFP antibodies in HEK293T cells.
(C) Overexpression of Axin does not promote the interaction between Amer1 and
LRP6. HEK293T cells stably expressing VSVG-LRP6 were transfected with FlagAmer1
with or without YFP-Axin and anti-Flag immunprecipitations were performed.
Supplementary Figure S8
(A, B) Amer1 interacts with CK1γ. (A) Flag-Amer1 co-immunoprecipitated with EYFPCK1γ,
but not with a CK1γ mutant lacking the C-terminal membrane association motif
(EYFP-CK1γΔC). (B) Co-immunoprecipitation of Flag-CK1γ with EGFP-Amer1 after
immunoprecipitation with anti-GFP antibodies in HEK293T cells.
9
Supplementary Figure S9
Fluorescence micrographs of MCF-7 cells expressing the indicated EGFP-tagged
fusion constructs. For the Amer1 scheme see Supplementary Figure S3A. Scale bar
is 20 µm.
Supplementary Figure S10
Knockdown of APC does not affect LRP6 phosphorylation at Ser1490. HEK293 cells
stably expressing either an APC shRNA (293iAPC) or control shRNA (293control)
(Schneikert and Behrens, 2006) were incubated with Wnt3A for 1 hour. Membrane
fractions (M) and whole cell lysates (WCL) were analysed by Western blotting.
10
Supplementary Figure S11
Overexpression of Amer1 represses a TCF/β-catenin dependent transcriptional
reporter. HEK293T cells stably expressing a β-catenin responsive firefly luciferase
(Major et al, 2007) were transfected with RFP-Wnt3A, RFP-daLRP6 and EGFPAmer1
as indicated. Fold changes of luciferase activity are presented relative to
control transfected cell. Error bars indicate standard deviations.
11
SUPPLEMENTARY MATERIALS AND METHODS
Cell culture and transfection
All cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM)
supplemented with 10% fetal calf serum (FCS) and 1% penicillin/streptomycin (PAA
Laboratories, Pasching, Austria) at 37°C in a humidified atmosphere of 10% CO2.
Plasmid transfections were performed using either polyethylenimin (Sigma) for
HEK293T and SW480 cells or TransIT-TKO (Mirus, Madison, WI, USA) for MCF-7
cells. siRNAs were transfected using Oligofectamine (Invitrogen) according to the
manufacturer’s instructions.
Plasmids and siRNAs
The following plasmids have been described previously: pEGFP-Amer1, pcDNAFlag-Amer1
(Grohmann et al, 2007); mRFP-daLRP6, mRFP-Wnt3A, mYFP-Axin,
mYFP-Conductin, mCFP-Axin, mCFP-Conductin, mCFP-Dvl2 (Krieghoff et al, 2006);
pcDNA3.1-Flag, pcDNA-Flag-Conductin, GSK3β (Behrens et al, 1998). LRP6-EYFP,
Fz8-EYFP, MESD, EYFP-CK1γ, EYFP-CK1γΔC, Flag-LRP6ΔE(1-4), FlagLRP6ΔE(1-4)Δ87,
Flag-LRP6ΔE(1-4)Δ127, Flag-LRP6ΔE(1-4)Δ162 and FlagLDLRΔN-miniC
were kindly provided by C. Niehrs, VSVG-LRP6, VSVG-LRP6m10
and pcDNA-Flag-Axin L396Q by X. He and pcDNA-Flag-Axin by A. Kikuchi. Deletion
mutants of Amer1 were generated by restriction digests or PCR amplification. The
sequences of the siRNA oligonucleotides are: siGFP, 5’-GCTACCTGTTCCATGGCCA-3’;
siLuc, 5’-CTTACGCTGAGTACTTCGA-3’; siAmer1a, 5’-GGGAGTACCCGTGAACAAA-3’;
siAmer1b, 5’-CCTCTATGCCCAAGCCAAA-3’; siAmer1-S1, 5’-
12
CCACCAGCTACTGAGAAAA-3’; siAmer1-S2, 5’-GGCCCAGGTTGTGGTGACA-3’;
siPI4KIIα, 5’-GGATCATTGCTGTCTTCAA-3’ (Pan et al, 2008); siPI4KIIα-2, 5’GGAAGAGGACCTATATGAA-3’
(Pan et al, 2008). All siRNA oligonucleotides were
purchased from Eurogentec.
Preparation of protein lysates, immunoprecipitation and Western blotting
For cytoplasmic or whole cell lysates cells were lysed for 10 minutes at 4°C in
hypotonic buffer (25 mM Tris-HCl, pH 8, 1 mM EDTA, 10 mM NaF, 1 mM DTT and
1 mM PMSF) or Triton-X-100 buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM
EDTA, 1% Triton X-100, 10 mM NaF, 1 mM DTT and 1 mM PMSF), respectively.
Lysates were cleared at 16,000 g for 10 minutes. For immunoprecipitation, lysates
were incubated for 4 hours at 4°C with the appropriate antibody and Protein A/G
PLUS agarose beads (Santa Cruz Biotechnology Inc.) or with Anti-FLAG M2 affinity
gel beads (Sigma). Immunoprecipitates were collected, washed four times with low
salt NET buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 5 mM EDTA, 1% Triton-X-100,
10 mM NaF) and eluted with SDS sample buffer. For Western blotting (Lustig et al,
2002) proteins were visualized with a luminoimager (LAS-3000, Fuji) using Enhanced
Chemiluminescence reagent (Perkin Elmer) and quantified using the AIDA image
analyser software v. 3.52 (Raytest, Straubenhardt, Germany).
Antibodies
The mouse monoclonal antibody against Conductin has been described before
(Lustig et al, 2002). Rabbit anti-pT1479 and rabbit anti-PI4KIIα were kindly provided
by C. Niehrs and P. De Camilli, respectively. Commercial antibodies were obtained
from Abcam (mouse anti-LRP6 (1C10)), Cell Signaling (rabbit anti-Axin1 (C76H11),
rabbit anti-GSK3β (27C10), rabbit anti-LRP6 (C5C7), rabbit anti-pLRP6 (Ser1490)),
13
R&D Systems (sheep anti-CK1γ), Roche (mouse anti-GFP, mixture of clones 7.1 and
13.1), Santa Cruz Biotechnology Inc. (rabbit anti-β-catenin (H102)), Serotec (rat antiα-tubulin,
clone YL1/2) and Sigma (rabbit anti-Flag, mouse anti-Flag, mouse
anti-GST, rabbit anti-Pan-Cadherin). Secondary antibodies coupled to horseradish
peroxidase or Cy3 were purchased from Jackson ImmunoResearch.
RT-PCR
Total cellular RNA was isolated with the RNeasy mini kit (Qiagen) and possible
genomic contaminations were removed by treatment with DNase I. Single stranded
cDNA was synthesized from 1 µg total cellular RNA using the AffinityScript QPCR
cDNA Synthesis Kit (Stratagene) according to the manufacturer’s instructions.
14
SUPPLEMENTARY REFERENCES
Behrens J, Jerchow BA, Wurtele M, Grimm J, Asbrand C, Wirtz R, Kuhl M, Wedlich D
Birchmeier W (1998) Functional interaction of an axin homolog, conductin,
with beta-catenin, APC, and GSK3beta. Science 280: 596-599
Davidson G, Shen J, Huang YL, Su Y, Karaulanov E, Bartscherer K, Hassler C,
Stannek P, Boutros M, Niehrs C (2009) Cell cycle control of wnt receptor
activation. Dev Cell 17: 788-799
Davidson G, Wu W, Shen J, Bilic J, Fenger U, Stannek P, Glinka A, Niehrs C (2005)
Casein kinase 1 gamma couples Wnt receptor activation to cytoplasmic signal
transduction. Nature 438: 867-872
Grohmann A, Tanneberger K, Alzner A, Schneikert J, Behrens J (2007) AMER1
regulates the distribution of the tumor suppressor APC between microtubules
and the plasma membrane. J Cell Sci 120: 3738-3747
Jenkins ZA, van Kogelenberg M, Morgan T, Jeffs A, Fukuzawa R, Pearl E, Thaller C,
Hing AV, Porteous ME, Garcia-Minaur S, Bohring A, Lacombe D, Stewart F,
Fiskerstrand T, Bindoff L, Berland S, Ades LC, Tchan M, David A, Wilson LC
et al (2009) Germline mutations in WTX cause a sclerosing skeletal dysplasia
but do not predispose to tumorigenesis. Nat Genet 41: 95-100
Krieghoff E, Behrens J, Mayr B (2006) Nucleo-cytoplasmic distribution of {beta}catenin
is regulated by retention. J Cell Sci 119: 1453-1463
Lustig B, Jerchow B, Sachs M, Weiler S, Pietsch T, Karsten U, van de Wetering M,
Clevers H, Schlag PM, Birchmeier W, Behrens J (2002) Negative feedback
loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and
liver tumors. Mol Cell Biol 22: 1184-1193
Major MB, Camp ND, Berndt JD, Yi X, Goldenberg SJ, Hubbert C, Biechele TL,
Gingras AC, Zheng N, Maccoss MJ, Angers S, Moon RT (2007) Wilms tumor
suppressor WTX negatively regulates WNT/beta-catenin signaling. Science
316: 1043-1046
Pan W, Choi SC, Wang H, Qin Y, Volpicelli-Daley L, Swan L, Lucast L, Khoo C,
Zhang X, Li L, Abrams CS, Sokol SY, Wu D (2008) Wnt3a-mediated formation
of phosphatidylinositol 4,5-bisphosphate regulates LRP6 phosphorylation.
Science 321: 1350-1353
Schneikert J, Behrens J (2006) Truncated APC is required for cell proliferation and
DNA replication. Int J Cancer 119: 74-79
15
Vítězslav Bryja, 2014    Attachments 
 
 
#12 
 
 
Bernatik  O,  Sri  Ganji  R,  Cervenka  I,  Polonio  T,  Schulte  G,  Bryja  V  (2011):  Sequential 
activation  and  inactivation  of  Dishevelled  in  the  Wnt/‐catenin  pathway  by  casein 
kinases. J. Biol. Chemistry 286: 10396‐10410. 
 
 
Impact factor (2011): 4.773 
Times cited (without autocitations, WoS, Feb 21st 2014): 12 
Significance:  This  detailed  analysis  for  the  first  time  rigorously  described  the  role  of 
individual Dvl domains in several independent phenotypes associated with CK1‐
controlled phosphorylation. Surprisingly, this analysis lead to discovery of distinct 
processes  controlled  by  CK1  and  identified  intrinsic  negative  feedback  loop 
controlled by CK1. 
Contibution of the author/author´s team: Completely performed in my lab with the 
exception of FRET assays. 
 
 
   
 
 
 
Sequential Activation and Inactivation of Dishevelled in the
Wnt/␤-Catenin Pathway by Casein Kinases□S
Received for publication,July 29, 2010, and in revised form, January 7, 2011 Published, JBC Papers in Press,February 1, 2011, DOI 10.1074/jbc.M110.169870
Ondrej Bernatik‡
, Ranjani Sri Ganji‡
, Jacomijn P. Dijksterhuis§
, Peter Konik¶
, Igor Cervenka‡
, Tilman Polonio§1
,
Pavel Krejci‡ʈ
**2
, Gunnar Schulte§3
, and Vitezslav Bryja‡ʈ4
From the ‡
Institute of Experimental Biology, Masaryk University, 61137 Brno, Czech Republic, the §
Section of Receptor Biology and
Signaling, Department of Physiology and Pharmacology, Karolinska Institutet, SE-171 77 Stockholm, Sweden, ¶
Faculty of Science,
University of South Bohemia, 37005 Ceske Budejovice, Czech Republic, the ʈ
Department of Cytokinetics, Institute of Biophysics
ASCR, 61265 Brno, Czech Republic, and **Medical Genetics Institute, Cedars-Sinai Medical Center, Los Angeles, California 90048
Dishevelled (Dvl) is a key component in the Wnt/␤-catenin
signaling pathway. Dvl can multimerize to form dynamic protein
aggregates, which are required for the activation of downstream
signaling. Upon pathway activation by Wnts, Dvl
becomes phosphorylated to yield phosphorylated and shifted
(PS) Dvl. Both activation of Dvl in Wnt/␤-catenin signaling and
Wnt-induced PS-Dvl formation are dependent on casein kinase
1 (CK1) ␦/⑀ activity. However, the overexpression of CK1 was
shown to dissolve Dvl aggregates, and endogenous PS-Dvl forms
irrespectiveofwhetherornottheactivatingWnttriggerstheWnt/
␤-catenin pathway. Using a combination of gain-of-function, lossof-function,
and domain mapping approaches, we attempted to
solve this discrepancy regarding the role of CK1⑀ in Dvl biology.
We analyzed mutual interaction of CK1␦/⑀ and two other Dvl
kinases, CK2 and PAR1, in the Wnt/␤-catenin pathway. We show
that CK2 acts as a constitutive kinase whose activity is required for
the further action of CK1⑀. Furthermore, we demonstrate that the
two consequences of CK1⑀ phosphorylation are separated both
spatially and functionally; first, CK1⑀-mediated induction of TCF/
LEF-driven transcription (associated with dynamic recruitment of
Axin1) is mediated via a PDZ-proline-rich region of Dvl. Second,
CK1⑀-mediated formation of PS-Dvl is mediated by the Dvl3 C
terminus.Furthermore,wedemonstratewithseveralmethodsthat
PS-Dvl has decreased ability to polymerize with other Dvls and
could, thus, act as the inactive signaling intermediate. We propose
a multistep and multikinase model for Dvl activation in the Wnt/
␤-catenin pathway that uncovers a built-in de-activation mechanism
that is triggered by activating phosphorylation of Dvl by
CK1␦/⑀.
The Wnt signaling pathway is a well conserved signaling
pathway necessary during embryonic development whose dysregulation
in adult tissues is linked to cancer (1, 2). Wnts are
secreted glycoproteins that can activate several downstream
cascades including the Wnt/␤-catenin (canonical) pathway and
other (noncanonical) pathways. These noncanonical pathways
include planar cell polarity, the Wnt/Ca2ϩ
pathway, and other
less-defined signaling cascades. The Wnt/␤-catenin pathway
initiates with the binding of Wnt to its receptor Frizzled (3) and
the co-receptor LRP5/6. Upon LRP5/6 phosphorylation, the
complex of Frizzled and LRP5/6 recruits Axin to the cell membrane.
The ␤-catenin destruction complex, composed of Axin,
adenomatosis polyposis coli, and glycogen synthase kinase 3␤,
is subsequently disrupted. ␤-Catenin accumulates and is then
translocated to the nucleus where it binds to the TCF55
/LEF
family of transcription factors. The binding of ␤-catenin to
TCF/LEF removes transcriptional repressors such as Groucho
and initiates the transcription of TCF/LEF target genes (1, 4).
The cytoplasmic protein Dishevelled (Dvl; Dvl1, Dvl2, Dvl3
in mammalian cells) is critically required for Wnt/␤-catenin
signal transduction. Dvl acts as a scaffolding protein, which
interacts with many proteins and serves as a key signaling intermediate
between the WNT receptor Frizzled and downstream
components in the Wnt/␤-catenin and non-canonical Wnt
pathways (5–8). The current model of Wnt/␤-catenin signal
transduction proposes Dvl as a core protein of dynamic protein
assemblies called signalosomes (9). The signalosome hypothesis
proposes that upon stimulation of the Wnt pathway, Dvl
protein multimerizes via its DIX domains and forms a platform
that recruits other proteins including Axin and that is required
for the phosphorylation of LRP6 (9–11). When Dvl is overexpressed
in mammalian cells, it is present in dynamic protein
aggregates and is visible as Dvl punctae, which most likely represents
Dvl multimers (12, 13). Although Dvl multimerization
has yet to be convincingly demonstrated at the endogenous
level, it is clear that endogenous Dvl becomes phosphorylated
after the addition of Wnt. Wnt-induced activation of Dvl is
visible as a Wnt-induced shift in the electrophoretic mobility of
all three Dvl isoforms, forming the so called phosphorylated
□S
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Figs. 1–6.
1
Present address: Cellular Senescence Group, German Cancer Research Center
(DKFZ), Im Neuenheimer Feld 242, 69120 Heidelberg, Germany.
2
Supported by Czech Science Foundation Grant 301/09/0587.
3
Supported by Knut and Alice Wallenberg Foundation Grant KAW2008.0149,
Swedish Research Council Grants K2008-68P-20810-01-4 and K2008-68X-
20805-01-4, Swedish Cancer Society Grant CAN 2008/539, and The Swedish
Foundation for International Cooperation in Research and Higher Education
(STINT).
4
Supported by Ministry of Education, Youth, and Sports of the Czech Republic
Grant MSM0021622430, Academy of Sciences of the Czech Republic
Grants KJB501630801, AVOZ50040507, and AVOZ50040702, Czech Science
Foundation Grants 204/09/H058, 204/09/0498, and 204/09/J030,
and an EMBO Installation grant. To whom correspondence should be
addressed: Institute of Experimental Biology, Faculty of Science, Masaryk
University, Kotlarska 2, 61137 Brno, Czech Republic. Tel.: 420-549493291;
Fax: 420-541211214; E-mail: bryja@sci.muni.cz.
5
The abbreviations used are: TCF, T-cell-specific transcription factor; PS,
phosphorylated and shifted; CK1, casein kinase 1; MEF, mouse embryonal
fibroblast; rm, recombinant mouse; x, Xenopus; Dvl, Dishevelled; LEF,
lymphoid enhancer binding factor; TBCA, (E)-3-(2,3,4,5-tetrabromophenyl)acrylic
acid; TBBt, tetrabromobenzotriazole; aa, amino acids.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 12, pp. 10396–10410, March 25, 2011
© 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
10396 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
http://www.jbc.org/content/suppl/2011/02/01/M110.169870.DC1.html
Supplemental Material can be found at:
and shifted (PS) Dvl (14–16). It has been clearly demonstrated
that both the activation of Dvl in the Wnt/␤-catenin pathway
(17–21) and Wnt-induced PS-Dvl formation are dependent on
casein kinase 1 (CK1) ␦/⑀ activity (14, 16). It is, thus, conceivable
that CK1␦/⑀ phosphorylation of Dvl promotes the formation of
signalosomes/Dvl aggregates, which is unique for the Wnt/␤catenin
pathway. However, these predictions have not been
supported by experimental data. First, overexpression of CK1
dissolved (and not promoted) Dvl aggregates in all tested cell
types (14, 20, 22). Second, endogenous PS-Dvl formed irrespective
of whether or not the activating Wnt triggered the Wnt/␤catenin
pathway (14, 15, 23).
In the present study we attempted to solve this obvious
conundrum in our current understanding of the role of CK1⑀ in
Dvl biology. We analyzed the mutual interaction of CK1␦/⑀,
and two other Dvl kinases, CK2 and PAR1, in the Wnt/␤catenin
pathway. Using a combination of gain-of-function,
loss-of-function, and domain mapping approaches, we proposed
a multistep and multikinase model for Dvl activation in
the Wnt/␤-catenin pathway. This approach uncovered a
built-in negative feedback loop triggered after activating phosphorylation
of Dvl by CK1␦/⑀.
MATERIALS AND METHODS
Cell Culture, Transfection, and Treatments—WT mouse
embryonal fibroblasts (MEFs) and HEK-293T cells were propagated
in DMEM, 10% FCS, 2 mM L-glutamine, 50 units/ml
penicillin, and 50 units/ml streptomycin. Cells (40,000–60,000
per well) were seeded in 24-well plates either directly (for biochemical
analysis) or on sterile coverslips (for microscopy). The
next day cells were transfected using polyethyleneimine in a
stoichiometry of 2.5 ␮l per 1 ␮g of DNA. Cells were harvested
for immunoblotting or immunocytochemistry 24 h after transfection.
The following plasmids have been described previously:
Dvl2-Myc (42), ca-␤-catenin (43), FLAG-Dvl3 deletion constructs
(32), Xenopus (x) Dsh and xPAR1 constructs (25), xCK2
constructs (44), xCK1⑀ constructs (45), GST-DSH (36), and
FLAG-Dvl1 (46). Treatment with the D4476, IC261, TBBt, or
TBCA (Calbiochem) dissolved in DMSO was done in 24-well
plates in the presence of 1 ␮l per well FuGENE 6 reagent to
increase cell penetration. For analysis of cellular signaling, the
cells were stimulated with mouse Wnt-3a or -5a (R&D Systems,
Minneapolis, MN) for 2 h if not otherwise stated. Control stimulations
were done with 0.1% BSA in PBS.
RNA Interference—MEF or HEK-293T cells were transfected
with siRNA using neofection according to the manufacturer’s
instructions (Ambion). In brief, siRNAs (0.55 ␮l of 20 ␮M
siRNA) were mixed with Lipofectamine 2000 (1.45 ␮l; Invitrogen)
and Opti-MEM (48 ␮l; Invitrogen) and incubated for 20
min at room temperature. The transfection mixture (50 ␮l) was
added to the 24-well plate and mixed with a suspension of
freshly trypsinized cells (25,000 cells/well in 350 ␮l of complete
media) resulting in a final concentration of 30 nM siRNA. When
a combination of two different siRNAs was used, each siRNA
was used at 30 nM, and the control siRNA was at 60 nM. The
transfection was terminated after 5 h by changing the culture
media. Cells were then treated with Wnt-3a or -5a inhibitors or
transfected according to the scheme used. The used siRNAs
were from Ambion (mCK1⑀ catalog no. 188528, mCK1␦ catalog
no. 88388) and from Santa Cruz Biotechnology (hCK1⑀ sc
29914, hCK1␦ sc 29910, hCK2␣ sc-29918, mCK2␣ sc-29919,
control siRNA sc-37007).
Dual-Luciferase Assay, Western Blotting, Solubility Assay,
Dephosphorylation Assay, and Immunoprecipitation—For the
luciferase reporter assay, cells were transfected with 0.1 ␮g of
Super8X TopFlash construct and 0.1 ␮g of Renilla luciferase
construct per well in a 24-well plate 24 h after seeding. For the
TopFlash assay, a Promega Dual-Luciferase assay kit was used
according to the manufacturer’s instructions. Relative luciferase
units were measured on a MLX luminometer (Dynex Technologies)
and normalized to the Renilla luciferase expression
24 h post-transfection. Results were shown as the means with
S.D. of at least three independent experiments.
Immunoblotting and sample preparations were performed
as previously described (14). For solubility assays, cells were
seeded out on 12-well plates and transfected according to
the scheme. Twenty-four hours post-transfection, cells were
scraped into 200 ␮l of buffer containing 50 mM Tris, pH 8.5, 150
mM NaCl, 1 mM MgCl2, and protease inhibitors (Roche Applied
Science, 11836145001) at 4 °C, and lysis was carried out for 15
min. Cells were then subjected to three freeze/thaw cycles. The
lysates were centrifuged at 16,100 ϫ g, and the supernatant was
collected. The pellet was then resuspended in 200 ␮l of lysis
buffer. Both supernatant and pellet were prepared for Western
blotting by adding 40 ␮l of 5ϫ Laemmli buffer, sonicated, and
boiled at 95 °C for 5 min. The antibodies used include phosphoLRP6
(Ser-1490, #2568), Dvl3 (#3218), Dvl2 (#3224), Axin1
(#2087) from Cell Signaling Technologies, actin (C-11,
sc-1615), Dvl3 (sc-8027), Dvl2 (sc-8026), CK1⑀ (sc-6471), and
Myc (sc-40) from Santa Cruz Biotechnology, CK2␣ (#611610)
from BD Transduction Laboratories, and FLAG M2 (F1804)
from Sigma.
For dephosphorylation assay cells were washed with buffer
containing 100 mM Tris, pH 8.5, 150 mM NaCl, 0.2 mM EDTA.
Then they were scraped into dephosphorylation buffer containing
50 mM Tris, pH 8.5, 150 mM NaCl, 1 mM MgCl2, and
protease inhibitors (Roche Applied Science, 11836145001).
Cells were lysed by a 22-gauge needle and then spun down at
16,100 ϫ g. Supernatant was divided into two parts. The pellet
was resuspended in dephosphorylation buffer and also divided
into two parts. One part of the supernatant and pellet was
treated for 1 h by 80 units of alkaline phosphatase (Sigma
P8361). 5ϫ Laemmli buffer was added to each sample, and samples
were sonicated and boiled for 5 min.
Immunoprecipitation was performed as previously described
(22). The antibodies used for immunoprecipitation
were anti-FLAG (F1804; Sigma), anti-CK1⑀ (sc-6471), antiDvl3
(sc-8027), anti-Dvl2 (sc-8026), and mouse IgG (sc-2025)
(all Santa Cruz Biotechnology).
GST Pulldown Assay—Production of recombinant GST-Dsh
(36) was induced by adding 0.2 mM isopropyl 1-thio-␤-D-galactopyranoside
and grown for 4 h at 37 °C. The bacteria were spun
down at 4000 ϫ g at 4 °C for 10 min, and the pellet was resuspended
in 10 ml of GST lysis buffer (50 mM Tris-Cl, pH 7.5, 150
mM NaCl, 5 mM MgCl2, protease inhibitors (Roche Applied
Science)) and stored at Ϫ80 °C. Then the solution was thawed,
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10397
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
sonicated 3 ϫ 30 s, and spun down 15,000 ϫ g at 4 °C for 15 min,
and the supernatant was then used for incubation with GST
beads for 2 h on the rotator (100 ␮l of beads per 100 ml of
original bacterial culture). After incubation beads were washed
3 times with 1 ml of GST lysis buffer and frozen at Ϫ80 °C as
25% slurry in GST lysis buffer ϩ 20% glycerol.
HEK-293T cells were transfected according to the scheme,
grown for 24 or 48 h, and lysed in 0.5% Nonidet P-40 lysis buffer
(0.5% Nonidet P-40, 50 mM Tris, pH 7.4, 1 mM EDTA, 150 mM
NaCl) with added protease inhibitors (Roche Applied Science),
phosphatase inhibitors (Calbiochem), and 10 mM N-ethylmaleimide
(Sigma). The lysate was spun down at 16,100 ϫ g at 4 °C
for 10 min, and the supernatant was used for overnight incubation
with 15 ␮l of solid GST beads containing GST recombinant
proteins on the rotator. After the incubation samples were
washed with 800 ␮l of 0.5% Nonidet P-40 lysis buffer, the GST
beads were collected at 0.1 ϫ g at 4 °C for 1 min, the supernatant
was aspirated; this washing was repeated 6 times. Proteins were
eluted with 45 ␮l of 2ϫ Laemmli buffer.
Immunocytochemistry—HEK-293 cells were seeded at ϳ2 ϫ
105
cells/well on collagen-coated coverslips in 24-well plates.
Cells were then transfected the next day, and 24 h later they
were fixed in fresh 4% paraformaldehyde, permeabilized with
0.05% Triton X-100, blocked with 3% BSA, 0,25% Triton, 0. 01%
NaN3 for 1 h, and incubated overnight with primary antibodies.
The next day coverslips were washed in PBS and incubated with
secondary antibodies Cy2 and Cy3 (Jackson ImmunoResearch),
washed with PBS, stained with DAPI (1:5000), and mounted on
coverslips. Cells were visualized using a Zeiss LSM 710 confocal
microscope. Two hundred positive cells per coverslip were analyzed
and scored as described previously (14). Graphs show
percentages of individual localization patterns.
Fo¨rster Resonance Electron Transfer (FRET)—HEK-293 cells
were seeded in a 24-well plate on sterile glass coverslips and
grown overnight (62,500 cells per well). Cells were transfected
with 0.1 ␮g of Dvl2-GFP, 0.1 ␮g of FLAG-Dvl3, and either 0.25
␮g of pcDNA 3.1 or CK1⑀ using the calcium phosphate method.
The next day, cells were fixed in 4% paraformaldehyde in PBS
for 15 min. Indirect immunostaining was done after blocking
using anti-FLAG M2 (Sigma, catalogue no. F1804) and donkey
anti-mouse Cy3-conjugated secondary antibody (Jackson
ImmunoResearch). To control for co-transfection efficiency of
Dvl isoforms and CK1⑀, separate samples were also stained for
CK1⑀ (Santa Cruz, catalogue no. sc-6471) and donkey anti-goat
Cy-5-conjugated secondary antibody. Glass coverslips were
mounted on microscopy slides using glycerol gelatin (Sigma).
FRET between Dvl2-GFP and FLAG-Dvl3-Cy3 was performed
on a Zeiss LSM710 confocal microscope and determined by
photo acceptor bleaching employing 100% laser power of 561
nm diode laser for 20 s. Signal intensity was routinely reduced
by 80–90%. Images were acquired before and after photo
bleaching with excitation/emission range 488/493–545 nm
(GFP) and 561/562–681 nm (Cy3). Quantification of GFP
emission pre- and post-bleaching was determined with region
of interest analysis in at least 15 individual cells per experiment
and condition, employing the ZEN 2009 software from
ZEISS. Data were normalized to the GFP intensity before
bleaching. For statistical analysis, Student’s t test was
performed.
Mass Spectrometry (MS/MS) Analysis—Protein pellets from
MEF cells (5 ϫ 15-cm-diameter confluent plates/sample) were
stored at Ϫ80 °C until analysis. After thawing they were immunoprecipitated
using 5 ␮g of anti-Dvl2 (sc-8026, Santa Cruz
Biotechnology) and anti-Dvl3 (sc-8027, Santa Cruz Biotechnology)
antibodies. Proteomic grade trypsin (Sigma) was added at
a concentration of 100 ng/␮l per sample. For label-free quantitative
analysis, yeast alcohol dehydrogenase (Sigma) was added
as a standard protein, with final concentrations of 50 fmol/␮l
per sample. After adding trypsin, samples were incubated at
37 °C for 12 h. Digested peptides were desalted using ZipTip
C18 pipette tips (Millipore Corp.) according to the manufacturer’s
protocol. MS analysis was performed on a NanoAcquity
UPLC (Waters) on-line coupled to an electrospray ionization
Q-Tof Premier (Waters) mass spectrometer. 1 ␮l of sample
was diluted in water and loaded onto a 180-␮m ϫ 20-mm
nanoAcquity UPLC Symmetry trap column (Waters) packed
with 5-␮m BEH C-18 beads. After 1 min of trapping, peptides
were eluted through a 75-␮m ϫ 150-mm nanoAcquity
(Waters) analytical column packed with 1.7-␮m BEH C-18
beads at a flow rate of 400 nl/min using a gradient of 3–40%
acetonitrile with 0.1% formic acid for 35 min at a temperature of
35 °C. Effluent was directly fed into the electrospray ionization
source of the mass spectrometer. Raw data were acquired in
data independent MSE
Identity (Waters) mode. Precursor ion
spectra were acquired with collision energy of 5 V, and fragment
ion spectra were acquired with collision energy of
20–35-V ramp in alternating 1-s scans. Peptide spectra and
fragment spectra were acquired with 2 and 5 ppm tolerance,
respectively. Raw data were then subjected to a data base search
using species specific Uniprot and NCBI mouse protein data
base by the PLGS2.3 software (Waters). Acetyl N-terminal,
deamidation N and Q, carbamidomethyl C, and oxidation M
were set as variable modifications. Identification of three consecutive
y- or b-ions was required for a positive peptide match.
Protein quantification is based on peak intensities of at least
three positively identified peptides belonging to one protein
compared with peak intensities of the standard protein (Dvl2).
Quantitative analysis was performed by the PLGS2.3 software
(Waters).
RESULTS
CK2␣, PAR1, and CK1⑀ Promote Dvl-dependent Wnt/
␤-Catenin Signaling via Distinct Mechanisms—Three Dvl
kinases, CK1⑀, CK2␣, and PAR1, have been previously shown to
play a positive role in Wnt/␤-catenin signaling (17, 24, 25). We
addressed the question of the interplay between these three
kinases and Dvl by coexpressing them alone (as wild type or
kinase inactive variants) or in combination with FLAG-Dvl3 in
HEK-293 cells. For CK2 overexpression, we co-expressed both
kinase subunits (CK2␣ and CK2␤) if not mentioned otherwise.
We used TCF/LEF reporter (TopFlash) (26) activity and electrophoretic
migration of FLAG-Dvl3 as a readout (Fig. 1).
FLAG-Dvl3 can be detected on Western blot as two bands that
we call Dvl and P (phosphorylated)-Dvl. Only CK1⑀, but not
CK2 or PAR-1, was able to promote the formation of novel,
Casein Kinases in Dishevelled Biology
10398 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
-
w
t
8S/TA
-
w
t
8S/TA
0
1
2
3
***
CK2/PAR1
XDsh
TopFLASHfoldinduction
FLAG
CK1ε
CK2α
Myc
- + - - + + + + + + + + + + +
- - wt KI wt KI wt
KI
wt wt wtwt KI KI KI KI
- - - - - - - wt KI - - wt KI - -
- - - - - - - - wt KI - - wt KI
FLAG
CK1ε
CK2α
PAR1 myc
0
1
2
3
4
*
TopFLASHfoldinduction
-
w
t
8S/TA
-
w
t
8S/TA
0
2
4
6
8
10
ns
CK1εε
XDsh
TopFLASHfoldinduction
FLAG
CK1ε
CK2α
Myc
- + - - + + + + + + + + + + +
- - wt KI wt KI wt
KI
wt wtwt wt KI KI KI KI
- - - - - - - wt KI - - wt KI - -
- - - - - - - - wt KI - - wt KI
FLAG
CK2α
CK1ε
PAR1 myc
0.0
0.5
1.0
1.5
2.0
2.5
*
TopFLASHfoldinduction
FLAG
CK1ε
CK2α
Myc
- + - - + + + + + + + + + + +
- - wt KI wt KI wt
KI
wt wtwt wt KI KI KI KI
- - - - - - - wt KI - - wt KI - -
- - - - - - - - wt KI - - wt KI
FLAG
PAR1 myc
CK1ε
CK2α
0
1
2
3
4
*
TopFLASHfoldinduction
A. B.
C. D.
E.
FIGURE 1. A–C, cotransfection of CK1⑀, CK2␣/␤, and PAR1 kinases with FLAG-Dvl3. FLAG-Dvl3 (0.1 ␮g) plasmid was cotransfected with 0.4 ␮g of each kinase or
a corresponding amount of pcDNA3 as control. Samples were analyzed for the activation of TCF/LEF-dependent transcription using the TopFlash reporter
system (graphs summarize three independent experiments) and for the analysis of electrophoretic migration of FLAG-Dvl3. Western blot analysis of CK1⑀,
CK2␣, and PAR1-Myc kinases provides a control for efficiency of transfection. All the measurements have been performed in three independent replicates. The
arrow indicates PS-Dvl3, the filled arrowhead indicates P-Dvl3, and the open arrowhead indicates non-modified Dvl3. D and E, HEK-293 cells were transfected
with wild type Xenopus Dsh (XDsh) or XDsh with eight serines in the b-region mutated to alanines (8S/TA) and corresponding kinases. XDsh-8S/A does not lack
the TopFlash-inducing potential for CK1⑀ but fails to induce TopFlash to the same extent in CK2/PAR1-transfected cells. Data represent the means Ϯ S.D. *, p Ͻ
0.05; **, p Ͻ 0.01; ***, p Ͻ 0.001, one-way analysis of variance, Tukey post test. ns, not significant.
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10399
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
even more slowly migrating forms of Dvl3 labeled as PS-Dvl
(see the Western blot panels in Fig. 1, A–C). Such changes in the
electrophoretic mobility of FLAG-Dvl3 induced by CK1⑀ coexpression
correlated with robust activation of the TopFlash
reporter, which reflected activation of the Wnt/␤-catenin pathway
(see the graphs in Fig. 1, A–C). CK2 was able to partially
activate the TopFlash reporter, whereas the activation of the
reporter by PAR1 was negligible. However, co-expression of
PAR1 was sufficient to significantly increase the reporter activation
induced solely by either CK1⑀ or CK2 (see Fig. 1, A and
B). The most prominent TopFlash induction was in the sample
in which CK1⑀ and PAR1 were coexpressed together (highest
bar in Fig. 1A). PAR1 in combination with CK2 was able to shift
Dvl3 electrophoretic migration from Dvl to P-Dvl (Fig. 1C, lane
9) but never to PS-Dvl (Fig. 1, A–C, all samples with CK1⑀). This
difference suggested that the effects of CK2/PAR1 were distinct
from the effects of CK1⑀. As CK2 and PAR1 kinases were shown
to mainly phosphorylate Dvl in the basic region/PDZ region
(24, 25), this observation would suggest that they cooperate or
were redundant in the phosphorylation of Dvl in the Wnt/␤catenin
pathway. In line with these observations, when the Ser/
Thr cluster in the basic region preceding PDZ domain of
Dishevelled was mutated to alanines (25), it had a reduced
capacity to activate the TopFlash reporter after phosphorylation
by CK2, PAR1, or the combination of both (Fig. 1D, supplemental
Fig. 1). It was, however, fully active after phosphorylation
by CK1⑀ (Fig. 1E). These results demonstrate that CK1⑀
and CK2/PAR1 were both capable of activating the Wnt/␤catenin
pathway in a Dvl-dependent manner, but the mechanisms
were distinct. Efficient activation of downstream signaling
accompanied by the formation of PS-Dvl can only be
achieved by the phosphorylation by CK1⑀. Because we have not
observed any functional differences between CK2 and PAR1,
we used the combination of the two kinases in the further work.
Down-regulation of CK1␦/⑀ but Not of CK2-diminished Formation
of PS-Dvl in MEF Cells after Wnt Stimulation—Gainof-function
experiments suggested that CK1 and CK2/PAR1
phosphorylated Dvl differently. To test the requirement of CK1
and CK2 for endogenous PS-Dvl formation, we used a loss-offunction
approach in MEFs. MEFs represent a very suitable
system for the analysis of Dvl biology because they respond
efficiently to Wnt stimulation by the formation of PS-Dvl. We
have used several antibodies against endogenous Dvl2 and
Dvl3 that show slightly different sensitivity against individual
phospho-variants of Dvl. We down-regulated CK1⑀ and -␦,
which are two isoforms previously shown to be redundant
and required for PS-Dvl formation (14), or CK2␣ using
siRNA-mediated knockdown in MEF cells. Stimulation with
recombinant mouse (rm) Wnt3a (50 ng/ml) or rmWnt5a (100
ng/ml) for 2 h efficiently promoted PS-Dvl formation in MEF
cells (Fig. 2A). Consistent with the earlier findings, the knockdown
of CK1␦/⑀ blocked the formation of PS-Dvl after Wnt3a
or Wnt5a treatment (Fig. 2A). However, we failed to see any
effect of CK2␣ knockdown on the Wnt-induced PS-Dvl formation.
This experiment suggested that CK1␦/⑀ was indeed necessary
for the dynamic Wnt-induced formation of PS-Dvl and
that CK2 was not.
To confirm the knockdown data, we pretreated MEF cells
with CK1 (100 ␮M D4476 and 50 ␮M IC261)- and CK2 (50 ␮M
TBCA, 100 ␮M TBBt)-specific inhibitors for 30 min and subsequently
with rmWnt3a (50 ng/ml) or rmWnt5a (100
ng/ml) for 2 h. As we show in Fig. 2B (D4476 and TBCA) and
supplemental Fig. 2 (IC261 and TBBt), CK1-specific inhibitors
were able to block the Wnt-induced formation of PSDvl.
In contrast, the CK2 inhibitors failed to block or diminish
the formation of the Wnt-induced PS-Dvl band. On the
other hand, they were able to generally decrease Dvl phosphorylation,
which also resulted in the appearance of a thirdfastest
migrating band (Dvl3, antibody CST#3218). The
CK2␣ activity toward Dvl has been shown to be constitutive
(24, 27). Thus, we propose that the CK2 inhibitor-induced
third band was a non-modified Dvl3, as the molecular mass
corresponded to the in silico-determined mass of Dvl3.
Interestingly, treatment of cell lysates with alkaline phosphatase
completely removed PS-Dvl but only partially promoted
appearance of Dvl (supplemental Fig. 2B). This suggests
that CK2-induced modification of Dvl is not solely
phosphorylation but may be more complex and involve
other modifications such as mono-ubiquitination. It is also
worth noting that CK1 inhibition decreased Wnt3a-induced
phosphorylation of LRP6 at Ser-1490, which is known to be a
Dvl-dependent process (9, 28). These loss-of-function
experiments suggest that endogenous Dvl is constitutively
modified (but not only phosphorylated) in a CK2-dependent
manner (P-Dvl) and after Wnt stimulation is further phosphorylated
by CK1␦/⑀ to form PS-Dvl. To demonstrate gradual
modification of Dvl3 by CK2 (to P-Dvl) and CK1␦/⑀ (to
PS-Dvl), we first eliminated endogenous CK1⑀ by siRNA and
overexpressed FLAG-Dvl3 with Xenopus CK2 and CK1⑀,
which were not targeted by siRNA. As we show in Fig. 2C,
under these conditions (right side of the panel) exogenous
CK2 clearly shifts Dvl to P-Dvl (filled arrowhead), and CK1⑀
to PS-Dvl (full arrow). The combination of results shown in
Figs. 1 and 2, thus, suggests that CK2/PAR1 and CK1⑀ may
phosphorylate Dvl sequentially with CK2 activity being constitutive
and CK1⑀ activity being induced by Wnts.
Both CK1 and CK2 Kinase Activities Are Irreplaceably
Required for Wnt/␤-Catenin Activation via Dvl3—We hypothesized
that phosphorylations by CK2 and CK1 represent distinct,
although sequential steps in the chain of events required
for Dvl activation in the Wnt/␤-catenin pathway. To test this
hypothesis, we induced TCF/LEF transcription by co-expressing
FLAG-Dvl3 and CK1⑀ or FLAG-Dvl3 and CK2/PAR1, and
we tested the effects of CK1 and CK2 inhibition, respectively.
As we show in Fig. 3, A and B, the CK1⑀ inhibitors D4476 and
IC261 were able to diminish TopFlash induction by both
FLAG-Dvl3ϩCK1⑀ and FLAG-Dvl3ϩCK2/PAR1. Strikingly,
the two CK2 inhibitors TBCA and TBBt showed very similar
effects and blocked a Dvl3-dependent increase in TCF/LEFdriven
transcription induced by both CK1⑀ and CK2/PAR1.
Importantly, inhibition of casein kinases did not show a consistently
negative effect on TCF/LEF-mediated transcription
induced by constitutively active (S33A) ␤-catenin (Fig. 3C).
This result was also not observed in the absence of FLAG-Dvl3,
which demonstrates that (i) the inhibitors did not interfere with
Casein Kinases in Dishevelled Biology
10400 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
siRNA Ctrl
siRNA CK1ε/δ
siRNA CK2α
0.1% BSA in PBS Wnt-3a (50ng) Wnt-5a (100ng)
+ - - + - - + - -
- - - - -+ + +
+ - - + - - +- pLrp6
(S1490)
Dvl2(CST#3224)
Dvl3(sc-8027)
CK2α
CK1ε
actin
pLrp6 (S1490)
Dvl2(CST#3224)
Dvl3(sc-8027)
actin
0.1% BSA in PBS
Wnt-3a (50ng)
Wnt-5a (100ng)
Ctrl D4476 TBCA
+ - - + - - + - -
- - - - -+ + +
+ - - + - - +- -
Dvl3(CST#3218)
Flag-Dvl3
CK1ε
CK2
siCtrl siCK1ε
- + + +
+
+
- - -
---
- + + +
+
+
- - -
---
Flag
CK2α
CK1ε
A.
B.
C.
FIGURE2.A,MEFcellsweretransfectedwithsiRNAforCK1⑀and-␦orCK2␣.24hpost-transfectioncellsweretreatedwithrecombinantmouseWnt3a(50ng/ml)
or Wnt5a (100 ng/ml). Cell lysates were harvested 2 h after treatment. After Wnt 3a/5a treatment, CK1⑀/␦ siRNA diminishes the formation of PS-Dvl, whereas
CK2␣siRNAdoesnot.WesternblotanalysisforCK1⑀andCK2␣demonstratesknockdownefficiency;phosphorylationofLrp6wasusedtodeterminetheWnt3a
activity. B, MEF cells were pretreated with the CK1 (D4476 100 ␮M) and CK2 (TBCA 100 ␮M) inhibitors. Cells were treated with rmWnt3a (50 ng/ml) or Wnt5a (100
ng/ml) after 30 min of pretreatment. Cell lysates were harvested 2 h after treatment. The CK1 inhibitor D4476 was able to diminish PS-Dvl formation after Wnt
treatment, whereas CK2 inhibitors were not able to do so. Unlike CK1 inhibitors, CK2 inhibitors were able to cause the formation of lowest molecular weight
form of Dvl3. C, HEK-293 cells were transfected with siRNA against CK1⑀ and after 24 h transfected with corresponding constructs. In the absence of endogenous
CK1⑀, CK2 clearly promotes P-Dvl, whereas PS-Dvl formation is only induced by CK1⑀. The arrow indicates PS-Dvl3, the filled arrowhead indicates P-Dvl3,
and the open arrowhead indicates non-modified Dvl3.
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10401
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
the signaling downstream of ␤-catenin, and (ii) the observed
effects were Dvl3-dependent.
To demonstrate how endogenous CK1⑀ and CK2␣ contributed
to the activation of the TCF/LEF transcription induced by overexpressed
kinases, we down-regulated endogenous CK1⑀ and CK2␣
in HEK-293 cells using siRNAs. Used siRNAs do not target exogenous
xCK1⑀ or xCK2/xPAR1 kinases, which were together with
FLAG-Dvl3 overexpressed in cells depleted of CK1⑀ or CK2␣ (Fig.
3, E and F). Knockdown of CK1⑀ and CK2␣ decreased TopFlash
induction in FLAG-Dvl3ϩxCK1⑀, which suggested that endogenous
CK2␣ activity was required for the action of overexpressed
CK1⑀. Furthermore, down-regulation of endogenous CK1⑀ was
able to diminish the xCK2/xPAR1-induced TopFlash. CK2␣
siRNA did not show any effect in this assay, which suggests that
xCK2␣ was able to fully rescue the lack of endogenous CK2␣
kinase. These results suggested that the phosphorylation of Dvl3
by CK1 and CK2 represented individual steps in the sequence of
events. Accordingly, the activation of the Wnt pathway and inter-
ctrl
D
vl3
D
vl3+C
K
2
ctrl
D
vl3
D
vl3+C
K
2
ctrl
D
vl3
D
vl3+C
K
2
0.0
0.5
1.0
1.5
siCtrl siCK1ε/δ siCK2α
**
ns
TopFLASHratio
DMSO
D4476
IC261
TBBt
TBCA
DMSO
D4476
IC261
TBBt
TBCA
0.0
0.5
1.0
1.5
β-cateninCtrl
TopFLASHratio
DMSO
D4476
IC261
TBBt
TBCA
DMSO
D4476
IC261
TBBt
TBCA
0.0
0.2
0.4
0.6
Ctrl Dvl3
TopFLASHratio
ctrl
D
vl3
ε
D
vl3+C
K
1
ctrl
D
vl3
ε
D
vl3+C
K
1
ctrl
D
vl3
ε
D
vl3+C
K
1
0
1
2
3
siCtrl siCK1ε/δ siCK2α
***
**
TopFLASHratio
DMSO
D4476
IC261
TBBt
TBCA
DMSO
D4476
IC261
TBBt
TBCA
0
1
2
3
4
5
Ctrl Dvl3+CK1ε
**
TopFLASHratio
DMSO
D4476
IC261
TBBt
TBCA
DMSO
D4476
IC261
TBBt
TBCA
0
1
2
3
4
5
Ctrl Dvl3+CK2
***
TopFLASHratio
A. B.
C. D.
F.E.
FIGURE 3. A–D, HEK-293 cells were transfected with the indicated constructs and TopFlash reporter. Twenty-four hours post-transfection, cells were treated
with CK1 (D4476 100 ␮M, IC261 50 ␮M) and CK2 (TBCA 50 ␮M, TBBt 100 ␮M) inhibitors. Both CK1 and CK2 inhibitors were able to significantly block TCF/LEFdriven
transcription in both FLAG-Dvl3 ϩ CK1⑀ (A)- or FLAG-Dvl3ϩCK2/PAR1 (B)-transfected cells. The inhibitors did not show any effect in cells transfected
with constitutively active ␤-catenin (C) or in the absence of overexpressed Dvl3 (D). E and F, HEK-293 cells were transfected with siRNA against CK1⑀ or CK2␣.
After 24 h they were transfected with the corresponding constructs and TopFlash ϩ Renilla constructs. siRNA against CK1⑀ and CK2␣ were able to diminish
DvlϩCK1⑀-induced TopFlash, whereas DvlϩCK2/PAR1-induced TopFlash could not be diminished by the siRNA. Data represent the means Ϯ S.D. **, p Ͻ 0.01;
***, p Ͻ 0.001; one-way analysis of variance, Tukey post test. ns, not significant.
Casein Kinases in Dishevelled Biology
10402 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
ruption of any of these steps completely interfered with the ability
of Dvl3 to promote Wnt/␤-catenin signaling.
Both CK1⑀ and CK2 Promote Even Intracellular Distribution
of Dvl—Dvl was usually found to be present in dynamic multiprotein
aggregates (12, 13) called Dvl dots or puncta. Based on
the cellular context, overexpressed Dvl2 or Dvl3 was usually
present either in dots or was evenly distributed (Dvl2 exampled
in Fig. 4A). CK1⑀ has been shown earlier to strongly promote
even localization of Dvl (14, 20). Based on these findings, in the
next step we tested the role of CK2 on Dvl distribution. Dvl2Myc
was overexpressed with the indicated kinases in HEK-293
cells, and the cells were scored for their pattern of subcellular
localization of Dvl2. As we show in Fig. 4B, CK1⑀ promoted
even localization of Dvl, as previously reported. Interestingly,
overexpression of CK2 showed very similar, albeit somewhat
weaker, effects than CK1⑀. These effects are not due to reduced
levels of Dvl2-Myc after kinase coexpression (inset in Fig. 4A).
Importantly, CK1 inhibition by D4476 and CK2 inhibition by
TBBt were both able to reduce the effects of either CK1⑀ or CK2
(Fig. 4C). These results suggested that the even distribution of
Dvl was similar to the TCF/LEF-dependent transcription promoted
by a mechanism that was non-redundantly dependent
on both CK2 and CK1⑀.
Analysis of Dvl Domains Required for the Effects of CK1⑀ and
CK2—Dvl proteins have three very well conserved domains
(see the scheme in Fig. 5): the N-terminal DIX domain, the PDZ
domain, and the DEP domain. Apart from these main domains,
there are two well conserved stretches of amino acids: a basic
region (b) preceding the PDZ domain and a proline-rich cluster
(Pro) between the PDZ and DEP domains. The DIX domain has
been shown to function mainly in the canonical Wnt/␤-catenin
pathway (29), whereas the function of the DEP domain has been
mostly associated with noncanonical pathways (30, 31). The
PDZ domain serves as a scaffold for many cooperating proteins
and has been shown to be necessary in both pathways. To test
the roles of and mutual relationship between CK1⑀ and CK2 in
Dvl biology, we analyzed a set of diverse human Dvl3 mutants.
We took advantage of the previously described deletion
ctrl
D
4476
TB
B
t
ctrl
D
4476
TB
B
t
ctrl
D
4476
TB
B
t
0.0
0.2
0.4
0.6
0.8
even
small puncta
large puncta
ctrl CK1εε CK2
DistributionpatternofDvl2-Myc
*
ns
*
ctrl
ε
C
K
1
C
K
2
0.0
0.2
0.4
0.6
0.8
1.0 even
small puncta
large puncta
DistributionpatternofDvl2-Myc
*
*
+ + +Dvl2-myc
- + -CK1ε
- - +CK2αβ
A. B.
C.
FIGURE 4. HEK-293 cells were transfected with the indicated constructs and were then subjected to immunocytochemistry. A, shown is a typical
localization pattern of Dvl2-Myc, which was scored in the experimental samples. The inset shows levels and electrophoretic migration of Dvl2-Myc in the
analyzed cells. B, both kinases were able to change Dvl intracellular distribution from dotted to even. This effect can be reduced by treatment with CK1 (D4476)
and CK2 (TBBt) inhibitors (C). Quantification is based on three independent replicates. *. p Ͻ 0.05, one-way analysis of variance (cells with even distribution),
Tukey post test. ns, not significant.
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10403
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
mutants of Dvl3 (32) and analyzed the function of individual
domains for Dvl3 behavior, which was modified by CK1 or
CK2/PAR1. The parameters examined after CK1⑀ and in some
cases after CK2 overexpression included (i) the ability to bind
CK1⑀ (endogenous and overexpressed), endogenous CK2␣,
and endogenous Axin1, (ii) the ability to promote TCF/LEF-dependent
transcription (see Fig. 3), (iii) intracellular localization
of Dvl3 (see Fig. 4), and (iv) electrophoretic mobility shift of
Dvl3 (see Fig. 1).
As we show in the protein-protein interaction analysis (Fig.
5), full-length Dvl3 was able to bind both endogenous and
overexpressed CK1⑀, endogenous CK2␣, and upon CK1⑀ overexpression,
full-length Dvl3 also bound endogenous Axin1.
Moreover, full-length Dvl3 acted as a scaffold, which was
required for the co-immunoprecipitation of CK1⑀ with endogenous
CK2␣ and Axin1. Analysis of mutants showed that CK1⑀
could be co-immunoprecipitated with at least two distinct
domains of Dvl3. For high affinity interactions, which were
indicated by the presence of endogenous CK1⑀ in the Dvl3 pulldown
assay, only a DIX domain was dispensable (see aa 82–716
mutant). However, overexpressed CK1⑀ could be also found in
association with all other mutants tested, with the exception of
the extreme C terminus (mutant aa 496–716). Our results confirm
previous findings that map the binding domains of CK1 to
the DEP domain or its close proximity (compare aa 332–716
and 496–716 mutants and Kishida et al. (19)) and to the basic
region preceding the PDZ domain (see mutant aa 1–246 and
Klein et al. (33) and Klimowski et al. (34)). Endogenous
CK2␣ could be co-immunoprecipitated with all the mutants
of Dvl3, which contained a basic region between the DIX and
PDZ domains,. This finding was in agreement with our data
in Fig. 1D and with a previously published report (24). Interestingly,
the binding of CK2 to Dvl3 was promoted by the
co-expression of CK1⑀ (see e.g. aa 1–422 and 1–495
mutants). In line with this observation, CK1⑀ could be precipitated
with endogenous CK2 in a Dvl3-dependent manner
only when the basic region/PDZ (CK2 binding site) and the
proline-rich-DEP domain (CK1 binding site) were present
(WT, aa 80–716 and 1–495 mutants). We also, for the first
time, showed that CK1⑀ overexpression could induce the
recruitment of endogenous Axin1 to Dvl3 (Fig. 5, panel WB:
Axin1), which is very relevant for the inactivation of the
destruction complex and for further downstream ␤-catenindependent
signaling. Axin1 bound only Dvl3 mutants containing
both a DIX domain, which was previously reported as
necessary for binding to Axin1 (29), and a PDZ-Pro-rich
FIGURE 5. HEK-293 cells were cotransfected with the indicated combinations of FLAG-Dvl3 mutants and CK1⑀. The amino acids present in the mutants
and the domain structure is schematized (b, basic region; Pro, proline-rich region). Two days later cells were lysed and subjected to immunoprecipitation (IP)
with the corresponding antibodies (FLAG M2, CK1⑀). The presence of Dvl3, CK1⑀, CK2␣, and Axin1 in the pull-down assay was analyzed by Western blotting
(WB). FLAG-Dvl3 constructs used in this experiment are schematized on the left hand side of the figure.
Casein Kinases in Dishevelled Biology
10404 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
region, which probably contains crucial CK1⑀ phosphorylation
sites required for Axin1 recruitment.
In the next step we tested the functional properties of Dvl3
mutants with respect to the effects of CK1 and CK2. Dvl3 and
its mutants were transfected into HEK-293T cells and tested for
their ability to induce TCF/LEF-dependent transcription. As
we show in Fig. 6A, the ability of Dvl3 truncations to induce
transcription was very weak, with only 2-fold induction of TopFlash
by WT and aa 1–422 and 1–495 mutants. There was no
induction by mutants lacking the DIX domain, but there was
approximately an 8-fold induction by mutant aa 1–246, which
contained the DIX domain and a basic region. Expression of
CK1⑀ alone increased the TCF/LEF reporter ϳ8-fold in this
experimental setup (Fig. 6B), which we believe represented the
effects of CK1⑀ on endogenous Dvl or on other endogenous
components of the Wnt pathway. CK1⑀ together with DIXdeficient
mutants (and also mutant aa 1–246) did not activate
TopFlash above this level. In contrast, the activation capacity of
both mutants, which contain a DIX, PDZ, and proline-rich
region (aa 1–422 and 1–495) but lacked the C terminus, was
even higher than the full-length Dvl after phosphorylation by
CK1⑀ (Fig. 6B). This effect does not seem to be unique to Dvl3
because the Dvl1 mutant lacking the C terminus (Dvl1 aa
1–502) behaves very similarly (supplemental Fig. 3A). CK2/
PAR1 increased TopFlash activation to a lesser extent than
CK1⑀, and the activity of none of the mutants, with the exception
of mutant aa 1–495, which lacked only the C terminus, was
potentiated more than 3-fold (Fig. 6C).
Individual deletion mutants intrinsically differ in other basic
parameters than in its ability to promote the Wnt pathway. The
presence of the DIX domain, which was shown to be required
for polymerization of Dvl (11), strongly determined the solubility
and localization of Dvl. Mutants containing the DIX domain
were insoluble when mildly lysed by freezing/thawing (supplemental
Fig. 3B) and formed large aggregates when they were
visualized by immunocytochemistry (Fig. 7). On the other
hand, mutants lacking the DIX domain were more soluble (supplemental
Fig. 3B) and were more evenly localized (Fig. 7). Our
data were also in good agreement with the previous report,
which mapped the nuclear export signal C-terminal from the
DEP domain (35) because the normally cytoplasmic Dvl3 was
also found in the nucleus after deletion of the C terminus (supplemental
Fig. 4A). As we demonstrated above, CK1⑀ and CK2/
PAR1 changed the distribution of full-length Dvl3 from punctate
to uniform (Fig. 4). The positive effects of CK1⑀ and CK2/
PAR1 on even localization of Dvl3 were conserved in the aa
82–716 and 332–716 mutants (Fig. 7, supplemental Fig. 4B).
Under basal conditions, these two mutants were localized more
uniformly than WT, and because they lacked their own DIX
domain, we speculate that they aggregated with endogenous
Dvl isoforms. Importantly, the distribution pattern of DIX-containing
mutants, which also lacked the N terminus, was not
modulated by CK1⑀ (Fig. 7) or CK2/PAR1 (not shown). The
ability of CK1⑀ to homogenize the localization of Dvl3 correlated
well with its ability to promote the efficient formation
of hyperphosphorylated Dvl3 (probably corresponding to PSDvl3).
This form in the overexpressed FLAG-Dvl3 was visible as
the third, most slowly migrating band, induced only in the conditions
where CK1 was co-expressed (Fig. 5, or in more detail,
supplemental Fig. 5). CK1⑀ and CK2 also caused the formation
of a shifted form of Dvl3 in other mutants with the exception of
aa 496–716 (C terminus). However, in these cases it promoted
predominantly, although not exclusively, the ratio of P-Dvl/Dvl
bands, which were also present after Dvl3 overexpression without
the kinase (supplemental Fig. 5).
ctrl
D
vl3
82-716332-716496-716
1-246
1-422
1-495
0.00
0.02
0.04
0.06
0.08
TopFLASHratio
0
20
40
60
80
ctrl
Dvl3
82-716
332-716
496-716
1-246
1-422
1-495
Ck1ε - + - + - + - + - + - + - + - +
TopFLASHratio
0
5
10
15
20
TopFLASHratio
ctrl
Dvl3
82-716
332-716
496-716
1-246
1-422
1-495
CK2/PAR1 - + - + - + - + - + - + - + - +
A.
B.
C.
FIGURE 6. HEK-293 cells were transfected with the indicated constructs
and a TopFlash reporter. A, the ability of FLAG-Dvl3 constructs to promote
TCF/LEF-dependent transcription is shown. B and C, FLAG-Dvl3 constructs
were co-transfected with CK1⑀ (B) or CK2/PAR1 (C). The graphs show -fold
change increase in the TopFlash reporter for each particular construct
induced by the co-expressed kinase. Graphs summarize data from three independent
experiments (means Ϯ S.D.).
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10405
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
All the results regarding the deletion mutants of Dvl3 are
summarized for clarity in Table 1. Based on the analysis of
deletion mutants, we concluded the following previously
unpublished information; (i) the roles of CK1⑀ and CK2 were
distinct and involved different regions of Dishevelled, (ii) the
C terminus showed an inhibitory function and was required
for CK1⑀-induced change in the subcellular localization
from punctate to even, (iii) the PDZ and Pro-rich rich region
FIGURE 7. HEK-293 cells were transfected with corresponding constructs and then subjected to immunocytochemistry. Intracellular distribution of Dvl
was observed and quantified 24 h after transfection. Typical subcellular distribution of Dvl3 mutants and quantitative analysis of distribution pattern (200 cells
in each of three independent experiments) is shown. wt, wild type; ki, kinase inactive.
Casein Kinases in Dishevelled Biology
10406 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
were required for CK1⑀-induced activation of Dvl in the
Wnt/␤-catenin pathway.
CK1⑀-phosphorylated PS-Dvl Has Decreased Ability to
Polymerize with Other Dvls—The findings above suggested that
CK1⑀ has apart from its clear positive role in Dvl/␤-catenin
signaling also a subsequent negative role, which is at least in
part mediated by formation of PS-Dvl and the Dvl-C terminus.
Because CK1⑀ has primarily a strong positive role, it is not possible
to analyze the negative consequences of CK1⑀ phosphorylation
by looking globally at downstream functional readouts.
It is more likely that if indeed CK1⑀ affects Dvl signaling negatively,
it will interfere with the properties of Dvl required for
efficient downstream signaling in the ␤-catenin pathway. A
suitable measure of this function is the ability of Dvls to polymerize
via their DIX domains, which was shown to be crucial
for Dvl function. In addition, polymerization-deficient mutants
of Dvl were shown to be inactive (9, 11).
To test the ability of PS-Dvl phosphorylated by CK1⑀ to bind
other Dvls, we have performed GST pulldown assays with GSTDvl
(36) as bait. As we show in Fig. 8A, GST-Dvl is able to
efficiently pull down FLAG-tagged Dvl3. Importantly, P-Dvl
binds to GST-Dvl most efficiently, whereas non-modified Dvl
or PS-Dvl triggered by CK1⑀ show much lower affinity to bacterially
produced GST-Dvl (see Fig. 8B for quantification).
Results of GST pulldown might be affected by protein modifications
appearing in the cell extract after lysis. To avoid possible
lysis artifacts, we performed FRET experiments in HEK-
293 cells expressing Dvl2-GFP and FLAG-Dvl3 with and
without overexpression of CK1⑀. After fixation and indirect
immunostaining of FLAG-Dvl3 with a Cy3-coupled secondary
antibody, the electron acceptor (Cy3) was photobleached. Due
to the destruction of the electron acceptor, FRET does not
occur, and emission by the electron donor (GFP) increases
compared with the prebleach situation when the two FRET
partners are in close proximity to each other. In fact, FRET was
measurable after photo acceptor bleaching with 115.8 Ϯ 1.2%
(mean Ϯ S.E., n ϭ 30) in Dvl2-GFP- and FLAG-Dvl3-expressing
cells, which showed a predominant punctate distribution of
the two Dvl isoforms. With CK1⑀ overexpression, Dvl2-GFP
and FLAG-Dvl3 showed a more even distribution as reported
previously, and the GFP emission after photobleaching remained
unchanged compared with the GFP emission before
bleaching (107.0 Ϯ 1.2%; mean Ϯ S.E., n ϭ 30) (Fig. 8C). Typical
appearance of cells used for FRET is shown in supplemental Fig.
6. We concluded that reduced FRET indicates the dissociation
of the two Dvl isoforms upon CK1⑀ overexpression.
The results above suggested that persistent phosphorylation of
Dvl by CK1⑀, which leads to the formation of PS-Dvl, causes
decreased ability of PS-Dvl to multimerize. However, PS-Dvl is
also formed after Wnt3a stimulation (see Fig. 2). To exclude pos-
sibleartifactsofoverexpression,wedecidedtotestwhetherendogenous
PS-Dvl has also decreased ability to polymerize. Therefore,
westimulatedMEFcellswithWnt3a,immunoprecipitatedendogenous
Dvl2, and analyzed the amount of Dvl3 in the pulldown
assay by Western blotting. The antibody used for precipitation
does not cross-react with endogenous Dvl1 and Dvl3 (Ref. 37 and
data not shown). As we show in Fig. 8D, the amount of Dvl3 in
complexwithDvl2decreasedafter2hofWnt3astimulation,when
PS-Dvl represented a dominant Dvl form.
To further confirm this finding and to avoid possible cross-reactivity
of used antibodies, we have repeated the co-immunoprecipitation
experiment with endogenous Dvl2 and Dvl3 as bait and
TABLE 1
Summary of deletion mutants of Dvl3
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10407
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
analyzed the composition of the complexes by MS/MS. First, we
have noticed that the number of samples where Dvl2 co-immunoprecipitated
with Dvl3 and Dvl3 co-immunoprecipitated with
Dvl2 dramatically decreased after 3 h of Wnt3a stimulation (Fig.
8E).Pleasenotethatonlysampleswherethebaitwasdetectedwith
a significant score were considered for the analysis. We conclude
from this non-quantitative analysis that the amount of the respective
Dvl that co-immunoprecipitated with the bait after Wnt3a
treatment was generally lower and more frequently below the
detection limit of MS/MS technology. We could also perform
MS/MS-based relative quantification of individual Dvls in a few
Wnt3a-treated samples where Dvl2 was used as bait and where
Dvl3 was detected in sufficient peptide quality and in sufficient
number of technical replicates (see “Materials and Methods” for
details). The amount of Dvl2 (bait) was set to 10 arbitrary units,
and Dvl3 in the samples was quantified relatively to Dvl2. The
results of this analysis showed that the amount of endogenous
Dvl3 in complex with Dvl2 is indeed lower after Wnt3a stimulation
(Fig. 8F). These results are in agreement with observations
obtained by Western blot detection and by the non-quantitative
MS/MS analysis. In summary, our findings shown in Fig. 8 demonstrate
that PS-Dvl has decreased ability to bind other Dvls and
suggest that PS-Dvl represents a negative signaling intermediate
with decreased ability to polymerize.
DISCUSSION
In this study we attempted to answer two main questions
related to the Wnt/␤-catenin signaling pathway; that is, how
control Wnt3a
0
1
2
3
4
RelativeamountofDvl3
incomplexwithDvl2
0
1
2
3
pulldown/inputratio
PS-Dvl3P-Dvl3Dvl3
Detected Dvl2 Detected Dvl3
0.0
0.2
0.4
0.6
0.8
control
Wnt3a
N=10
N=8
N=8
N=6
IP Dvl3
sc8027
IP Dvl2
sc8026
proportionofsamples
whereDvlwasdetected
IP
TCL
IgG
Dvl2
sc8026
- +- - +Wnt-3a
Dvl2
sc8026
Dvl3
CST#3218
Dvl3
sc8027
pcDNA3 CK1ε
0
20
40
60
80
100
105
110
115
***
FRET(Dvl2-Dvl3)
+ + +FLAG- Dvl3 +
- + -CK1ε +
GST GST-Dvl
+ +
- +
input
Dvl3
P-Dvl3
PS-Dvl3
A. B.
C. D.
E. F.
FIGURE 8. A and B, FLAG-Dvl3 was overexpressed either alone or with CK1⑀in HEK-293 cells and subjected to GST pulldown assays with GST-Dvl (or GST tag only
as the negative control). FLAG-Dvl3 in the pulldown and input (TCL) was visualized by Western blotting using FLAG antibody. The ratio of individual Dvl forms
(pulldown/input) in the shown experiment was quantified by densitometry (B). C, Dvl2-GFP and FLAG-Dvl3 were overexpressed in HEK-293 cells, fixed, and
stained for FLAG (Cy3-conjugated secondary antibody). As a measure of proximity between Dvl2-GFP and FLAG-Dvl3, FRET between GFP and Cy3 was
determined by photoacceptor bleaching in cells co-transfected with pcDNA3.1 or CK1⑀. The results from 30 individual cells are summarized in a bar graph (C).
GFPfluorescencebeforephotobleachingwassetto100%fornormalization.StatisticalsignificancewasanalysesbyStudent’sttest.***,pϽ0.0001.D,MEFcells
were either treated with control or Wnt3a-conditioned medium for 3 h, lysed, and subjected to immunoprecipitation (IP) with Dvl2-specific antibody. Unspecific
antibody (IgG) was used as a control. The amount of Dvl2 and Dvl3 in the immunoprecipitates and in the input (TCL) was analyzed by Western blotting
using several antibodies specific for individual Dvl isoforms. E and F, MEF cells were treated with control and Wnt3a-conditioned media, and endogenous Dvl2
or Dvl3 (baits) was immunoprecipitated. Composition of protein mixtures was analyzed by MS/MS. Graphs (E) indicate the proportion of samples where Dvl2
was found in complex with Dvl3 (bait), and Dvl3 was found in complex with Dvl2 (bait). Bait was identified in 100% of samples in this analysis. N indicates the
number of experiments. F, relative amounts of endogenous Dvl3 in samples immunoprecipitated with anti-Dvl2 antibody are shown. Quantification is based
on peak intensities with relative bait abundance set to 10.
Casein Kinases in Dishevelled Biology
10408 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
Dvl integrates phosphorylation by individual kinases and
how CK1⑀ at the same time strongly induces Wnt/␤-catenin
signaling and dissolves Dvl puncta, which are required for
signal activation. Based on our results, we propose a model
that is consistent with the experimental evidence brought by
us and others. This model sheds light on some of the so far
controversial issues of Dvl biology and is schematized in
Fig. 9.
Our functional data show that CK2/PAR1 and CK1⑀ cannot
replace each other. The effects of either kinase on Dvldependent
induction of TCF/LEF-driven transcription can
be blocked by inhibition/knockdown of the second kinase.
This suggests that CK1⑀ and CK2 (or mammalian homologues
of PAR1 from the MARK family of kinases, which may
have similar function) act sequentially during the process of
Dvl activation. Activity of CK1⑀ is required for the effects of
CK2 to take place, and vice versa, the activity of CK2 is
required for the effects of CK1⑀ to take place. In line with
some earlier reports (24, 27), our data suggest that CK2
activity is constitutive or at least high enough to keep endogenous
Dvl predominantly modified in the CK2-dependent
manner in untreated cells. It remains to be tested as to the
significance of the Wnt-induced increase in CK2 activity
reported earlier by Gao and Wang (38). As a consequence,
the levels of endogenous dephosphorylated Dvl were very
low and only increased upon inhibition of CK2. In contrast,
CK1⑀ seems to be a true Wnt-activated kinase required for
the formation of PS-Dvl, which is the only hallmark of the
activation of endogenous Dvl known to date. Our data suggest
that CK1⑀ acts on Dvl modified by a CK2-dependent
process. Furthermore, inhibition or low levels of CK2 can
block or reduce the ability of CK1 to further phosphorylate
Dvl and activate TCF/LEF-mediated transcription. The
gradual effects of CK2 and CK1 toward Dvl can be visualized
as a phosphorylation-dependent shift both in endogenous
and exogenous Dvl (partially phosphorylated by CK2; Fig.
2C). It should be noted, however, that P-Dvl cannot be fully
transformed to Dvl by phosphatase treatment, and thus,
posttranslational modifications other than phosphorylation
triggered by CK2 might be involved.
The effects of CK1⑀-mediated phosphorylation of Dvl have
been well described earlier in many cellular models. The most
prominent CK1⑀-induced changes involve (i) the ability of
CK1⑀ to activate Dvl-dependent TCF/LEF-driven transcription
(17–20) and (ii) the ability to dissolve Dvl polymers visible as
Dvl puncta (14, 20). We show in this study that these two consequences
of CK1⑀ phosphorylation are separated both spatially
and functionally. First, CK1⑀-mediated induction of TopFlash
associated with dynamic recruitment of Axin1 was
mediated via the PDZ-Pro-rich region of Dvl (given that DIX
domain as the required prerequisite was present). Meanwhile,
the ability of CK1⑀ to promote even localization of Dvl3 was
mediated by the Dvl3 C terminus. The C-terminal part of Dvl
was required for even localization of Dvl, which likely corresponds
to the inability to form signalosomes. Dvl3 mutants
lacking C terminus were hyperactive, showed punctate localization,
and got less hyperphosphorylated after CK1⑀ co-expression,
at least as assessed by the mobility shift. However, our
data do not allow a direct link of electrophoretic migration of
Dvl and Dvl localization. Although there is a strong correlation
between these two features of Dvl (both strongly promoted by C
terminus), there are few notable exceptions from this rule; for
example, CK2 is unable to promote Dvl3 hyperphosphorylation
but still efficiently shifts Dvl localization from punctate to even.
However, our findings clearly demonstrated that the ability of
CK1 to activate downstream signaling and promote even localization
of Dvl are separate events with distinct functions.
This observation sheds light on some of the unclear issues of
Dishevelled biology. It is well established that CK1⑀ is required
for signaling downstream of Dvl, which involves Dvl polymerization
and subsequent formation of signalosomes, Lrp6 phosphorylation,
and stabilization of ␤-catenin (9, 11). However,
activation of Dvl-mediated (and CK1-dependent) downstream
signaling measured either as the formation of signalosomes (9),
phosphorylation of LRP6 (39), internalization of LRP6 (40), or
dephosphorylation of ␤-catenin (16) appears in less than 10–15
min, whereas the earliest formation of PS-Dvl is detected first
after 30 min (14–16, 41). Functional separation of CK1-triggered
downstream signaling and Dvl depolymerization allowed
us to formulate the hypothesis that hyperphosphorylated Dvl
(PS-Dvl), which is predominantly evenly distributed, is in an
inactive form. Furthermore, our data suggest that PS-Dvl is part
of a Dvl-inactivating mechanism maintained by CK1⑀. CK1⑀
can, thus, control both the initiation and the termination of
signaling (see Fig. 9).
According to our results the C-terminal part of Dvl carries
the ability to switch off the activity of Dvl in the Wnt/␤-catenin
signaling upon CK1⑀ phosphorylation. In line with our findings,
the C terminus of Dvl was shown to be an important region for
the interaction with known negative regulators of the Wnt/␤catenin
pathway. For example, KLHL12-cullin 3 system, which
triggers ubiquitination and degradation of Dvl, binds the Dvl3 C
terminus (32). The other inhibitor of the Wnt/␤-catenin pathway,
atypical receptor-tyrosine kinase Ror2, binds to the C terDvl
P-Dvl P-Dvl PS-Dvl
puncta puncta puncta even
bPDZ C-terminus
CK2/PAR1 CK1 CK1?
PDZ, Pro
DIX,
PDZ
P P P
P
P
P P
Wnt
TCF/LEF
transcription ON
OFF
FIGURE 9. Model for the function of casein kinases in Dvl biology. Casein
kinase 2 (and probably also PAR1 and its mammalian homologues) behave
like constitutively active kinases. Under normal conditions CK2 phosphorylates
Dvl in the basic domain/PDZ (bPDZ) to trigger formation of P-Dvl. P- Dvl
was then subject to phosphorylation by CK1␦/⑀, which becomes activated
upon Wnt stimulation. CK1␦/⑀ phosphorylation of P-Dvl in the PDZ and/or
Pro-rich region of Dvl allows recruitment of axin and phosphorylation of Lrp6
(usually detected after 10–15 min) and an executive phase of pathway activation
(TCF/LEF-driven transcription), which is dependent on the DIX
domains. Dvl in these functional states was capable of polymerization with an
electrophoretic migration that resembles P-Dvl. Further phosphorylation of
Dvl by CK1 led to the formation of PS-Dvl (usually detected 30–45 min after
Wnt stimulation) and ultimately resulted in the inactivation of Dvl in the
␤-catenin pathway. This functional state of Dvl, which requires the C terminus
of Dvl, leads to Dvl depolymerization and uniform subcellular distribution.
Using this mechanism, CK1␦/⑀ can control both the activation and the termination
of the pathway.
Casein Kinases in Dishevelled Biology
MARCH 25, 2011•VOLUME 286•NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 10409
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
minus of Dvl3 and is the only known Dvl interaction partner
that binds specifically to PS-Dvl after CK1 phosphorylation
(41). Moreover, we have shown recently that negative effects
mediated by the Dvl3 C terminus are dependent on Ror2 (41).
Our work, thus, suggests that PS-Dvl, which is the only universal
marker of Dvl activation in both canonical and non-canonical
Wnt pathways, may be a general inactive signaling intermediate.
This view was supported by the fact that PS-Dvl formed
irrespective of whether or not activated Wnt triggered the
Wnt/␤-catenin pathway (14–16). We have also shown before
that PS-Dvl, triggered by Wnt3a and Wnt5a, was indistinguishable
in terms of its dynamics, the electrophoretic migration,
and the kinases involved in its formation (14). Although it is
becoming clear that the C terminus of Dvl is an important functional
domain of PS-Dvl, most likely by providing an interaction
interface for negative regulators of Wnt/␤-catenin pathway,
future work is required to uncover the molecular details of this
phenomenon.
Acknowledgments—We thank Dr. S. Yanagawa (Kyoto University,
Japan), Dr. Randy Moon (University of Washington, Seattle), Dr. S.
Byers (Georgetown University, Washington D. C.), Drs. Olga Ossipova,
Sergei Sokol, and Marek Mlodzik (Mount Sinai School of Medicine),
Dr. Isabel Dominguez (Boston University School of Medicine),
Dr. Madelone Maurice (UMC Utrecht), and Dr. J. M. Graff (University
of Texas, Dallas) for providing plasmids. LWnt3A cells
(ATCC#CRL-2647) were provided by Dr. Vladimir Korinek (Institute
of Molecular Genetics, Prague).
REFERENCES
1. Clevers, H. (2006) Cell 127, 469–480
2. Malanchi, I., and Huelsken, J. (2009) Curr. Opin. Oncol. 21, 41–46
3. Schulte, G., and Bryja, V. (2007) Trends Pharmacol. Sci. 28, 518–525
4. Angers, S., and Moon, R. T. (2009) Nat. Rev. Mol. Cell Biol. 10, 468–477
5. Malbon, C. C., and Wang, H. Y. (2006) Curr. Top. Dev. Biol. 72, 153–166
6. Wallingford, J. B., and Habas, R. (2005) Development 132, 4421–4436
7. Gao, C., and Chen, Y. G. (2010) Cell. Signal. 22, 717–727
8. Wharton, K. A., Jr. (2003) Dev. Biol. 253, 1–17
9. Bilic, J., Huang, Y. L., Davidson, G., Zimmermann, T., Cruciat, C. M.,
Bienz, M., and Niehrs, C. (2007) Science 316, 1619–1622
10. Schwarz-Romond, T., Metcalfe, C., and Bienz, M. (2007) J. Cell Sci. 120,
2402–2412
11. Schwarz-Romond, T., Fiedler, M., Shibata, N., Butler, P. J., Kikuchi, A.,
Higuchi, Y., and Bienz, M. (2007) Nat. Struct. Mol. Biol. 14, 484–492
12. Schwarz-Romond, T., Merrifield, C., Nichols, B. J., and Bienz, M. (2005)
J. Cell Sci. 118, 5269–5277
13. Smalley, M. J., Signoret, N., Robertson, D., Tilley, A., Hann, A., Ewan, K.,
Ding, Y., Paterson, H., and Dale, T. C. (2005) J. Cell Sci. 118, 5279–5289
14. Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007) J. Cell Sci.
120, 586–595
15. Gonza´lez-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A., and Brown,
A. M. (2004) Mol. Cell. Biol. 24, 4757–4768
16. Bryja, V., Schulte, G., and Arenas, E. (2007) Cell. Signal. 19, 610–616
17. Peters, J. M., McKay, R. M., McKay, J. P., and Graff, J. M. (1999) Nature
401, 345–350
18. Sakanaka, C., Leong, P., Xu, L., Harrison, S. D., and Williams, L. T. (1999)
Proc. Natl. Acad. Sci. U.S.A. 96, 12548–12552
19. Kishida, M., Hino, Si., Michiue, T., Yamamoto, H., Kishida, S., Fukui, A.,
Asashima, M., and Kikuchi, A. (2001) J. Biol. Chem. 276, 33147–33155
20. Cong, F., Schweizer, L., and Varmus, H. (2004) Mol. Cell. Biol. 24,
2000–2011
21. Foldynova´-Trantírkova´, S., Sekyrova´, P., Tmejova´, K., Brumovska´, E., Bernatík,
O., Blankenfeldt, W., Krejcí, P., Kozubík, A., Dolezal, T., Trantírek,
L., and Bryja, V. (2010) Breast Cancer Res. 12, R30
22. Bryja, V., Gradl, D., Schambony, A., Arenas, E., and Schulte, G. (2007)
Proc. Natl. Acad. Sci. U.S.A. 104, 6690–6695
23. Bryja, V., Schambony, A., Caja´nek, L., Dominguez, I., Arenas, E., and
Schulte, G. (2008) EMBO Rep. 9, 1244–1250
24. Willert, K., Brink, M., Wodarz, A., Varmus, H., and Nusse, R. (1997)
EMBO J. 16, 3089–3096
25. Ossipova, O., Dhawan, S., Sokol, S., and Green, J. B. (2005) Dev. Cell 8,
829–841
26. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler,
K. W., Vogelstein, B., and Clevers, H. (1997) Science 275, 1784–1787
27. Song, D. H., Sussman, D. J., and Seldin, D. C. (2000) J. Biol. Chem. 275,
23790–23797
28. Zeng, X., Huang, H., Tamai, K., Zhang, X., Harada, Y., Yokota, C.,
Almeida, K., Wang, J., Doble, B., Woodgett, J., Wynshaw-Boris, A., Hsieh,
J. C., and He, X. (2008) Development 135, 367–375
29. Kishida, S., Yamamoto, H., Hino, S., Ikeda, S., Kishida, M., and Kikuchi, A.
(1999) Mol. Cell. Biol. 19, 4414–4422
30. Li, L., Yuan, H., Xie, W., Mao, J., Caruso, A. M., McMahon, A., Sussman,
D. J., and Wu, D. (1999) J. Biol. Chem. 274, 129–134
31. Boutros, M., Paricio, N., Strutt, D. I., and Mlodzik, M. (1998) Cell 94,
109–118
32. Angers, S., Thorpe, C. J., Biechele, T. L., Goldenberg, S. J., Zheng, N.,
MacCoss, M. J., and Moon, R. T. (2006) Nat. Cell Biol. 8, 348–357
33. Klein, T. J., Jenny, A., Djiane, A., and Mlodzik, M. (2006) Curr. Biol. 16,
1337–1343
34. Klimowski, L. K., Garcia, B. A., Shabanowitz, J., Hunt, D. F., and Virshup,
D. M. (2006) FEBS J. 273, 4594–4602
35. Itoh, K., Brott, B. K., Bae, G. U., Ratcliffe, M. J., and Sokol, S. Y. (2005)
J. Biol. 4, 3
36. Jenny, A., Reynolds-Kenneally, J., Das, G., Burnett, M., and Mlodzik, M.
(2005) Nat. Cell Biol. 7, 691–697
37. Lee, Y. N., Gao, Y., and Wang, H. Y. (2008) Cell. Signal. 20, 443–452
38. Gao, Y., and Wang, H. Y. (2006) J. Biol. Chem. 281, 18394–18400
39. Khan, Z., Vijayakumar, S., de la Torre, T. V., Rotolo, S., and Bafico, A.
(2007) Mol. Cell. Biol. 27, 7291–7301
40. Yamamoto, H., Komekado, H., and Kikuchi, A. (2006) Dev. Cell 11,
213–223
41. Witte, F., Bernatik, O., Kirchner, K., Masek, J., Mahl, A., Krejci, P., Mundlos,
S., Schambony, A., Bryja, V., and Stricker, S. (2010) FASEB J. 24,
2417–2426
42. Lee, J. S., Ishimoto, A., and Yanagawa, S. (1999) J. Biol. Chem. 274,
21464–21470
43. Orford, K., Crockett, C., Jensen, J. P., Weissman, A. M., and Byers, S. W.
(1997) J. Biol. Chem. 272, 24735–24738
44. Dominguez, I., Mizuno, J., Wu, H., Imbrie, G. A., Symes, K., and Seldin,
D. C. (2005) Mol. Cell. Biochem. 274, 125–131
45. McKay, R. M., Peters, J. M., and Graff, J. M. (2001) Dev. Biol. 235, 388–396
46. Tauriello, D. V., Haegebarth, A., Kuper, I., Edelmann, M. J., Henraat, M.,
Canninga-van Dijk, M. R., Kessler, B. M., Clevers, H., and Maurice, M. M.
(2010) Mol. Cell 37, 607–619
Casein Kinases in Dishevelled Biology
10410 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286•NUMBER 12•MARCH 25, 2011
atKarolinskainstitutetlibrary,onMarch25,2011www.jbc.orgDownloadedfrom
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#13 
 
 
Chaki M, Airik R, Ghosh AK, Giles RH, Chen R, Slaats GG, Wang H, Hurd TW, Zhou W, 
Cluckey A, Gee HY, Ramaswami G, Hong CJ, Hamilton BA, Cervenka I, Ganji RS, Bryja V, 
Arts HH, van Reeuwijk J, Oud MM, Letteboer SJ, Roepman R, Husson H, Ibraghimov‐
Beskrovnaya O, Yasunaga T, Walz G, Eley L, Sayer JA, Schermer B, Liebau MC, Benzing T, 
Le  Corre  S,  Drummond  I,  Janssen  S,  Allen  SJ,  Natarajan  S,  O'Toole  JF,  Attanasio  M, 
Saunier S, Antignac C, Koenekoop RK, Ren H, Lopez I, Nayir A, Stoetzel C, Dollfus H, 
Massoudi R, Gleeson JG, Andreoli SP, Doherty DG, Lindstrad A, Golzio C, Katsanis N, 
Pape  L,  Abboud  EB,  Al‐Rajhi  AA,  Lewis  RA,  Omran  H,  Lee  EY,  Wang  S,  Sekiguchi  JM, 
Saunders R, Johnson CA, Garner E, Vanselow K, Andersen JS, Shlomai J, Nurnberg G, 
Nurnberg P, Levy S, Smogorzewska A, Otto EA, Hildebrandt F. (2012): Exome capture 
reveals  ZNF423  and CEP164 mutations,  linking  renal  ciliopathies  to  DNA  Damage 
response signaling. Cell. 150(3): 533‐48. 
 
 
Impact factor (2012): 31.957 
Times cited (without autocitations, WoS, Feb 21st 2014): 33 
Significance: Identification of CEP164 as a gene mutated in ciliopathies. Because it is 
known  that  CEP164  controls  cilia  formation  and  DNA  damage,  this  protein 
provided  a  link  between  these  two  processes  in  ciliopathies.  As  part  of  this 
project, interaction between CEP164 and Dvl3 was revealed. This aspect pointed 
towards the role of Dishevelled in the centrosomal biology. 
Contibution of the author/author´s team: Identification of CEP164‐Dvl interaction by 
mass spectrometry, identification of binding domains between the two proteins 
and  analysis  of  disease‐specific  CEP164  mutants  with  respect  to  its  interaction 
with Dvl3. 
 
 
   
 
 
 
Exome Capture Reveals ZNF423 and CEP164
Mutations, Linking Renal Ciliopathies
to DNA Damage Response Signaling
Moumita Chaki,1,39 Rannar Airik,1,39 Amiya K. Ghosh,1 Rachel H. Giles,3 Rui Chen,4 Gisela G. Slaats,3 Hui Wang,4
Toby W. Hurd,1 Weibin Zhou,1 Andrew Cluckey,1 Heon Yung Gee,1 Gokul Ramaswami,1 Chen-Jei Hong,6
Bruce A. Hamilton,6 Igor Cervenka,7 Ranjani Sri Ganji,7 Vitezslav Bryja,7,8 Heleen H. Arts,9 Jeroen van Reeuwijk,9
Machteld M. Oud,9 Stef J.F. Letteboer,9 Ronald Roepman,9 Herve´ Husson,10 Oxana Ibraghimov-Beskrovnaya,10
Takayuki Yasunaga,11 Gerd Walz,11 Lorraine Eley,12 John A. Sayer,12 Bernhard Schermer,13,14,16 Max C. Liebau,13,15
Thomas Benzing,13,14,16 Stephanie Le Corre,19 Iain Drummond,19 Sabine Janssen,1 Susan J. Allen,1
Sivakumar Natarajan,1 John F. O’Toole,20 Massimo Attanasio,21 Sophie Saunier,22 Corinne Antignac,22
Robert K. Koenekoop,23 Huanan Ren,23 Irma Lopez,23 Ahmet Nayir,24 Corinne Stoetzel,25 Helene Dollfus,25
Rustin Massoudi,26 Joseph G. Gleeson,26 Sharon P. Andreoli,27 Dan G. Doherty,28 Anna Lindstrad,29 Christelle Golzio,29
Nicholas Katsanis,29 Lars Pape,30 Emad B. Abboud,31 Ali A. Al-Rajhi,31 Richard A. Lewis,5 Heymut Omran,32
Eva Y.-H.P. Lee,33 Shaohui Wang,33 JoAnn M. Sekiguchi,2 Rudel Saunders,2 Colin A. Johnson,34 Elizabeth Garner,35
Katja Vanselow,36 Jens S. Andersen,36 Joseph Shlomai,18 Gudrun Nurnberg,14,17 Peter Nurnberg,14,17 Shawn Levy,37
Agata Smogorzewska,35 Edgar A. Otto,1 and Friedhelm Hildebrandt1,2,38,*
1Department of Pediatrics and Communicable Diseases
2Department of Human Genetics
University of Michigan, Ann Arbor, MI 48109, USA
3Department of Nephrology and Hypertension, University Medical Center, Utrecht, The Netherlands
4HGSC Department of Molecular and Human Genetics
5Department of Ophthalmology
Baylor College of Medicine, Houston, TX, USA
6Department of Medicine, Division of Medical Genetics, Department of Cellular and Molecular Medicine, and Institute for Genomic Medicine,
George Palade Laboratories, Room 256, UCSD School of Medicine, 9500 Gilman Drive, San Diego, CA 92093, USA
7Institute of Experimental Biology, Faculty of Science, Masaryk University, 61137 Brno, Czech Republic
8Department of Cytokinetics, Institute of Biophysics, Academy of Sciences of the Czech Republic 61265 Brno, Czech Republic
9Department of Human Genetics, Nijmegen Centre for Molecular Life Sciences and Institute for Genetic and Metabolic Disease, Radboud
University Nijmegen Medical Centre, 6525 GA, Nijmegen, The Netherlands
10Genzyme Corporation, Cell Biology, Framingham, MA 01701, USA
11Renal Division, University Freiburg Medical Center, 7900 Freiburg, Germany
12Institute of Genetic Medicine, Newcastle University, Newcastle upon Tyne, NE1 3BZ, UK
13Department II of Internal Medicine and Center for Molecular Medicine
14Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases
15Department of Pediatrics and Adolescent Medicine
16Systems Biology of Aging
17Cologne Center for Genomics and for Molecular Medicine
University of Cologne, 50937 Cologne, Germany
18Department of Microbiology and Molecular Genetics, The Institute for Medical Research Israel-Canada (IMRIC), Faculty of Medicine,
The Hebrew University-Hadassah Medical School, Jerusalem, 91120 Israel
19Nephrology Division, Massachusetts General Hospital and Department of Genetics, Harvard Medical School, Charlestown, MA 02129, USA
20Division of Nephrology, Department of Internal Medicine, MetroHealth Medical Center, and Case Western Reserve University School of
Medicine, Cleveland, OH 44109-1998, USA
21Department of Internal Medicine and Eugene McDermott Center for Growth and Development, University of Texas Southwestern Medical
Center, Dallas TX 75390, USA
22Inserm U983, Paris Descartes University, Hoˆ pital Necker-Enfants Malades, Assistance Publique-Hoˆ pitaux de Paris, Paris, France
23McGill Ocular Genetics Laboratory, Montreal Children’s Hospital, McGill University Health Centre, Montreal, H3H 1P3, Canada
24Department of Pediatric Nephrology, Faculty of Medicine, University of Istanbul, Istanbul, Turkey
25Laboratoire de Ge´ ne´ tique Me´ dicale EA3949, Equipe AVENIR-Inserm, Faculte´ de Me´ decine, Universite´ de Strasbourg, 11 rue Humann,
67000 Strasbourg, France
26Howard Hughes Medical Institute, Department of Pediatrics, University of California, San Diego, La Jolla, CA 92093, USA
27Department of Pediatrics, James Whitcomb Riley Hospital for Children, Indiana University Medical Center, Indianapolis, IN 46202, USA
28Division of Genetic Medicine, Department of Pediatrics, University of Washington, Center for Integrative Brain Research, Seattle Children’s
Hospital, Seattle, WA, 98101 USA
29Center for Human Disease Modeling, Duke University Medical Center, Durham, NC 27710, USA
30Department of Pediatric Nephrology, Hannover Medical School, Hannover 30625, Germany
31King Khaled Eye Specialist Hospital, Riyadh 11462, Kingdom of Saudi Arabia
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 533
32Klinik und Poliklinik fu¨ r Kinder- und Jugendmedizin, Allgemeine Pa¨ diatrie, Universita¨ tsklinikum Mu¨ nster, Mu¨ nster 48149, Germany
33University of California Irvine, Department of Biological Chemistry, Irvine, CA 92697, USA
34Leeds Institute of Molecular Medicine, St James’s University Hospital, Leeds, LS9 7TF, UK
35Laboratory of Genome Maintenance, The Rockefeller University, New York, NY 10065, USA
36Department of Biochemistry and Molecular Biology, University of Southern Denmark, DK-5230, Odense, Denmark
37HudsonAlpha Institute for Biotechnology, 601 Genome Way, Huntsville, AL 35806, USA
38Howard Hughes Medical Institute, Chevy Chase, MD 20815, USA
39These authors contributed equally to this work
*Correspondence: fhilde@umich.edu
http://dx.doi.org/10.1016/j.cell.2012.06.028
SUMMARY
Nephronophthisis-related ciliopathies (NPHP-RC)
are degenerative recessive diseases that affect
kidney, retina, and brain. Genetic defects in NPHP
gene products that localize to cilia and centrosomes
defined them as "ciliopathies.’’ However, disease
mechanisms remain poorly understood. Here, we
identify by whole-exome resequencing, mutations
of MRE11, ZNF423, and CEP164 as causing NPHPRC.
All three genes function within the DNA damage
response (DDR) pathway. We demonstrate that,
upon induced DNA damage, the NPHP-RC proteins
ZNF423, CEP164, and NPHP10 colocalize to nuclear
foci positive for TIP60, known to activate ATM at
sites of DNA damage. We show that knockdown of
CEP164 or ZNF423 causes sensitivity to DNA damaging
agents and that cep164 knockdown in zebrafish
results in dysregulated DDR and an NPHP-RC
phenotype. Our findings link degenerative diseases
of the kidney and retina, disorders of increasing prevalence,
to mechanisms of DDR.
INTRODUCTION
Nephronophthisis (NPHP) is a recessive cystic kidney disease
that represents the most frequent genetic cause of end-stage
kidney disease in the first three decades of life. NPHP-related ciliopathies
(NPHP-RC) are single-gene recessive disorders that
affect kidney, retina, brain, and liver by prenatal-onset dysplasia
or by organ degeneration and fibrosis in early adulthood. Identification
of recessive mutations in more than ten different genes
(NPHP1-NPHP13) revealed that their gene products share localization
at the primary cilia-centrosomes complex and mitotic
spindle poles in a cell-cycle-dependent manner, characterizing
them as retinal-renal ‘‘ciliopathies’’ (Ansley et al., 2003; Hildebrandt
et al., 2011). Multiple signaling pathways downstream
of cilia have been implicated in the disease mechanisms of
NPHP-RC, including Wnt signaling (Germino, 2005; Simons
et al., 2005) and Shh signaling (Huangfu and Anderson, 2005;
Huangfu et al., 2003). However, despite convergence of ciliopathy
pathogenesis at cilia and centrosomes it remains largely
unknown what signaling pathways downstream of cilia and
centrosome function operate in the disease mechanisms that
generate the NPHP-RC phenotypes.
Centrosomal proteins have been recently implicated in DNA
damage response (DDR). Both pericentrin (PCNT), a core centrosomal
protein (Doxsey et al., 1994), as well as CEP152,
encoding a centrosomal protein required for centriolar duplication
(Blachon et al., 2008), are defective in Seckel syndrome,
an autosomal-recessive disorder characterized by dwarfism,
microcephaly, and mental retardation (Griffith et al., 2008; Kalay
et al., 2011; Rauch et al., 2008). PCNT- and CEP152 mutant cells
are also defective in ATR-dependent DDR signaling, consistent
with the fact that the first mutation identified in Seckel syndrome
was in ataxia-telangiectasia mutated and RAD3-related (ATR),
a key phosphoinositide 3-kinase-related protein kinase involved
in DDR signaling (O’Driscoll et al., 2003), but the mechanism of
the signaling defect is not fully understood.
The known NPHP genes explain less than 50% of all cases
with NPHP-RC, and many of the single-gene causes of NPHPRC
are still unknown (Otto et al., 2011). The finding that some
of the recently identified genetic causes of NPHP-RC are exceedingly
rare (Attanasio et al., 2007) necessitates the ability to
identify novel single-gene causes of NPHP-RC in single affected
families. To achieve this goal, we developed a strategy that
combines homozygosity mapping (HM) with whole-exome resequencing
(WER) (Otto et al., 2010). Because this approach allows
identification of multiple different causes of NPHP-RC within
a short time frame, it has the potential of delineating pathogenic
pathways.
Using this approach, we identify here mutations in three
NPHP-RC genes, MRE11, ZNF423, and CEP164, which together
suggest involvement of a DDR signaling pathway in NPHP-RC
pathogenesis.
RESULTS
Whole-Exome Resequencing Accelerates Discovery of
NPHP-RC Genes
Identification of monogenic causes of ciliopathies is limited by
their rarity (Attanasio et al., 2007), necessitating methods to identify
ciliopathy-causing genes in single families by using WER.
However, WER typically yields hundreds of variants from normal
reference sequence (Ng et al., 2009), whereas only a single-gene
mutation will represent the disease cause. To overcome this limitation,
we here combined WER with HM (Hildebrandt et al., 2009)
in sib pairs affected with NPHP-RC and performed functional
analysis of the identified genes (Otto et al., 2010).
534 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
HM yielded positional candidate regions of homozygosity by
descent (Hildebrandt et al., 2009) in families A3471 (two regions),
F874 (nine regions), and KKESH001-7 (14 regions) (Figure 1),
who had one or more features of NPHP-RC, including NPHP,
retinal degeneration, liver fibrosis, or cerebellar degeneration/
hypoplasia (Table 1). We then performed WER in one affected
individual of each of the three NPHP-RC families (Ng et al.,
2009; Otto et al., 2010). Remarkably, each of three NPHP-RC
A B
C D
E F
Figure 1. Identification of Recessive Mutations in MRE11, ZNF423, and CEP164 in NPHP-RC Using HM and WER
Data regarding HM and mutations are shown for family A3471 with MRE11 mutation (A and B), family F874 with ZNF423 mutation (C and D), and family KKESH001
with CEP164 mutation (E and F). (A, C, and E) Nonparametric lod scores (NPL) are plotted across the human genome in three families (A3471, F874, and
KKESH001) with NPHP-RC (see also Table 1). The x axis shows SNP positions on human chromosomes concatenated from p-ter (left) to q-ter (right). Genetic
distance is given in cM. Maximum NPL peaks (Hildebrandt et al., 2009) (red circles) indicate candidate regions of homozygosity by descent. The genes MRE11,
ZNF423, and CEP164 are positioned (arrow heads) within one of the maximum NPL peaks. (B, D, and F) Homozygous mutations detected in families with NPHPRC.
Family number (underlined), mutation (arrowheads), and predicted translational changes (in parenthesis) are indicated (see also Table 1). Sequence traces
are shown for mutations above normal controls. (For additional mutations in other families see also Table 1 and Figure S2).
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 535
Table1.MutationsofMRE11,ZNF423andCEP164infamilieswithNPHP-RC
FamilyIndividuals
Ethnic
Origin
Nucleotide
Alterationa,b
(Hg19Position)
Deduced
Protein
Change
Exon
(State)
ContinuousAmino
AcidSequence
Conservation
Parental
Consanguinity
Kidney
(AgeatESKF)Eye(AgeatRD)Other(atAge)
MRE11
A3471-21and-22Pakistanic.1897C>T
(Chr11:94,170,372)
p.R633X16(hom)N/AYesNorenalfailureNormal-21:-21:CVA(MRI),ataxia,
dysarthria,myoclonus;
-22:CVA(MRI),ataxia
ZNF423
F874-21and-22Turkeyc.2738C>T(Chr16:
49,670,325)
p.P913L5(hom)(D.rerio)YesNPHPNDCVHInfantileNPHP
Situsinversus
A106-21and-22Icelandc.1518delC(Chr16:
49,671,545)
p.P506fsX435(het)(X.tropicalis)NoPKDLCACVH(Joubert)
A111-21?c.3829C>T(Chr16:
49,525,212)
p.H1277Y9(het)(D.rerio)?PKDRDCVH,NPHP,perinatal
breathingabnormality,
tonguetumor
CEP164
F319-21and-22Turkeyc.32A>C(Chr11:
117,209,334)
p.Q11P3(hom)(Ch.Reinhardtii)YesNPHP,noBx;
-21:(8years);
-22:(8years)
-21:RD(11yr,
notyetblind);-22:
noRPat8yrs
-21:obesity?no
LF;-22:obesity?LF?
F59-21,-22,-23USA
(Europe)
c.277C>T,(Chr11:
117,222,588)
c.1573C>T(Chr11:
117,252,580)
p.R93W,
p.Q525X
5(het),
13(het)
(Ch.Reinhardtii),
N/A
NoNPHP,noBx;
-21:(9years);
-22:(8years);
-23:normal
-21:RD(6years);
-22:LCA(legally
blindat5months);
-23:(2years)
-22:NY(birth),
mildAI;-23:seizuresc
,
substantialDD,mildID
NPH505NDc.1726C>T(Chr11:
117,257,920)
p.R576X15(hom)N/AYesNPHP,Bx(8yr)RDandflatERG
(notblind)
CVH,FD,bilateralPD,
bronchiectasis(1mo),
abnormalLFT,obesity
KKESH001-7Saudic.4383A>G(Chr11:
117,282,884)
p.X1460W
extX57
33(hom)N/AYesnormal(RD)LCA,flat
ERG(blind<2yr)
N/A
AI,aorticinsufficiency;Bx,Kidneybiopsy;CVH,cerebellervermishypoplasia;DD,developmentaldelay;ERG,electroretinogram;ESKF,end-stagekidneyfailure;FD,facialdysmorphism;het,
heterozygous;hom,homozygous;ID,intellectualdisability;LCA,Lebercongenitalamaurosis;LF,liverfibrosis;LFT,liverfunctiontests;MRI,magneticresonanceimaging;N/A,notapplicable;
ND,nodata;NPHP,nephronophthisis;NPHP-RC,nephronophthisis-relatedciliopathies;NY,nystagmus;PD,polydactyly;RD,retinaldegeneration;SS,shortstature.
a
Allmutationswereabsentfrom>270healthycontrolindividualsandfromtheESPExomeVariantServerdatabase,excepttheCEP164variantp.R576X(allelefrequencyinEuropeanAmericans
1/7,019).
b
cDNAmutationnumberingisbasedonhumanreferencesequencesNM_014956.4forMRE11,NM_015069.2forZNF423,andNP_055771forCEP164,where+1correspondstotheAofATG
starttranslationcodon.
c
Seizureswereintractable,generalizedand/orpartialcomplex.
536 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
genes consecutively identified by this approach, MRE11,
ZNF423, and CEP164, suggested a functional connection to
the DDR pathway (Figure 1; Table 1).
A Mutation of MRE11 in Progressive Cerebellar
Degeneration Suggests Link to DDR
In family A3471, two siblings had cerebellar vermis hypoplasia
(CVH), a central feature of NPHP-RC (Table 1). Homozygosity
mapping yielded two candidate loci (Figure 1A). WER detected
a homozygous truncation mutation (p.R633X) of MRE11 (Figure
1B; Table 1) previously described for CVH in another Pakistani
family (Stewart et al., 1999), suggesting a founder effect for
this allele. MRE11 is an essential component of the ATM-Chk2
pathway of DDR (Figure S1 available online), where it recruits
ATM (ataxia telangiectasia-mutated) to sites of DNA doublestrand
breaks (Figure S1A). Rediscovery of this MRE11 mutation
in family A3471 thus generated an unexpected link between
NPHP-RC phenotype and the ATM pathway of DDR signaling
(Figure S1A).
Patients with the NPHP-RC Joubert Syndrome Have
Defects in ZNF423
Another link of NPHP-RC to the ATM pathway of DDR signaling
emerged from HM and WER in two siblings (F874) with infantile
onset NPHP, CVH, and situs inversus (Table 1). SNP mapping
yielded nine candidate regions of homozygosity by descent (Figure
1C). We identified in both affected individuals a homozygous
missense mutation (p.P913L; conserved in vertebrates) of
ZNF423 (Figure 1D). In addition, when examining 96 additional
Joubert syndrome (JS) subjects, we detected two heterozygous-only
mutations of ZNF423: p.P506fsX43 in family A106
and p.H1277Y in individual A111-21 (Table 1). Mutations of the
mouse ortholog Zfp423 cause reduced proliferation and abnormal
development of midline neural progenitors resulting in a
loss of the cerebellar vermis (Alcaraz et al., 2006; Cheng et al.,
2007) similar to that seen in JS patients with CVH.
ZNF423 encodes a protein with 30 zinc fingers (Figure 2A).
Mouse models display phenotypic variability that is subject
to modifier genes, environment, and stochastic effects (Alcaraz
et al., 2011; Alcaraz et al., 2006), consistent with the variable
presentations of NPHP-RC patients. The homozygous mutation
p.P913L, located between zinc fingers 21 and 22 (Figure 2A),
most likely exerts recessive loss-of-function, analogous to the
Zfp423 mouse models.
We next examined whether the heterozygous-only mutations
(Table 1) lead to loss of function via a dominant mechanism,
using a proliferation assay in P19 cells (Figures 2B–2D). Mutations
were engineered into a FLAG-tagged ZNF423 cDNA and
assayed by a S-phase index, defined as the proportion of transfected
cells that incorporate BrdU in 1 hr, 48 hr after transfection.
Simple loss-of-function alleles should not interfere with endogenous
Zfp423 activity in this assay. Indeed, overexpression of
either wild-type or the homozygous p.P913L allele had no effect
(Figure 2D). However, transfection with either the p.P506fsX43
frame-shifting allele, which removes the zinc fingers required
for SMAD (similar to mothers against decapentaplegic) and
EBF (early B cell factor) interactions, and the H1277Y substitution
allele, which destroys the terminal zinc finger required for
EBF interaction, reduced the mitotic index to little more than
half that of cells transfected with green fluorescent protein
(GFP) control vector or other alleles of ZNF423 (Figures 2B–
2D). A dominant mechanism is plausible for the two heterozygous
mutations, as each is predicted to interfere selectively
with a subset of interaction domains (Figure 2A). Neither subject
had siblings, and DNA from parents was not available to determine
whether the mutations occurred de novo.
We detected five additional putative mutations in highly conserved
(including histidine knuckle) residues of ZNF423 among
JS families (Table S1). Although these mutations have not been
confirmed functionally, the high incidence of predicted deleterious
mutations found in patients but absent from 270 healthy
control individuals, dbSNP, and 1000 Genomes Project data
further support identification of ZNF423 as a causal gene in
NPHP-RC and JS.
ZNF423/OAZ was recently shown to interact with the DNA
ds-damage sensor PARP1 (poly-ADP ribosyl polymerase 1) (Ku
et al., 2003), which recruits MRE11 and ATM to sites of DNA
damage (Figure S1A). This indirectly linked ZNF423 to the ATM
pathway of DNA damage signaling (Figure S1A). We therefore
tested whether ZNF423 mutations affect interaction between
ZNF423 and PARP1. Coimmunoprecipitation verified the association
of ZNF423 and PARP1 in reciprocal assays (Figure 2E).
More importantly, the truncating mutation P506fsX43, which
we detected in a JS patient (Table 1), abrogates this interaction
(Figure 2E), whereas H1277Y inhibits multimerization of ZNF423
(Figure 2E). In addition, depletion of ZNF423 mRNA caused
sensitivity to DNA damaging agents (see below).
Furthermore, we identified ZNF423 as a direct interaction
partner of CEP290/NPHP6, which is mutated in NPHP-RC (Sayer
et al., 2006; Valente et al., 2006). In a yeast two-hybrid screen
of human fetal brain library with a CEP290 (JAS2; amino acids
1917–2479) ‘‘bait’’ we found three in-frame ‘‘prey’’ sequences
corresponding to ZNF423 (amino acids 178-406). This interaction
was confirmed (Figures 2F and 2G). CEP290/NPHP6 is known to
interact with the NPHP-RC protein NPHP5 (Scha¨ fer et al., 2008)
and localizes to the ciliary transition zone (Sang et al., 2011).
Mutations of CEP164 Cause NPHP-RC
We obtained 14 candidate regions by HM in a Saudi family
(KKESH001) of first-cousin parents with a child who had LCA
(which can be allelic with NPHP-RC) with nystagmus, hyperopic
discs, vascular attenuation, diffuse retinal pigment epithelium
atrophy, and nonrecordable ERG (Table 1) (Figure 1E). Using
WER we detected a homozygous point mutation in CEP164
(centrosomal protein 164 kDa) that abolished the termination
codon, adding 57 amino acid residues to the open reading frame
(p.X1460WextX57) (Figure 1F, Table 1). The mutation was absent
from 96 Saudi healthy controls and from 224 North American
LCA patients who lack mutations in other known LCA genes.
We performed exon-PCR and Sanger sequencing of all 31
coding exons for one affected individual in each of 856 different
NPHP-RC families (see Extended Experimental Procedures). We
detected both mutated CEP164 alleles in each of three additional
families with NPHP-RC (Table 1; Figure S2). We thereby identified
recessive mutations of CEP164 as an additional cause of
NPHP-RC. Because of the significant overlap of phenotypic
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 537
features with other forms of NPHP-RC we introduce the alias
‘‘NPHP14’’ for ZNF423 and ‘‘NPHP15’’ for the CEP164 protein.
Although the number of families with CEP164 mutation is
small, our findings support a gradient of genotype-phenotype
correlations characteristic of NPHP-RC (Table 1), in which null
mutations cause the severe dysplastic phenotypes of Meckel
syndrome and JS, whereas hypomorphic alleles cause the
milder degenerative phenotypes of NPHP and SLSN (Hildebrandt
et al., 2011). CEP164 is transcribed into three common
isoforms (Figures S2A–S2C) and is part of the photoreceptor
sensory cilium proteome (Liu et al., 2007). To study subcellular
localization of the CEP164 protein, we utilized antibodies against
human CEP164 for immunoblotting and immunofluorescence
(Figure S3).
Mutation of CEP164 Interferes with Ciliogenesis
By confocal microscopy of GFP-labeled CEP164 protein with
other labels, we show that CEP164 colocalizes in hTERTRPE
cells with the mother centriole, with the mitotic spindle
poles, and with the abscission structure in a cell-cycle-dependent
way (Figure S4), a feature characteristic of proteins involved
in single-gene ciliopathies (Otto et al., 2010; Graser
A
B C D
E
F
G
Figure 2. Two ZNF423 Mutations Have
Dominant Negative Characteristics, ZNF423
Mutation Abrogates Interaction with PARP1,
and ZNF423 Directly Interacts with the
NPHP-RC Protein CEP290/NPHP6
(A) Amino acid residues altered by NPHP-RC
mutations in ZNF423 are drawn in relation to functional
annotation of its 30 Zn-fingers.
(B–D) S-phase index assay (fraction of transfected
cells incorporating BrdU) for P19 cells transfected
with either wild-type or mutant ZNF423. (B)
Representative field of cells transfected with wildtype
ZNF423 shows high frequency of BrdU+
FLAG+
double-positive cells. (C) ZNF423–H1277Y
transfected cells exhibits fewer FLAG–positive cells
and a lower proportion that are double positive. (D)
S-phase index measured in duplicate transfections
for each of three DNA preparations per construct. A
GFP construct was used as a nonspecific control.
Constructs with P506fsX43 and H1277Y mutations
detected in NPHP-RC show significantly reduced
S-phase index (p < 10À5
, ANOVA with post-hoc
Tukey honestly significant difference [HSD]).
(E) ZNF423 interacts with PARP1. P19 cells were
cotransfected with expression constructs for N
terminally FLAG-tagged human full-length ZNF423
and V5-tagged human full length PARP1. Comparable
amounts of both proteins were present in all
lysates (lower panels). Proteins were precipitated,
using anti-V5 (upper panels) and anti-FLAG antibodies
(middle panels), respectively. Reciprocal
coIP demonstrates interaction between ZNF423
and PARP1. Note that the ZFN423 mutation
P506fsX43 abrogates this interaction (arrowhead)
and that mutation H1277Y diminishes ZNF423
multimerization (arrow).
(F–G) ZNF423 directly interacts with CEP290/
NPHP6. (F) A human fetal brain yeast two-hybrid
library screened with human CEP290/NPHP6
(JAS2; aa 1917–2479) fused to the DNA-binding
domain of GAL4 (pDEST32) identified ZNF423
as a direct interaction partner of CEP290/NPHP6.
The interaction was confirmed using direct yeast
two-hybrid assay where 1 and 2 represent colony
growth of CEP290 bait with ZNF423 prey. a–e are
controls for colony growth on medium deficient
in histidine, leucine and tryptophan. (G) HEK293T
were cotransfected with human V5-tagged partial
human V5-CEP290 clone and GFP-tagged fulllength
human ZNF423 clone. Immunoprecipitation
with anti-V5 (lane 2), but not control IgG (lane 3)
precipitated both the V5-tagged CEP290 (arrowhead)
as well as GFP-tagged ZNF423 (arrow).
538 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
et al., 2007) and that this colocalization is abrogated by
mutations (Figure 3, Figures S3C–S3F). We thus demonstrated
lack of centrosomal localization for the truncating mutation
p.Q525X and for an equivalent of the p.X1460WextX57
mutation.
Loss of function of several genes that cause nephronophthisis
in NPHP-RC cause disruption of 3D architecture of renal epithelial
cell culture (Otto et al., 2010; Sang et al., 2011). To evaluate
CEP164 by this criterion, we transfected murine kidney IMCD3
cells with siRNA oligonucleotides against murine Cep164, or
random sequences (Ctrl) in 3D spheroid growth assays. Cells
transfected with siCep164 developed spheroids with overall
normal architecture and size, but with markedly reduced
frequency of cilia (Figures 3E–3H). We conclude that Cep164
affects ciliogenesis or maintenance but that the overall architecture
of renal 3D growths is not as grossly affected as we have
previously seen for knockdown of other NPHP-RC genes
(Sang et al., 2011).
A
B
C
D
E
F
G
H
Figure 3. Expression of Mutant CEP164 in
Renal Epithelial Cells Abrogates Localization
to Centrosomes
(A) Immunofluorescence using a-SDCCAG8/
NPHP10-CG antibody in MDCK cells, labels
both centrioles, whereas a-CEP164-ENR antibody
demonstrates CEP164 staining at the mother
centriole only.
(B) Inducible overexpression of N terminally
GFP-tagged human full-length CEP164 isoform
1 (NGFP-CEP164-WT) in IMCD3 cells demonstrates,
in addition to a cytoplasmic expression
pattern, localization at one of the two centrioles
(inset, arrow heads) consistent with selective
localization to the mother centriole (Graser et al.,
2007). Both centrioles are stained with an anti-gtubulin
antibody.
(C) In contrast, the centrosomal signal is abrogated
upon overexpression of an N terminally
GFP-tagged truncated CEP164 construct representing
the mutation p.Q525X.
(D) The number of centrosomes positive for
CEP164 is reduced upon overexpression of C
terminally GFP-tagged human full-length CEP164
isoform 1 (CGFP-hCEP164-WT), which mimics
the mutation p.X1460WextX57 that causes a readthrough
of the stop-codon X1460, adding 57
aberrant amino acid residues to the C terminus of
CEP164. Similar data were obtained upon CEP164
expression in hTERT-RPE cells (see also Figures
S3B–S3D). IMCD3 cells were stably transfected
with the respective CEP164 constructs in a retroviral
vector for doxycyclin-inducible expression
(pRetroX-Tight-Pur). Scale bars, 10 mm.
(E–H) Knockdown of Cep164 disrupts ciliary
frequency. (E) Depletion of Cep164 by siRNA (F)
causes a ciliary defect in 3D spheroid growth
assays. IMCD3 cells transfected with either siCtrl or
siCep164 were grown to spheroids in 72 hr and
immunostained for acetylated tubulin (red). DAPI
stains nuclei (blue). Doxycycline induced stably
transfected NGFP-hCEP164-WT (green).Space bar
represents 5 mm. (G) Nuclei and cilia were scored
within a single spheroid to generate ciliary frequencies.
siCep164 transfected cells manifest lower cilia
frequencies (33%) compared to control transfected
IMCD3 cells (49%). Induction of NGFP-hCEP164WT
in siCep164 transfected cells rescues this ciliary
defect (57%). 50 spheroids per condition were
analyzed in three independent experiments. Error
bars represent SEM, n = 3, *p value < 0.0002. (H)
Ciliary frequency is not rescued by mutant CEP164.
Ciliary frequencies are reduced in siCep164 transfected IMCD3 cells (39%) compared to control siCtrl transfected IMCD3 cells (54%). Induction of NGFP-hCEP164Q525X
does not rescue this ciliary defect (34%). 50 spheroids per condition were analyzed. Error bars represent SEM, ***p value < 0.0002.
See also Figure S3.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 539
NPHP-RC Proteins Colocalize with the DDR Protein
TIP60 to Nuclear Foci
A noncentrosomal localization for CEP164 was described by
demonstrating its translocation to nuclear foci in response to
DNA damage (Pan and Lee, 2009; Sivasubramaniam et al.,
2008). CEP164 plays a role in DDR signaling where it interacts
with the DDR protein ATRIP (Figure S2C), is activated by the
DDR proteins ATM and ATR, and is necessary for checkpoint-
1 (Chk1) activation. Abrogation of CEP164 function leads to
loss of G2/M cell-cycle checkpoint and aberrant nuclear divisions
(Sivasubramaniam et al., 2008).
Localization of SDCCAG8 (alias NPHP10) (Otto et al., 2010),
shows nuclear foci in hTERT-RPE cells in addition to its centrosomal
localization (Figures 4B–4C). Transient shRNA knockdown
confirmed specificity of the signal (Figures S4B–S4D).
SDCCAG8/NPHP10 did not colocalize with markers for PLM
bodies (Janderova´ -Rossmeislova´ et al., 2007) or CENP-C
(marking chromosomal centromeres) (Figures S5A and S5B). In
contrast, SDCCAG8/NPHP10 fully colocalized with SC35 in
hTERT-RPE cells (Figures 4A–4C). SC35, also known as
serine/arginine-rich splicing factor 2 (SRSF2), plays a role in
DDR by controlling cell fate decisions in response to DNA
damaging agents (Edmond et al., 2011; Reinhardt et al., 2011).
SC35 marks hubs of enhanced gene expression (Szczerbal
and Bridger, 2010), is phosphorylated by topoisomerase I (Elias
et al., 2003), and is required for genomic stability during mammalian
organogenesis (Xiao et al., 2007). Moreover, ZNF423 also
fully colocalizes (Figure 4D), and CEP164 partially colocalizes
(Figure 4E) with SC35 in nuclear foci. Consequently, ZNF423
and CEP164 also colocalize with SDCCAG8/NPHP10 in SC35positive
nuclear foci (Figures 4F and 4G).
SC35 functions within a TIP60 complex, in which TIP60 acetylates
SC35 on lysine 52 (Figure S1B), modifying the role of SC35
in the promotion of apoptosis and inhibition of G2/M arrest (Edmond
et al., 2011), which is regulated by the checkpoint proteins
Chk1 and Chk2 (Figure S1D). Interestingly, the TIP60 protein, together
with the heterotrimeric MRN complex (of which MRE11
is a component) constitutes the major activator of ATM within
the ATM pathway of DDR signaling (Ciccia and Elledge, 2010)
(Figure S1A). In hTERT-RPE cells the ATM activator TIP60 colocalizes
to nuclear foci with SC35/SRSF2 (Figure 4H) and partially
with the identified NPHP-RC protein CEP164 (Figure 4I). We
thus identify a group of NPHP-RC proteins and demonstrate
that they colocalize to nuclear foci with the DDR proteins TIP60
and SC35. These gene products include the identified NPHPRC
proteins ZNF423 and CEP164 as well as SDCCAG8/
NPHP10. Interestingly, the protein OFD1, which is mutated in
the ciliopathy oral-facial-digital syndrome, is part of the TIP60
complex. We recently identified OFD1 as a direct interaction
partner of SDCCAG8/NPHP10 (Figure S1B) (Otto et al., 2010).
Cep164 Associates with DDR Proteins and Its Loss
Causes DDR Defects
Because one of the central mechanisms controlled by DDR
signaling is cell-cycle regulation through phosphorylation of
checkpoint-1 (Chk1) and checkpoint-2 (Chk2) proteins (Figure
S1D), we tested whether Chk proteins are recruited to
SC35/SRSF2-positive nuclear foci. SC35 and p317-Chk1 colocalize
to nuclear foci in hTERT-RPE cells (Figure 4J). We then
tested whether localization of CEP164 to nuclear foci was inducible
by DNA damage. Following irradiation with 20–50 J/m2
of
UV light, CEP164-positive nuclear foci condensed to larger
size and colocalized with TIP60 and Chk1 to foci of similar size
(Figures 4K–4O). TIP60 and p317-Chk1 colocalized within these
foci (Figure 4P). We thus demonstrate that CEP164 translocates
in response to DNA damage to nuclear foci that contain the DDR
proteins TIP60 and Chk1.
Lagging chromosomes on anaphase spindles (‘‘anaphase
lag’’) are a hallmark of many mutations that affect mitotic checkpoint
integrity. We show that siCep164 knockdown in IMCD3
cells increased anaphase lag from 1% in siCtrl controls to 21%
in siCep164-treated cells (Figures 5A and 5B, p = 0.04). This
phenomenon was specific, since doxycycline-inducible expression
of WT-CEP164 during Cep164 siRNA knockdown reduced
the incidence of anaphase lag to just 4% (Figure 5B). These
data indicate a requirement for Cep164 at the G2/M checkpoint.
The DDR pathway can be activated by the CDK inhibitor
roscovitine, which also reduces Chk1 expression (Maude and
Enders, 2005). Roscovitine reduces the development of kidney
cysts in the Nphp9 mouse model, Jck (Bukanov et al., 2006).
We therefore tested the influence of roscovitine (targeting
CDK2, 5, 7 and 9) on DDR activation in IMCD3 cells. Immunofluorescence
shows increased uniform distribution of gH2AX (activated
H2AX phosphorylated at Ser139) in the nucleus of IMCD3
cells upon roscovitine treatment in irradiated cells, indicating
partial DDR activation (Figure 5C). Second, in cells treated with
roscovitine, UV irradiation caused enhanced gH2AX staining
with a prominent nuclear foci pattern, characteristic of strong
DDR activation (Figure 5D). Immunoblotting showed that roscovitine
decreased the amount of CEP164 present in both control
and UV-irradiated cells (Figures 5E and 5F). This was most likely
due to translocation of CEP164 into the nucleus upon roscovitine
treatment, as shown by subcellular fractionation (Figure 5F). As
expected, UV radiation increased phosphorylation of Chk1 at
Ser317 (p-Chk1) (Figure 5E), and roscovitine decreased Chk1
protein expression and abrogated UV-induced p-Chk1 in both
cytoplasm and nucleus (Figures 5G and 5H). These data indicate
that CDK inhibition by roscovitine causes nuclear translocation
of CEP164 and inhibits Chk1 activation. gH2AX activation by
roscovitine may restore cell-cycle control by Chk2 activation
instead (Maude and Enders, 2005).
Human Wild-Type CEP164 but Not Its NPHP-RC
Truncation Mutant Rescues IMCD3 Cell Proliferation
In clonally selected IMCD3 cells expressing wild-type human
CEP164 cDNA construct N-GFP-CEP164-WT under doxycycline
(Dox) control, depletion of endogenous mouse Cep164
retarded proliferation in comparison to either undepleted control
cells or undepleted cells that were Dox-induced to overexpress
N-GFP-CEP164-WT alone (Figure 5G). Cep164-depleted growth
was rescued by Dox-induced expression of human N-GFPCEP164-WT
(Figure 5G). Cells expressing truncated cDNA
construct N-GFP-CEP164-Q525X, modeling the NPHP-RC mutation
in family F59, exhibited retarded growth, even when the
endogenous Cep164 was present (Figure 5H), consistent with
a dominant negative effect. Further depletion of the endogenous
540 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Figure 4. Colocalization upon Immunofluorescence of the NPHP-RC Proteins SDCCAG8/NPHP10, ZNF423 and CEP164 to Nuclear Foci that
Are Positive for the DDR Signaling Proteins SC35, TIP60 and Chk1 in hTERT-RPE Cells
(A–G) Colocalization of NPHP-RC proteins with SC35 in nuclear foci. SDCCAG8/NPHP10 (A-C) and ZNF423 (D) fully colocalize to nuclear foci with SC35, and (E)
CEP164 partially colocalizes with SC35. SDCCAG8/ NPHP10 also colocalizes with the identified NPHP-RC proteins ZNF423 (F) and CEP164 (G).
(H–J) Colocalization of NPHP-RC proteins with the DDR protein TIP60 and Chk1 to nuclear foci. (H) TIP60 fully colocalizes with SC35. (I) TIP60 partially colocalizes
with CEP164. (J) Chk1 fully colocalizes with SC35/ SRSF2. DNA is stained in blue with DAPI. Scale bars, 5 mm.
(K–P) Colocalization of DDR and NPHP proteins upon induction of DDR by UV radiation in HeLa cells. (K) Following irradiation of HeLa cells with UV light at 20 J/m2
a strong immunofluorescence signal of an anti-gH2AX antibody indicates activation of DDR. (L–M) Upon irradiation with UV light, CEP164-positive nuclear foci
condense and colocalize with TIP60 foci of similar size. (N–O) In untreated cells (N) a pattern of broad CEP164 speckles, which are Chk1-negative and locate to
DAPI-negative domains, changes to a pattern of multiple smaller foci (O) that are double positive for both CEP164-N11 and Chk1. (P) p317-Chk1 fully colocalizes
with TIP60 to nuclear foci and to the centrosome (arrowhead).
See also Figures S4, S5A, and S5B.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 541
Figure 5. Knockdown of Cep164 Causes Anaphase Lag and Retarded Cell Growth
(A and B) Knockdown of CEP164 causes anaphase lag. siCep164 knockdown in IMCD3 cells increased anaphase lag incidence from 1% after siCtrl to 21% after
siCep164-treated cells (n > 250 anaphases, five independent experiments). CREST antiserum (red) and DAPI (blue) confirmed the presence of incomplete mitotic
congression and unattached kinetochores during late anaphase (white arrows). Doxycycline-inducible expression of WT-CEP164 during Cep164 siRNA
knockdown reduced the incidence of anaphase lag to 4%, whereas untransfected IMCD3 cells had no detectable anaphase lag (0%) (B). Bars represent SEM, p
values (Student’s t test) are indicated above the bar graph.
(C–F) The effect of roscovitine on UV-induced DDR. Cells were UV irradiated with 30 J/m2
and analyzed 1 hr after UV irradiation. Where indicated, cells were
preincubated for 24 hr with the CDK inhibitor roscovitine (80 mM). (C and D) Immunofluorescence analysis showed that roscovitine triggered uniform nuclear
542 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Cep164 in N-GFP-CEP164-Q525X-expressing cells showed an
additive effect on growth retardation, confirming the dominant
negative effect of N-GFP-CEP164-Q525X in this experimental
system (Figure 5H).
CEP164 Directly Interacts with CCDC92 and TTBK2
NPHP-RC proteins are known to interact with other NPHP-RC
proteins in the dynamic ‘‘NPHP-JS-MKS interaction network’’
(Sang et al., 2011).To identify novel direct interaction partners
of CEP164, we performed yeast two-hybrid screening. We identified
CCDC92 and TTBK2 as direct interactors of CEP164
(Figures S5C–S5J). Interactions between CEP164 and both partners
were validated by GST pull-down (Figure S5D) and coimmunoprecipitation
(Figures S5E–S5H). Immunofluorescence
showed that CCDC92 fully colocalizes with CEP164 at the
mother centriole (Figures S5I and S5J).
CEP164 also interacted with NPHP3 and weakly with NPHP4
(Figures S6A–S6B), demonstrating that CEP164 is in a complex
with other known NPHP-RC proteins (Figures S1A and S1B). The
DDR protein DDB1 interacted with NPHP2 (Figures S6C and
S6D). The disheveled protein (Dvl), which is a central component
of the Wnt pathway, interacts with NPHP2/inversin targeting
Dvl for proteasomal degradation, thereby triggering a switch
from canonical to noncanonical Wnt signaling (Germino, 2005;
Simons et al., 2005). We identify interaction between Dvl3 and
CEP164 (Figures S6E–S6H). Immunocytochemistry reveals that
endogenous Dvl3 and CEP164 share centrosomal localization
(Figure S6E). We demonstrate that GST-CEP164 (aa 2–195) is
sufficient to pull down endogenous Dvl3 from the cellular lysate
(Figure S6F). Domain mapping for Dvl3 suggests that CEP164
interacts with the proline-rich region of Dvl3, because only
mutants containing this sequence efficiently coimmunoprecipitate
with CEP164-GFP (Figure S6G). Interestingly, only wildtype
CEP164-mCherryRFP but not the NPHP-RC causing
mutant CEP164-Q525X detected in family F59 (Table 1) can be
efficiently immunoprecipitated with Dvl3 (Figure S6H), further
supporting its pathogenic role.
cep164 Loss of Function Causes NPHP-RC and DDR
Activation in Zebrafish
To test in a vertebrate model whether loss of cep164 function
results in both, an NPHP-RC phenotype as well as DDR activation,
we performed cep164 knockdown in zebrafish embryos
using morpholino-oligonucleotides (MOs) (Figure 6). A p53 MO
was injected to reduce off-target MO effects (Robu et al.,
2007). At 28 hr postfertilization (hpf) we observed the ciliopathy
phenotypes of ventral body axis curvature and cell death (Figure
6A–6C). Embryos showed increased expression of phosphorylated
gH2AX (Figures 6D and 6E). At 48 hpf, cep164 morphants
displayed the typical ciliopathy phenotype of abnormal
heart looping (Figures 6F–6I). At 72 hpf, embryos developed
further NPHP-RC phenotypes, including pronephric tubule cysts
(Figures 6J and 6K), hydrocephalus, and retinal dysplasia
(Figures 6L–6M).
Depletion of CEP164 or ZNF423(Zfp423) Causes
Sensitivity to DNA Damaging Agents
To assess whether depletion of CEP164 causes sensitivity to
DNA damage, Cep164 expression was stably suppressed in the
mouse renal cell line IMCD3 (Figures 6P and 6Q). Cep164 knockdown
resulted in a dose-dependent increase of gH2AX intensity
levelsina FACS analysis,signifyingincreasedradiationsensitivity
to IR and perturbed DDR. Cellular sensitivity to IR was also seen
in cells depleted of CEP164 using a multicolor competition assay
(MCA) (Smogorzewska et al., 2007) (Figures S7A and S7B).
To test whether ZNF423(Zfp423) affects DDR, we examined
P19 cells, which express high levels of endogenous Zfp423 (Figures
6R–6T). Replicate cultures infected with lentivirus expressing
either scrambled control or Zfp423-targeted shRNA were
exposed to 0–10 Gy of X-irradiation and imaged for Zfp423
and nuclear gH2AX foci (Figure 6R). Quantification showed significantly
increased gH2AX intensities in Zfp423-depleted cells
at lower (0.5 and 1.0 Gy) exposures (Figure 6S), but the effect
was nonsignificant when corrected for the number of exposures.
To determine whether sensitivity to lower dose is reproducible,
we exposed 32 additional cultures at 1.0 Gy (Figure 6T). Normalized
gH2AX fluorescence in Zfp423 knockdown had both higher
mean (9.6 versus 4.7) and median (6.6 versus 5.2) values than
control (Figure 6T). These data replicate the radiation sensitivity
with high significance (p = 0.018, Mann-Whitney U test, 2 tails),
indicating that P19 cells require Zfp423 for quantitatively normal
DDR. These results are further confirmed by multicolor competition
assays Figure S7C.
DISCUSSION
Disease Gene Identification Implicates NPHP-RC
Proteins in DDR
Many DDR signaling proteins localize to nuclear foci and
to centrosomes. In addition, dual localization of proteins at
distribution of gH2AX (activated H2AX phosphorylated at Ser139) in non-UV irradiated cells suggesting partial DDR activation (C). UV radiation caused enhanced
gH2AX staining with a prominent nuclear foci pattern, characteristic of strong DDR activation (D). (C and D) Error bars denote SEM.
(E and F) The effect of roscovitine on UV-triggered subcellular localization of CEP164 and Chk1. CEP164 and Chk1 proteins, along with nuclear marker Sam68
and cytoplasmic marker 14.3.3 were analyzed by Western blot. Roscovitine decreased the amount of CEP164 present in control and UV-irradiated cells (E). This
was most likely due to translocation of CEP164 into the nucleus upon roscovitine treatment as shown by subcellular fractionation (F). As expected, UV radiation
increased phosphorylation of Chk1 at Ser317 (p-Chk1) (E), and roscovitine decreased Chk1 protein expression and abrogated UV-induced p-Chk1 in both
cytoplasm and nucleus (E-F). Proteins 14.3.3 and Sam68 serve as controls for cytoplasmic versus nuclear fraction, respectively. See also Figure S6.
(G and H) Transient knockdown of Cep164 inhibits proliferation, which is rescued by wild-type but not mutant CEP164. In clonally selected and doxycycline (Dox)inducible
mouse IMCD3 cells siRNA knockdown was performed. (G) IMCD3 cells depleted of murine Cep164 grew more slowly (siRNA, green line) than
nondepleted cells (control, blue line) or the nondepleted cells induced to express human wild-type CEP164 (Dox, red line). Expression of WT Cep164 in siRNAdepleted
cells rescued the slow growth phenotype of Cep164 depletion (siRNA+
dox, purple line). (H) As in (G), except mutant Cep164 cDNA (CEP164-Q525X) was
expressed under doxycyclin control. Expression of this allele itself had a negative impact on cell growth (green line), suggesting a dominant negative effect. An
even greater negative effect was seen when the endogenous Cep164 was depleted in cells expressing CEP164-Q525X (siRNA+
dox, purple line). The average
counts are plotted with standard deviations. Asterisks indicate significant differences by unpaired Student’s t test (p < 0.05).
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 543
Figure 6. Knockdown of cep164 in Zebrafish Embryos Results in Ciliopathy Phenotypes, and Knockdown of Cep164 or Zfp423(Znf423)
Causes Sensitivity to DNA Damage
A morpholino-oligonucleotide (cep164 MO) targeting the exon 7 splice donor site of zebrafish cep164 was injected into fertilized eggs at the one to four-cells
stage together with p53 MO (0.2 mM) to minimize nonspecific MO effects.
544 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
centrosomes and at nuclear foci has been demonstrated for
multiple known DDR proteins related to ataxia or CVH. Individuals
with mutations in the three NPHP-RC-causing genes that
we identify here, MRE11, ZNF423, and CEP164, share the
NPHP-RC phenotypes of CVH and ataxia. The first protein that
strongly linked DDR signaling to the ataxia phenotype was the
protein ATM (ataxia telangiectasia mutated) (Savitsky et al.,
1995). Interestingly, we identify here in individuals with NPHPRC,
CVH and ataxia, mutations in proteins that colocalize to
nuclear foci with TIP60 and/or its interaction partner SC35.
These proteins are ZNF423, CEP164, and the previously identified
NPHP-RC protein SDCCAG8/NPHP10 (Otto et al., 2010).
Our findings support the notion that many products of genes,
which if mutated cause NPHP-RC and/or ataxia, play a role in
DDR and are part of a dynamic protein complex.
A DDR-Based Pathogenic Hypothesis of Dysplasia and
Degeneration in NPHP-RC
We here generate evidence that NPHP-RC proteins exhibit dual
localization at centrosomes and in nuclear foci and that they play
a role in DDR. We also demonstrate the parallel occurrence of
DDR defects with an NPHP-RC phenotype upon cep164 knockdown
in zebrafish. We therefore propose that defects in DDR
may participate in the pathogenesis of NPHP-RC. Whereas
multiple signaling pathways have been implicated in the pathogenesis
of NPHP-RC (Hildebrandt et al., 2011), including noncanonical
(Simons et al., 2005) and canonical Wnt signaling (Yu
et al., 2009), Shh signaling (Huangfu et al., 2003), and mitotic
spindle orientation (Fischer et al., 2006), none of them consistently
explains the phenotypes observed. In particular, none
of these mechanisms provides a model for the dichotomy of
dysplasia phenotypes resulting from null-alleles of NPHP-RC
genes versus degenerative phenotypes resulting from hypomorphic
alleles of the same NPHP-RC genes. Based on our findings
we here propose a pathogenic hypothesis for NPHP-RC that
implicates DDR signaling as a relevant disease mechanism.
Within this hypothesis, loss of function of NPHP-RC proteins
with a dual role in DDR and centrosomal signaling, would cause
disturbance of cell-cycle checkpoint control, which is particularly
detrimental for embryonic and adult progenitor cell survival.
This notion is in accordance with the orthologous mouse model
for ZNF423 loss of function, the Zfp423À/À
mouse, in which CVH
with ataxia is caused by defective granule progenitor proliferation
in the cerebellum (Alcaraz et al., 2006).
Within this pathogenic hypothesis for NPHP-RC, a DDR
signaling defect would lead to impairment of cell-cycle checkpoint
control, which in turn would cause lack of progenitor
cells. This hypothesis could lend a possible explanation to the
following persisting conundrum of NPHP-RC pathogenesis: in
certain NPHP genes (e.g., NPHP3, 6, or 8) null mutations cause
severe, congenital-onset phenotypes of dysplasia and malformation
in kidney, eye, CVH, and liver, whereas hypomorphic
mutations in the same gene cause only late-onset degenerative
phenotypes such as renal tubular degeneration and fibrosis
(nephronophthisis), retinal degeneration (Senior-Loken syndrome),
and liver fibrosis. However, the disease mechanisms
of neither the degenerative nor the dysplastic phenotypes are
understood. These findings suggest that null mutations act
during morphogenesis in embryonic development causing dysplasia
and malformation, whereas hypomorphic mutations act
during the ‘‘chronic’’ processes of tissue maintenance and
repair, which are spread out over months or years of the life of
an organism. Because DDR signaling is in high demand under
conditions of high proliferation during development (morphogenesis),
causing high ‘‘replication stress’’ to progenitor cells,
tissue dysplasia would be an expected pathogenic outcome.
Conversely, during tissue maintenance, low replication stress
would be expected, but persistent DDR impairment would allow
(A–E) Whereas p53 MO injection (n = 67) did not produce any phenotype (A), coinjection of cep164 MO at 28 hpf caused the mild ciliopathy phenotype of ventral
body axis curvature in 48% of embryos (60/125) (B). 50% of embryos (62/125) showed severe cell death throughout the body as judged by gray-appearing cells in
the head region (C). Embryos with severe cell death also showed increased expression of phosphorylated gH2AX (D) compared to p53 MO control (E). Most
embryos with massive cell death did not survive beyond 48 hpf.
(F–I) At 48 hpf, surviving cep164 morphants displayed the ciliopathy phenotype of laterality defects. Whereas p53 MO did not cause any abnormal heart looping
(F and G), cep164 MO caused inverted heart looping (H) or ambiguous heart looping (I). (A, atrium; L, left; V, ventricle).
(J–M) At 72 hpf, cep164 morphant embryos developed further ciliopathy phenotypes. When compared to p53 MO controls (J), pronephric tubules (arrow heads)
exhibited cystic dilation (K), asterisks) in 25% (7/28) of embryos, compared to p53 MO controls (J and L), 0% (0/67) of which showed kidney cysts, hydrocephalus
(asterisk), or retinal dysplasia (brackets) (M).
(N) At 0.2 mM, cep164 MO knockdown effectively altered mRNA processing as revealed by RT-PCR. The wild-type (WT) mRNA product is 339 bp. A shorter
aberrantly spliced mRNA product appeared in cep164 morphants (asterisks), and the normal mRNA product was significantly reduced. p53 MO alone did not
affect cep164 mRNA processing.
(O) Quantification of g-H2AX levels in cep164 MO morphants. Whole-fish lysates were prepared from morphants injected with control MO (p53 0.2 mM) or cep164
MO (p53 0.2 mM, cep164 0.2 mM). Injection of cep164-targeting MO causes upregulation of g-H2AX in cep164 morphant embryos signifying perturbed DDR. gH2AX
levels correlate with the phenotypic severity of the cep164 morphants (see A–C). Anti-a-tubulin antibody was used to show equal loading.
(P and Q) Cep164-deficient IMCD3 cells exhibit radiation sensitivity. In IMCD3 cells transduced with shRNA retrovirus, Cep164 expression was suppressed by
shRNA knockdown to about 20% of control as judged by qPCR (P). Cep164 knockdown resulted in a dose-dependent increase of gH2AX-positive cells in a FACS
assay, signifying increased radiation sensitivity to IR and perturbed DDR. See also Figure S7. In (Q) the level of significance of two-tailed t test (p < 0.001) is
indicated by an asterisk. Error bars denote SEM.
(R–T) Zfp423(Znf423)-deficient P19 cells exhibit radiation sensitivity. P19 cells transduced with shRNA lentivirus were exposed to the indicated level X-irradiation.
Zfp423 and gH2AX immunofluorescence was quantified in matched replicate cultures for each virus 2 hr after irradiation. (R) Representative images illustrate
dose-responsiveness of gH2AX and effective knockdown of Zfp423 expression. (S) gH2AX intensity normalized to DAPI+
nuclei is increased following IR at 0.5
and 1.0 Gy, signifying increased IR sensitivity and perturbed DDR (2 fields from each of 6 replicate cultures per condition). Asterisks, uncorrected pair-wise
p < 0.05, Mann-Whitney U test, 2 tails. (T) Histogram shows average gH2AX intensity per cell in 16 additional replicate cultures for each shRNA at 1.0 Gy exposure.
p = 0.018, Mann-Whitney U test, 2 tails. See also Figure S7. Box plots delimit quartiles in (S).
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 545
slow accumulation of DNA damage with a phenotype of tissue
degeneration.
At least two related findings support this model: (1) In a mouse
conditional knockout model of the cystic kidney disease
gene Pkhd1, knockout of the gene before 2 weeks of postnatal
life, up to which a high proliferation state prevailed, caused
(dysplastic) kidney cysts, whereas knockdown after 2 weeks
of postnatal life, when proliferation rate was shown to be
dramatically reduced, only caused occasional cysts, the number
of which increased when tissue injury was induced (Piontek
et al., 2007). This phenomenon could be explained by different
degrees of replication stress, and thereby DDR activation, under
different proliferation rates. (2) In Seckel syndrome (primordial
dwarfism), a progeria syndrome with CVH caused by mutation
of the centrosomal and DDR proteins ATR, CEP152, or pericentrin,
the degree of cerebellar impairment is dependent on cell
proliferation state (Kalay et al., 2011; Murga et al., 2009; Rauch
et al., 2008).
A DDR-Based Pathogenic Hypothesis Might Explain
Specific Organ Involvement in NPHP-RC
Regarding the question why organ degeneration occurs in
specific organs and at characteristic sites, it is tempting to speculate
that the specific tissue regions or cell types affected in
NPHP-RC are more strongly exposed to genotoxins. In the
kidney, the distal convoluted tubule segment, around which
most fibrotic changes occur, is more strongly exposed to genotoxins
such as hydroxyurea. Retinal degeneration could be
caused by postnatal accumulation of UV light-induced DNA
damage. Most strikingly, bile duct-surrounding cholangiocytes
in the liver are the one mammalian cell type that is most strongly
exposed to genotoxins that are generated by the liver for excretion
in bile.
In summary, a testable pathogenic hypothesis of NPHP-RC
that implicates DDR signaling, impaired cell-cycle checkpoint
control with lack of progenitor cells might potentially explain
some of the ill understood features of ciliopathies:
(1) It might provide a mechanism for the dual phenotypes of
degeneration/dysplasia seen in NPHP-RC in kidney, eye,
cerebellum and liver.
(2) It would implicate in the NPHP-RC pathogenesis, lack of
response to replication stress-sensing as a functional
basis for understanding the dualism of dysplasia that
occurs in high-proliferation states during development/
morphogenesis or repair versus degeneration, which occurs
during the low proliferation state of tissue mainte-
nance.
(3) It would characterize the degenerative phenotypes as
diseases of ‘‘organ-specific premature aging,’’ thereby
pointing in new directions for identification of small compounds
for therapy including cyclin inhibitors.
EXPERIMENTAL PROCEDURES
Research Subjects
We obtained human samples following informed consent from individuals with
NPHP-RC. Approval for human subjects research was obtained from the
University of Michigan Institutional Review Board and the other institutions
involved. The diagnosis of NPHP-RC was based on published clinical criteria
(Chaki et al., 2011).
Linkage Analysis
For genome-wide HM the GeneChip Human Mapping 250k StyI Array from
Affymetrix was used. Nonparametric LOD scores were calculated using a
modified version of the programs GENEHUNTER 2.1 (Kruglyak et al., 1996;
Strauch et al., 2000) and ALLEGRO (Gudbjartsson et al., 2000) in order to identify
regions of homozygosity as described (Hildebrandt et al., 2009; Sayer et al.,
2006).
Bioinformatics
Genetic location is according to the February 2009 Human Genome Browser
data (http://www.genome.ucsc.eduH).
Immunoblotting and Immunoprecipitation
Immunoblotting and immunoprecipitation were performed as previously
described (Bryja et al., 2007). HEK293 cells were transfected with the indicated
constructs and lysed 48 hr later. Samples were analyzed using SDS-PAGE and
western blotting, or subjected to immunoprecipitation. The antibodies used for
immunoprecipitation are described in Extended Experimental Procedures.
cep164 Zebrafish Morpholino Oligo-Mediated Knockdown
MOs were obtained from Gene Tools, LLC (Philomath, OR). MOs (cep164 at
0.1 mM, standard control at 0.2 mM, and p53 MO at 0.2 mM) were injected
into zebrafish embryos at 1–4 cell stages. Embryos were fixed at 27 hpf with
4% PFA/PBS +1% DMSO overnight, permeablized with acetone at À20
C
for 7 min, and stained with antibody against phosphorylated zebrafish
gH2AX (1:1,000, gift from Amatruda lab at UT Southwestern) or antibody
against cleaved Caspase-3 (1:200, BD Biosciences). Alex568-anti rabbit IgG
was used at 1:2,000 and 1:1,000 respectively. The IF procedure followed standard
protocol. Morpholinos were: cep164 MO: 50-TATATGCTCTTCTCCATC
ACCTCAT; p53 MO: 50-GCGCCATTGCTTTGCAAGAATTG. For histological
analyses, embryos were fixed at 72 hpf with 4% PFA/PBS and embedded in
JB-4 resin (PolySciences) following the manufacturer’s protocol. Six millimeter
sections were obtained using a Leica R2265 microtome and stained with
hematoxylin-eosin following published procedures (Zhou et al., 2010).
Statistical Analysis
Student’s two-tailed nonpaired t tests and normal distribution two-tailed
z tests were carried out using pooled standard error and S.D. values to determine
the statistical significance of different cohorts.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, seven
figures, and two tables and can be found with this article online at http://dx.doi.
org/10.1016/j.cell.2012.06.028.
ACKNOWLEDGMENTS
We are grateful to the study individuals for their contributions. This research
was supported by grants from the NIH to F.H. (DK068306, DK090917),
B.A.H (NS054871, NS060109), N.K. (HD042601, DK075972, DK072301), and
W.Z. (DK091405); the March of Dimes Foundation and the Center for Organogenesis
of the University of Michigan to F.H.; the Netherlands Organization for
Scientific Research to R.R. (NWO Vidi-91786396) and R.H.G. (NWO Vidi-
917.66.354), the Avenir-INSERM program, the Agence Nationale pour la Recherche,
the Union Nationale pour les Aveugles et De´ ficients Visuels, RETINA
France, Programme Hospitalier de Recherche National 2007, and the Association
Bardet-Biedl, France to H.D. and C.S.; the European Community’s
Seventh Framework Programme FP7/2009 under grant agreement no:
241955, SYSCILIA (to R.H.G., G.G.S., N.K., R.R., H.O., C.A.J. and G.W.); the
Dutch Kidney Foundation (KJPB09.009 and IP11.58 to H.H.A); the Retina
Research Foundation and the National Eye Institute (R01EY018571) to R.C.;
546 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
the NIH to H.W. (F32EY19430); and the DFG (SCHE1562 and SFB832 to B.S.;
SFB829 to T.B.; SFB592 to H.O.). R.K.K. is supported by FFB-Canada, CIHR,
FRSQ, and Reseau Vision. J.S.A. is supported by the Lundbeck Foundation.
V.B. is supported by MSM0021622430 (Ministry of Education, Youth and
Sports of the Czech Republic), 204/09/H058, and 204/09/0498 (Czech
Science Foundation) and EMBO Installation Grant; I.C. is supported by the
programme, Brno PhD Talent of South Moravian Center for International
Mobility. S.S. is a laureate of the ‘‘Equipe FRM’’ (DEQ20071210558) and the
Agence National de la Recherche (R09087KS, R11012KK). W.Z. is a Carl. W.
Gottschalk research scholar of the American Society of Nephrology. J.A.S.
is a GlaxoSmithKline clinician scientist. A.S. is supported by the Burroughs
Wellcome Fund Career Award for Medical Scientists and the Doris Duke Charitable
Foundation Clinical Scientist Development Awards and is a Rita Allen
Foundation and an Irma T. Hirschl scholar. F.H. is an Investigator of the Howard
Hughes Medical Institute, a Frederick G. L. Huetwell Professor, and a Doris
Duke Distinguished Clinical Scientist.
Received: September 4, 2011
Revised: February 1, 2012
Accepted: June 25, 2012
Published: August 2, 2012
REFERENCES
Alcaraz, W.A., Gold, D.A., Raponi, E., Gent, P.M., Concepcion, D., and Hamilton,
B.A. (2006). Zfp423 controls proliferation and differentiation of neural
precursors in cerebellar vermis formation. Proc. Natl. Acad. Sci. USA 103,
19424–19429.
Alcaraz, W.A., Chen, E., Valdes, P., Kim, E., Lo, Y.H., Vo, J., and Hamilton, B.A.
(2011). Modifier genes and non-genetic factors reshape anatomical deficits in
Zfp423-deficient mice. Hum. Mol. Genet. 20, 3822–3830.
Ansley, S.J., Badano, J.L., Blacque, O.E., Hill, J., Hoskins, B.E., Leitch, C.C.,
Kim, J.C., Ross, A.J., Eichers, E.R., Teslovich, T.M., et al. (2003). Basal body
dysfunction is a likely cause of pleiotropic Bardet-Biedl syndrome. Nature
425, 628–633.
Attanasio, M., Uhlenhaut, N.H., Sousa, V.H., O’Toole, J.F., Otto, E., Anlag, K.,
Klugmann, C., Treier, A.C., Helou, J., Sayer, J.A., et al. (2007). Loss of GLIS2
causes nephronophthisis in humans and mice by increased apoptosis and
fibrosis. Nat. Genet. 39, 1018–1024.
Blachon, S., Gopalakrishnan, J., Omori, Y., Polyanovsky, A., Church, A., Nicastro,
D., Malicki, J., and Avidor-Reiss, T. (2008). Drosophila asterless and
vertebrate Cep152 Are orthologs essential for centriole duplication. Genetics
180, 2081–2094.
Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007). Wnt-5a
induces Dishevelled phosphorylation and dopaminergic differentiation via
a CK1-dependent mechanism. J. Cell Sci. 120, 586–595.
Bukanov, N.O., Smith, L.A., Klinger, K.W., Ledbetter, S.R., and IbraghimovBeskrovnaya,
O. (2006). Long-lasting arrest of murine polycystic kidney
disease with CDK inhibitor roscovitine. Nature 444, 949–952.
Chaki, M., Hoefele, J., Allen, S.J., Ramaswami, G., Janssen, S., Bergmann, C.,
Heckenlively, J.R., Otto, E.A., and Hildebrandt, F. (2011). Genotype-phenotype
correlation in 440 patients with NPHP-related ciliopathies. Kidney Int.
80, 1239–1245.
Cheng, L.E., Zhang, J., and Reed, R.R. (2007). The transcription factor Zfp423/
OAZ is required for cerebellar development and CNS midline patterning. Dev.
Biol. 307, 43–52.
Ciccia, A., and Elledge, S.J. (2010). The DNA damage response: making it safe
to play with knives. Mol. Cell 40, 179–204.
Doxsey, S.J., Stein, P., Evans, L., Calarco, P.D., and Kirschner, M. (1994). Pericentrin,
a highly conserved centrosome protein involved in microtubule organization.
Cell 76, 639–650.
Edmond, V., Moysan, E., Khochbin, S., Matthias, P., Brambilla, C., Brambilla,
E., Gazzeri, S., and Eymin, B. (2011). Acetylation and phosphorylation of
SRSF2 control cell fate decision in response to cisplatin. EMBO J. 30,
510–523.
Elias, E., Lalun, N., Lorenzato, M., Blache, L., Chelidze, P., O’Donohue, M.F.,
Ploton, D., and Bobichon, H. (2003). Cell-cycle-dependent three-dimensional
redistribution of nuclear proteins, P 120, pKi-67, and SC 35 splicing factor, in
the presence of the topoisomerase I inhibitor camptothecin. Exp. Cell Res.
291, 176–188.
Fischer, E., Legue, E., Doyen, A., Nato, F., Nicolas, J.F., Torres, V., Yaniv, M.,
and Pontoglio, M. (2006). Defective planar cell polarity in polycystic kidney
disease. Nat. Genet. 38, 21–23.
Germino, G.G. (2005). Linking cilia to Wnts. Nat. Genet. 37, 455–457.
Graser, S., Stierhof, Y.D., Lavoie, S.B., Gassner, O.S., Lamla, S., Le Clech, M.,
and Nigg, E.A. (2007). Cep164, a novel centriole appendage protein required
for primary cilium formation. J. Cell Biol. 179, 321–330.
Griffith, E., Walker, S., Martin, C.A., Vagnarelli, P., Stiff, T., Vernay, B., Al
Sanna, N., Saggar, A., Hamel, B., Earnshaw, W.C., et al. (2008). Mutations in
pericentrin cause Seckel syndrome with defective ATR-dependent DNA
damage signaling. Nat. Genet. 40, 232–236.
Gudbjartsson, D.F., Jonasson, K., Frigge, M.L., and Kong, A. (2000). Allegro,
a new computer program for multipoint linkage analysis. Nat. Genet. 25,
12–13.
Hildebrandt, F., Heeringa, S.F., Ru¨ schendorf, F., Attanasio, M., Nu¨ rnberg, G.,
Becker, C., Seelow, D., Huebner, N., Chernin, G., Vlangos, C.N., et al. (2009). A
systematic approach to mapping recessive disease genes in individuals from
outbred populations. PLoS Genet. 5, e1000353.
Hildebrandt, F., Benzing, T., and Katsanis, N. (2011). Ciliopathies. N. Engl. J.
Med. 364, 1533–1543.
Huangfu, D., and Anderson, K.V. (2005). Cilia and Hedgehog responsiveness
in the mouse. Proc. Natl. Acad. Sci. USA 102, 11325–11330.
Huangfu, D., Liu, A., Rakeman, A.S., Murcia, N.S., Niswander, L., and Anderson,
K.V. (2003). Hedgehog signalling in the mouse requires intraflagellar
transport proteins. Nature 426, 83–87.
Janderova´ -Rossmeislova´ , L., Nova´ kova´ , Z., Vlasa´ kova´ , J., Philimonenko, V.,
Hoza´ k, P., and Hodny´, Z. (2007). PML protein association with specific nucleolar
structures differs in normal, tumor and senescent human cells. J. Struct.
Biol. 159, 56–70.
Kalay, E., Yigit, G., Aslan, Y., Brown, K.E., Pohl, E., Bicknell, L.S., Kayserili, H.,
Li, Y., Tu¨ ysu¨ z, B., Nu¨ rnberg, G., et al. (2011). CEP152 is a genome maintenance
protein disrupted in Seckel syndrome. Nat. Genet. 43, 23–26.
Kruglyak, L., Daly, M.J., Reeve-Daly, M.P., and Lander, E.S. (1996). Parametric
and nonparametric linkage analysis: a unified multipoint approach. Am. J.
Hum. Genet. 58, 1347–1363.
Ku, M.C., Stewart, S., and Hata, A. (2003). Poly(ADP-ribose) polymerase 1
interacts with OAZ and regulates BMP-target genes. Biochem. Biophys.
Res. Commun. 311, 702–707.
Liu, Q., Tan, G., Levenkova, N., Li, T., Pugh, E.N., Jr., Rux, J.J., Speicher, D.W.,
and Pierce, E.A. (2007). The proteome of the mouse photoreceptor sensory
cilium complex. Mol. Cell. Proteomics 6, 1299–1317.
Maude, S.L., and Enders, G.H. (2005). Cdk inhibition in human cells compromises
chk1 function and activates a DNA damage response. Cancer Res.
65, 780–786.
Murga, M., Bunting, S., Montan˜ a, M.F., Soria, R., Mulero, F., Can˜ amero, M.,
Lee, Y., McKinnon, P.J., Nussenzweig, A., and Fernandez-Capetillo, O.
(2009). A mouse model of ATR-Seckel shows embryonic replicative stress
and accelerated aging. Nat. Genet. 41, 891–898.
Ng, S.B., Turner, E.H., Robertson, P.D., Flygare, S.D., Bigham, A.W., Lee, C.,
Shaffer, T., Wong, M., Bhattacharjee, A., Eichler, E.E., et al. (2009). Targeted
capture and massively parallel sequencing of 12 human exomes. Nature
461, 272–276.
O’Driscoll, M., Ruiz-Perez, V.L., Woods, C.G., Jeggo, P.A., and Goodship, J.A.
(2003). A splicing mutation affecting expression of ataxia-telangiectasia
and Rad3-related protein (ATR) results in Seckel syndrome. Nat. Genet. 33,
497–501.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. 547
Otto, E.A., Hurd, T.W., Airik, R., Chaki, M., Zhou, W., Stoetzel, C., Patil, S.B.,
Levy, S., Ghosh, A.K., Murga-Zamalloa, C.A., et al. (2010). Candidate exome
capture identifies mutation of SDCCAG8 as the cause of a retinal-renal ciliopathy.
Nat. Genet. 42, 840–850.
Otto, E.A., Ramaswami, G., Janssen, S., Chaki, M., Allen, S.J., Zhou, W., Airik,
R., Hurd, T.W., Ghosh, A.K., Wolf, M.T., et al; GPN Study Group. (2011). Mutation
analysis of 18 nephronophthisis associated ciliopathy disease genes using
a DNA pooling and next generation sequencing strategy. J. Med. Genet. 48,
105–116.
Pan, Y.R., and Lee, E.Y. (2009). UV-dependent interaction between Cep164
and XPA mediates localization of Cep164 at sites of DNA damage and UV
sensitivity. Cell Cycle 8, 655–664.
Piontek, K., Menezes, L.F., Garcia-Gonzalez, M.A., Huso, D.L., and Germino,
G.G. (2007). A critical developmental switch defines the kinetics of kidney cyst
formation after loss of Pkd1. Nat. Med. 13, 1490–1495.
Rauch, A., Thiel, C.T., Schindler, D., Wick, U., Crow, Y.J., Ekici, A.B., van
Essen, A.J., Goecke, T.O., Al-Gazali, L., Chrzanowska, K.H., et al. (2008).
Mutations in the pericentrin (PCNT) gene cause primordial dwarfism. Science
319, 816–819.
Reinhardt, H.C., Cannell, I.G., Morandell, S., and Yaffe, M.B. (2011). Is posttranscriptional
stabilization, splicing and translation of selective mRNAs
a key to the DNA damage response? Cell Cycle 10, 23–27.
Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber,
S.A., and Ekker, S.C. (2007). p53 activation by knockdown technologies.
PLoS Genet. 3, e78.
Sang, L., Miller, J.J., Corbit, K.C., Giles, R.H., Brauer, M.J., Otto, E.A., Baye,
L.M., Wen, X., Scales, S.J., Kwong, M., et al. (2011). Mapping the NPHPJBTS-MKS
protein network reveals ciliopathy disease genes and pathways.
Cell 145, 513–528.
Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle,
D.A., Smith, S., Uziel, T., Sfez, S., et al. (1995). A single ataxia telangiectasia
gene with a product similar to PI-3 kinase. Science 268, 1749–1753.
Sayer, J.A., Otto, E.A., O’Toole, J.F., Nurnberg, G., Kennedy, M.A., Becker, C.,
Hennies, H.C., Helou, J., Attanasio, M., Fausett, B.V., et al. (2006). The centrosomal
protein nephrocystin-6 is mutated in Joubert syndrome and activates
transcription factor ATF4. Nat. Genet. 38, 674–681.
Scha¨ fer, T., Pu¨ tz, M., Lienkamp, S., Ganner, A., Bergbreiter, A., Ramachandran,
H., Gieloff, V., Gerner, M., Mattonet, C., Czarnecki, P.G., et al. (2008).
Genetic and physical interaction between the NPHP5 and NPHP6 gene products.
Hum. Mol. Genet. 17, 3655–3662.
Simons, M., Gloy, J., Ganner, A., Bullerkotte, A., Bashkurov, M., Kro¨ nig, C.,
Schermer, B., Benzing, T., Cabello, O.A., Jenny, A., et al. (2005). Inversin,
the gene product mutated in nephronophthisis type II, functions as a molecular
switch between Wnt signaling pathways. Nat. Genet. 37, 537–543.
Sivasubramaniam, S., Sun, X., Pan, Y.R., Wang, S., and Lee, E.Y. (2008).
Cep164 is a mediator protein required for the maintenance of genomic stability
through modulation of MDC1, RPA, and CHK1. Genes Dev. 22, 587–600.
Smogorzewska, A., Matsuoka, S., Vinciguerra, P., McDonald, E.R., 3rd, Hurov,
K.E., Luo, J., Ballif, B.A., Gygi, S.P., Hofmann, K., D’Andrea, A.D., and Elledge,
S.J. (2007). Identification of the FANCI protein, a monoubiquitinated FANCD2
paralog required for DNA repair. Cell 129, 289–301.
Stewart, G.S., Maser, R.S., Stankovic, T., Bressan, D.A., Kaplan, M.I., Jaspers,
N.G., Raams, A., Byrd, P.J., Petrini, J.H., and Taylor, A.M. (1999). The DNA
double-strand break repair gene hMRE11 is mutated in individuals with an
ataxia-telangiectasia-like disorder. Cell 99, 577–587.
Strauch, K., Fimmers, R., Kurz, T., Deichmann, K.A., Wienker, T.F., and Baur,
M.P. (2000). Parametric and nonparametric multipoint linkage analysis with
imprinting and two-locus-trait models: application to mite sensitization. Am.
J. Hum. Genet. 66, 1945–1957.
Szczerbal, I., and Bridger, J.M. (2010). Association of adipogenic genes with
SC-35 domains during porcine adipogenesis. Chromosome Res. 18, 887–895.
Valente, E.M., Silhavy, J.L., Brancati, F., Barrano, G., Krishnaswami, S.R.,
Castori, M., Lancaster, M.A., Boltshauser, E., Boccone, L., Al-Gazali, L.,
et al; International Joubert Syndrome Related Disorders Study Group.
(2006). Mutations in CEP290, which encodes a centrosomal protein, cause
pleiotropic forms of Joubert syndrome. Nat. Genet. 38, 623–625.
Xiao, R., Sun, Y., Ding, J.H., Lin, S., Rose, D.W., Rosenfeld, M.G., Fu, X.D., and
Li, X. (2007). Splicing regulator SC35 is essential for genomic stability and cell
proliferation during mammalian organogenesis. Mol. Cell. Biol. 27, 5393–5402.
Yu, J., Carroll, T.J., Rajagopal, J., Kobayashi, A., Ren, Q., and McMahon, A.P.
(2009). A Wnt7b-dependent pathway regulates the orientation of epithelial cell
division and establishes the cortico-medullary axis of the mammalian kidney.
Development 136, 161–171.
548 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Supplemental Information
EXTENDED EXPERIMENTAL PROCEDURES
Whole-Exome Sequencing
Whole-Exome Capture
Exome enrichment was conducted largely following the manufacturer’s protocol for the NimbleGen SeqCap EZ Exome v2 (Roche
NimbleGen, version 2). Briefly, three micrograms of genomic DNA was fragmented by sonication using the Covaris S2 system to
achieve a uniform distribution of fragments with a mean size of 300 bp. The sonicated DNA was purified using AMPure XP Solid Phase
Reversible Immobilization paramagnetic (SPRI) beads (Agencourt) followed by polishing of the DNA ends by removing the 30
overhangs
and filling in the 50
overhangs resulting from sonication using T4 DNA polymerase and Klenow fragment (New England Biolabs).
Following end polishing, a single ‘A’-base was added to the 30
end of the DNA fragments using Klenow fragment (30
to 50
exo minus).
This prepares the DNA fragments for ligation to specialized adaptors that have a ‘T’-base overhang at their 30
ends. The end-repaired
DNA with a single ‘A’-base overhang was ligated to paired-end adaptors (Illumina) in a standard ligation reaction using T4 DNA ligase
and 2–4 mM final adaptor concentration, depending on the DNA yield following purification after the addition of the ‘A’-base (a 10-fold
molar excess of adaptors is used in each reaction). Following ligation, the samples were purified using SPRI beads, amplified by six
cycles of PCR to maintain complexity and avoid bias due to amplification and quality controlled by library size assessment on the
Agilent Bioanalyzer and quantitation using PicoGreen reagent (Invitrogen).
One microgram of amplified, purified DNA (DNA library) was prepared for hybridization by adding COT1 DNA and blocking oligonucleotides
to the DNA library, desiccating the DNA completely and resuspending the material in NimbleGen hybridization buffer. The
resuspended material was denatured at 95
C prior to addition of the exome capture library bait material. The DNA library and biotinlabeled
capture library were hybridized by incubation at 47
C for 68 hr. Following hybridization, streptavidin coated magnetic beads
were used to purify the DNA:DNA hybrids formed between the capture library and sequencing library during hybridization. The purified
sequencing library was amplified directly from the purification beads using 8 cycles of PCR using Pfx DNA polymerase (Invitrogen).
The libraries were purified following amplification and the library size was assessed using the Agilent Bioanalyzer. A single peak
between 350-400 bp indicates a properly constructed and amplified library ready for sequencing. Final quantitation of the library was
performed using the Kapa Biosciences Real-time PCR assay and appropriate amounts loaded onto the Illumina flowcell for
sequencing by paired-end 50 nt sequencing on the Illumina HiSeq2000 sequencer.
Sequencing
Sequencing was performed largely as described in (Bentley et al., 2008). Following dilution to 10 nM final concentration based on the
real-time PCR and bioanalyzer results, the final library stock is then used in paired-end (PE) cluster generation at a final concentration
of 6-8 pM to achieve a cluster density of 600,000/mm2
(on the Illumina HiSeq2000 instrument, v2.5 reagents). Following cluster
generation, 100nt paired-end sequencing was performed using the standard Illumina protocols. Sequencing each sample in a single
lane at paired-end 100 nt conditions on the Illumina HiSeq (v2.5 reagents) generated an average of 19.1Gb of pass-filter sequence
data with 94.96% aligning to the genome. This amount of sequence corresponded to an average coverage of 181x over the 44 Mb of
capture region. 80.41% of sequencing reads fell with 200 bp of the target region. 98.39% of the capture region was sequenced to
a depth of at least 1x, 95.6% to at least 8x, 92.17% to at least 20x, and 89.42% to at least 30x.
Data Analysis
Raw sequencing data for each individual were mapped to the human reference genome (build hg19) using the Burrows-Wheeler
Aligner (BWA v0.5.81536)14. The BWA aligned sequencing reads were processed by Picard (http://picard.sourceforge.net/) to label
the PCR duplicates. The Genome Analysis Toolkit (GATK, version 5091) was then used to remove duplicates, perform local realignment
and map quality score recalibration to produce a ‘‘cleaned’’ BAM file for each individual. SNP calls were made by the Unified
Genotyper module in GATK using the ‘‘cleaned’’ BAM files in batch fashion (90 samples per batch). The resulting Variant Call Format
(VCF, version 4.0) files were annotated using the GenomicAnnotator module in GATK to identify and label the called variants that are
within the targeted coding regions and overlap with known and likely benign SNPs reported in dbSNP v132 (ftp://ftp.ncbi.nlm.nih.
gov/snp/organisms/human_9606/VCF/v4.0/00-All.vcf.gz) with allele frequencies > 5%. The annotated VCF files were then filtered
using the GATK variant filter module with a hard filter setting and a custom script for initial filtering. Variant calls that failed to pass
the following filters were eliminated from the call set: (1) MQ0 > = 4 && ((MQ0 / (1.0 * DP)) > 0.1); (2) QUAL < 30.0 jj QD < 5.0 jj
HRun > 5 jj SB > 0.00; (3) Cluster size 10; (4) not contain dbSNP id; (5) inside the targeted regions. Combined VCF files were then
split into individual files and remaining variants were tested for recessive segregation in the respective families. Topline statistics
on 32 whole human exomes that we evaluated, which include the exomes that we evaluated in this paper, are available from the
authors (unpublished data).
For each of the three families with mutation of MRE11, ZNF423 or CEP164 there was only one gene in each family in any of the
homozygous regions for which the homozygous variant passed Polyphen 1 and 2 scores, segregated within the family, and was
absent from >270 controls, thus validating the pathogenic relevance of the mutation (unpublished data).
CEP164 Mutation Analysis
We performed exon-PCR and Sanger sequencing of all 31 coding exons for one affected individual in each of 856 different NPHP-RC
families. The number of families examined (by increasing number of organs involved) was: isolated nephronophthisis (5), isolated
retinal degeneration (100), Senior-Loken syndrome (168), Joubert syndrome (240), Bardet-Biedl syndrome (195), Meckel syndrome
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S1
(52), and other severe unsolved NPHP-RC cases (96). We also examined 480 individuals from additional NPHP-RC families using
massively-parallel sequencing of exon-PCR from pooled DNA samples (Otto et al., 2010).
Yeast-Two-Hybrid Screening with ZNF423
A subclone of human CEP290 was prepared using high fidelity Taq polymerase, spanning 1770 bp, (562 amino acids, 1917-2479) and
including wild-type stop codon and cloned into pENTR-TOPO as previously described in (Sayer et al., 2006) (clone named ‘JAS2’).
The CEP290 subclone insert was switched to destination vector pDEST32 (binding domain containing yeast-2-hydrid vector, ‘‘bait’’)
(Invitrogen). CEP290 (JAS2) was used as bait, fused to the GAL4 DNA binding domain in the pDEST32 vector, and a human fetal brain
expression library was screened and cloned into pEXPAD22 GAL4 activation domain fusion vector (Invitrogen). Approximately 1 3
106
clones were screened after cotransforming plasmids into competent MaV203 yeast cells (lithium acetate method) and plating
onto His, Leu and Trp deficient medium containing 25 mM 3-aminotriazole. Colonies were replica plated on restrictive media and
surviving colonies were used for cDNA extraction. Five ml cultures were grown at 30
C overnight. cDNA was extracted using
RPM yeast plasmid isolation kitÔ (Bio 101 systems). cDNA was transformed into E. coli, purified and directly sequenced using vector
specific primers. Sequence analysis allowed prediction of amino acid sequences (ORF Finder), which were then identified by BLAT
analysis (http://genome.ucsc.edu). Direct yeast-2-hybrid interaction experiments allowed colony growth to be compared to 2 negative
controls (respective plasmids without insert, data not shown) and 5 positive control yeast strains for different interaction strength.
Coimmunoprecipitation with ZNF423
Full length human ZNF423 was subcloned into pcDNA3.1-NT-GFP using long range PCR (Expand, Roche) and IMAGE clone
100072717 as template. Clones were sequenced to confirm orientation and fidelity. A partial length human CEP290 cDNA spanning
1770 bp as described above (JAS2) was subcloned into a DEST-V5 vector. HEK293 cells were transiently cotransfected with full
length GFP-ZNF423 and partial length CEP290-V5 using Lipofectamine 2000. After 24 hr cells were washed in phosphate-buffered
saline (PBS), pelleted, and lysed in NP-40 buffer (150 mM sodium chloride, 0.5% NP-40, 50 mM Tris pH 7.4, phenylmethanesulphonylfluoride,
and protease inhibitors). The lysate was centrifuged for 20 min at 10,000 g at 4
C and the supernatant was precleared with
protein G sepharose beads (GE Healthcare, Giles, Buckinghamshire, UK). After removal of protein G the supernatant was then incubated
overnight with protein G and 1 mg of either anti-V5 (Invitrogen) or mouse IgG (Sigma) at 4
C. The beads were washed extensively
in lysis buffer and bound proteins resolved by 10% SDS-polyacrylamide gel electrophoresis as described above. GFP-tagged
proteins were detected with anti-GFP-conjugated to HRP (Santa Cruz) 1:5,000 and V5-tagged proteins were detected with anti-V5
conjugated to HRP (Invitrogen) 1:5,000.
Spheroid Assays
IMCD3 Cell Culture
IMCD3 is a mouse inner medullary collecting duct cell line. The cells were cultured in Dulbecco’s Modified Eagle’s Medium
(DMEM):F12 (1:1) (GlutaMAX, GIBCO), supplemented with 10% Fetal Calf Serum (FCS) and penicillin and streptomycin (1% P/S).
Cells were incubated at 37
C in 5% carbon dioxide (CO2) to approximately 90% confluence.
Transfections
Before exposing the cells to different experimental conditions, cells were seeded in 6-, 24- or 48-well plates, depending on the experimental
setup. After at least 6 hr, the cells were transfected with Lipofectamine RNAimax (Invitrogen, 13778-075), according to the
supplier’s protocol. Opti-MEM (Invitrogen, 31985-062) was used to dilute the ON-TARGETplus siRNA SMARTpools (Thermo Scientific
Dharmacon) for Nontargeting pool (D-001810-10) or Cep164 (L-057068-01).
IMCD3 Spheroid Growth Assay
Cells were trypsinized 24 hr post-transfection and resuspended cells were then mixed 1:1 with growth factor-depleted matrigel
(BD Bioscience). After the matrigel polymerized for 20 min at 37
C, warm medium was dropped over the matrix until just covered.
The IMCD3 cells formed spheroids with cleared lumens 3 days later. Medium was removed by pipetting and the gels were washed
three times for 10 min with warm PBS supplemented with calcium and magnesium. The gels were then fixed in fresh 4% PFA for
30 min RT. After washing three times in PBS after fixation, the cells were permeabilized for 15 min in gelatin dissolved in warm
PBS (350 mg/50 mL) and 0.5% Triton X-100. Primary antibody (mouse anti-acetylated tubulin, Sigma, at 1:20,000) was diluted in
the permeabilization gelatin buffer and incubated at 4
C overnight. After washing the spheroids 3 times for 30 min in permeabilization
buffer, goat anti-mouse Alexa-555 secondary antibody (Invitrogen) was diluted 1:500 in permeabilization buffer and incubated overnight
at 4
C. The next day, spheroids were washed 3 times in permeabilization buffer and mounted with Dapi (1:2,000) in Fluoromount-G
(Cell Lab, Beckman Coulter). Images were taken with a Zeiss LSM510 confocal microscope and 50 spheroids per condition
were scored. GraphPad Prism 5.0 was used to perform two-tailed Student’s t tests.
RT-qPCR for Cep164
IMCD3 cells were transfected with nontargeting siControl or siCep164 oligonucleotides (Dharmacon, ON-TARGETplus SMARTpool
Cep164) using Lipofectamine RNAimax (Invitrogen) in 6 well plates seeded with cells at 50% confluency. Cells were lysed 24, 48 and
72 hr after transfection and total RNA was isolated (RNeasy Mini Kit, QIAGEN, 74106) and measured (NanoDrop spectrophotometer
ND-1000, Thermo Fischer Scientific Inc.). cDNA was synthesized from 500 ng RNA template using the iScript cDNA Synthesis Kit
(Bio-Rad, 170-8891) according to the supplier’s protocol. Dilutions were made for RT-QPCR analysis to determine the expression
of Cep164, normalized against reference gene RPL27. The primers (Sigma) used are mCep164 forward 50
-AGAGTGACAACCA
S2 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
GAGTGTCC, mCep164 reverse 50
-GGAGACTCCTCGTACTCAAAGTT, mRPL27 forward 50
- CGCCCTCCTTTCCTTTCTGC and
mRPL27 reverse 50
-GGTGCCATCGTCAATGTTCTTC. The iQ SYBR Green Supermix (Bio-Rad, 170-8880) was used to multiply
and measure the cDNA with a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). All samples were run in triplicate in
20 ml reactions. The following PCR program was used: 95
C for 3 min, followed by 40 cycles of 10 s at 95
C, 30 s at 51.5/61
C
and 30 s at 72
C, then 10 s at 95
C followed by a melt of the product from 65
C-95
C.The DDCT method was used for statistical
analysis to determine gene expression levels.
Immunofluorescence and Confocal Microscopy
For immunostaining IMCD3 cells, cells were grown on coverslips and fixed for 30 min in 4%PFA followed by a 15 min permeabilization
step in 0.5%Triton X-100/1%BSA/PBS. Primary antibody incubations (human anti-CREST at 1:1,000, mouse anti-acetylated tubulin
at 1:20,000) were performed overnight in 1% BSA/PBS. Secondary antibody incubations were performed for 1 hr at RT. DAPI incubations
were performed for 10 min at RT. Coverslips were mounted in Fluoromount G (Cell Lab, Beckman Coulter). Confocal imaging
was performed using Zeiss LSM510 Confocal laser microscope and images were processed with the LSM software. Approximately
250 events per condition were scored. GraphPad Prism 5.0 was used to perform two-tailed Student’s t tests.
Cell-Cycle Studies
Generation of IMCD3 and hTERT-RPE Cell Lines that Are Doxycycline-Inducible for N-GFP-CEP164 Constructs
Both, IMCD3 and hTERT-RPE cells were stably transfected with N terminally GFP tagged human CEP164 constructs in a retroviral
vector for doxycycline (Dox)-inducible expression (pRetroX-Tight-Pur). Following selection on puromycin for 2 weeks, cells were
induced with 10 ng/ml of doxycyclin for 20 hr. Based on the GFP expression levels upon immunofluorescence, clonal cells were
generated for IMCD3 cells.
Cell-Cycle Studies
IMCD3 cells Dox-inducible for human N-GFP-Cep164-WT (wild-type) or N-GFP-Cep164-Q525X (mutant) were transfected with
either nontargeting control siRNA (50 nM, Dharmacon D-001206-14-20) or mouse Cep164 siRNA (50 nM, Smartpool Dharmacon
L-057068-01-0020) using Polyplus transfection reagents. Cells were then re-plated and treated for double thymidine (2 mM) blocks
beginning at 24 hr post transfection. At the same time, cells were also induced with doxycycline (10 ng/ml) for N-GFP-Cep164-WT
or N-GFP-Cep164-Q525X. Cells were released from second thymidine block for 6 hr and fixed with 2% PFA and stained with
PI/RNase staining solution (BD Biosciences). FACS analysis for cell-cycle histograms was performed and data were then analyzed
using Modfit software. Mean and SD of % DNA amount for different phases (triplicate samples) were calculated and plotted as bar
diagram.
Cell-Proliferation Studies
IMCD3 cells Dox-inducibly expressing human N-GFP-CEP164-WT or N-GFP-CEP164-Q525X were transfected with either nontargeting
control siRNA (50 nM, Dharmacon D-001206-14-20) or mouse Cep164 siRNA (50 nM, Smartpool Dharmacon
L-057068-01-0020) using Polyplus transfection reagents. Cells were then re-plated in triplicate of 10,000 cells for each group
and treated for thymidine (2 mM) blocks beginning at 24 hr post transfection. At the same time, cells were also induced with doxycycline
(10 ng/ml) for N-GFP-CEP164-WT or N-GFP-CEP164-Q525X expression. Cells were counted at 48, 72, and 96 hr post
transfection.
Roscovitine Studies
Cell Culture and Cell Irradiation
Sh-Neg-IMCD3 cells were maintained in DMEM:F12 supplemented with 10% FCS, 1% Penicillin/Streptomycin and 5 mg/ml Puromycin
(all from GIBCO/Invitrogen, Carlsbad, CA) and maintained in a 5% CO2 humidified atmosphere at 37
C. Roscovitine (Chem
Partners, China) was incubated at 80 mM for 24 hr. Ultraviolet (UV) irradiation was performed using a UV StratalinkerÔ (Stratagene/Agilent,
Santa Clara, CA) at 30 J/m2
dose; cells were left to recover for 1 hr at 37
C before further analyses.
Immunoblotting, Immunofluorescence, and Subcellular Fractionation
Cells were lysed as previously described (Bukanov et al., 2006). Subcellular fractionation was performed using Nuclear Extract
Kit according to the manufacturer’s instructions (Active Motif, Carlsbad, CA). Protein concentration was determined by BCA protein
assay (Pierce/Thermofisher, Rockford, IL). Proteins were resolved on SDS PAGE 5%–12% gradient and transferred using iBlot
system (Invitrogen). The following antibodies were used: CEP164 (Novus Biologicals, Littleton, CO), Phospho-Chk1 (Ser317)
and phospho-H2AX (Ser139) (Cell Signaling, Danvers, MA), Chk1 (Upstate/Millipore, Billerica, MA), H2AX and 13.3.3 (AbCam,
Cambridge, MA) and Sam-68 (Santa Cruz Biotech. Santa Cruz, CA). Primary antibodies were detected with anti-rabbit or anti-mouse
horseradish peroxidase-conjugated secondary antibodies (Promega, Madison, WI) and revealed by ECL (Amersham, Little Chalfont,
Buckinghamshire, UK) as previously described (Bukanov et al., 2006). For immunofluorescence, cells were fixed for 20 min in 4%
paraformaldehyde (Electron Microscopy Science, Hatfield, PA) in PBS (pH 7.2) and were permeabilized with 0.1% Triton X-100 in
PBS. Immunofluorescence was then performed as previously described (Smith et al., 2006).
Gene Expression Analysis
Gene expression analysis was performed as described before (Smith et al., 2006, 17-pp2821-2831) using TAQ-Man gene expression
assays (Applied Biosystems/Invitrogen, Carslbad, CA).
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S3
Interaction Studies of CEP164 with TTBK2 and CCDC92
Yeast Two-Hybrid
A GAL4-based yeast two-hybrid system was used to screen for binary CEP164 interactors by using methods described by Letteboer
and Roepman (Letteboer and Roepman, 2008). Bait constructs expressing full length CEP164 (CEP164fl
) and several fragments
thereof (CEP1641-550
, CEP164551-1100
and CEP1641101-1460
) were used to screen two retinal cDNA libraries: a bovine library of
randomly primed retina cDNA and a human library of oligo-dT primed retina cDNA (Letteboer and Roepman, 2008).
GST Pull-Down
Full length 3xFlag-CCDC92 and 3xFlag-TTBK2 were expressed in COS-1 cells. CEP164fl
, CEP1641-550
, CEP164551-1100
and
CEP1641101-1640
were cloned in pDEST15 and the resulting expression constructs were transformed in BL21DE3 to express
glutathione S-transerase (GST) fusion proteins. The GST pull-down was performed as described by Coene et al. (Coene et al.,
2011). The results were assessed by immunoblotting, and Flag-tagged proteins were detected using anti-Flag primary antibodies
(Sigma-Aldrich) and goat-anti-mouse IRDye800 secondary antibodies (Rockland, Immunochemicals, Gilbertsville, PA, USA). A
Li-Cor Odyssey 2.1 scanner was used for imaging.
Coimmunoprecipitation
3xHA-CEP164fl
was expressed in combination with either 3xFlag-CCDC92fl
or 3xFlag-TTBK2fl
in COS-1 cells (and vice versa with
swapped tags). 3xFlag-dNp63 or 3xHA-dNp63 was used as a control for specificity. The coimmunoprecipitation was performed
as described by Coene et al. Transfected COS-1 cells were lysed and incubated with a-M2-agarose from mouse (Sigma-Aldrich)
or a-HA affinity matrix from rat (Roche) for 2 hr at 4
C. After washing, sample buffer was added to the beads and the sample was
heated. Beads were then precipitated by centrifugation and the supernatant was analyzed by immunoblotting to assess if TTKB2
and CCDC92 indeed coimmunoprecipitated with CEP164.
Interaction Studies of CEP164 with DVL3
Immunoprecipitation Coupled to Mass Spectrometry
Mouse embryonal fibroblasts were grown in DMEM supplemented with 10% fetal bovine serum at 37
C to confluency and cell pellets
are frozen at À80
C. Cells were then lysed in lysis buffer (0.5% NP40; 150mM NaCl; 50 mM Tris pH 7.4) and subjected to immunoprecipitation
with antibodies against Dvl3 (sc-8027); Dvl2 (sc-8026) or control IgG (sc-2025; Santa Cruz Biotechnology). Proteomics
grade trypsin (Sigma) was added to the beads directly (10 ng/ml) and left at 37
C for 12 hr. Tryptic digested peptides were desalted
using ZipTip C18 column (Millipore) based on the manufacturer’s protocol. LC-MS/MS was performed on a NanoAcquity UPLC
(Waters) on-line coupled to an ESI Q-TOF Premier (Waters) mass spectrometer. Trypsin digested peptides eluted from ZipTip column
were diluted in autoclaved M.Q. water (Millipore) and loaded onto a 180 mm x 20 mm nanoAcquity UPLC Symmetry trap column
(Waters) packed with 5 mm BEH C-18 beads. After 1 min of trapping, peptides were eluted through a 75 mm x 150 mm nanoAcquity
(Waters) analytical column packed with 1.7 mm BEH C-18 beads at a flow rate of 400 nL/min using a gradient of 3 – 40% acetonitril
with 0.1% formic acid for 35 min at a temperature of 35
C. Effluent was directly fed into the ESI source of the mass spectrometer. Raw
data was acquired in data independent MSE
Identity (Waters) mode. Precursor ion spectra were acquired with collision energy 5 V
and fragment ion spectra with a collision energy 20-35 V ramp in alternating 1 s scans. Raw data was then subjected to a database
search using species specific Uniprot and NCBI mouse protein database by the PLGS2.3 software (Waters). Acetyl N-terminal, Deamidation
N and Q, Carbamidomethyl C and Oxidation M were set as variable modifications. Peptide accuracy and MS/MS fragment
mass accuracy was less than 20 ppm.
Western Blotting and Immunoprecipitation
Immunoblotting and sample preparations were performed as previously described (Bryja et al., 2007b). HEK293 cells were transfected
with the indicated constructs and lysed 48 hr later. Samples were analyzed using SDS-PAGE and Western blotting, or
subjected to immunoprecipitation. The antibodies used include the following: Dvl3 (sc-8027), Dvl2 (sc-8026), mouse IgG
(sc-2025), from Santa Cruz Biotech, CEP164 (4533.00.02) from Sdix, HA.11 (MMS-101P) from Covance, GFP (3H9), RFP (3F5)
from Chromotek and FLAG M2 (F1804), GST (G1160) from Sigma.
Immunoprecipitation was performed as previously described (Bryja et al., 2007a). The antibodies used for immunoprecipitation
were RFP Trap from Chromotek, HA.11 (MMS-101P) from Covance, anti FLAG (F1804; Sigma), anti Dvl3 (sc-8027), anti Dvl2 (sc-
8026) (all Santa Cruz Biotechnology).
GST Pull-Down
Production of recombinant GST-tagged fragments of CEP164 (Sivasubramaniam et al., 2008) was induced by adding 0.2 mM IPTG
and grown for 4 hr at 37
C. The bacteria were spun down at 4000 g/4
C/10 min and the pellet was resuspended in 10 ml of GST lysis
buffer (50 mM Tris-Cl pH 7.5, 150 mM NaCl, 5mM MgCl2, protease inhibitors (Roche)) and stored at À80
C. Then the solution was
thawed, sonicated for 3x30 s and spun down 15000 g/4
C/15 min. The supernatant was then used for incubation with GST beads for
2 hr at rotator (100 ml of beads per 100 ml of original bacterial culture). After incubation beads were washed 3 times with 1 ml of GST
lysis buffer and frozen at À80
C as 25% slurry in GST lysis buffer +20% glycerol.
HEK293T cells were transfected according to the scheme, grown for 24 or 48 hr and lysed in 0.5% NP 40 lysis buffer (0.5% NP40,
50 mM Tris pH 7.4, 1 mM EDTA, 150 mM NaCl) with added protease inhibitors (Roche) and phosphatase inhibitors (Calbiochem). The
lysate was spun down at 16100 g/4
C/10 min and the supernatant was used for overnight incubation with 15 ml of solid GST beads
containing GST recombinant proteins on the rotator. After the incubation samples were washed with 800 ml 0.5% NP 40 lysis buffer,
S4 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
the GST beads were collected at 0.1 g/4
C/1 min, the supernatant was aspirated out and this washing was repeated 6 times. Proteins
were eluted with 45 ml of 2x Laemmli buffer.
Immunohistochemistry
HEK293 cells were seeded at approx. 2x105
cells/well on collagen coated coverslips in 24-well plates. Cells were fixed in fresh 4%
paraformaldehyde, permeabilized with 0.05% Triton X-100, blocked with PBTA (3% BSA, 0,25% Triton, 0,01% NaN3) for 1 hr and
incubated overnight with primary antibodies CEP164 (4533.00.02) from Sdix and Dvl2 (sc-8026 from Santa Cruz Biotechnology).
Next day, coverslips were washed in PBS, and incubated with secondary antibodies: Alexa 488, Alexa 568 (Invitrogen), washed
with PBS, stained with DAPI (1:5000) and mounted on coverslips. Cells were visualized using a Leica TCS SP-5 confocal microscope.
Multicolor Competition Assay
MCA was performed as described previously (Smogorzewska et al., 2007). Briefly, 1.7 3 105
U2OS-GFP were reverse transfected
with 64 pmol siRNA duplex using Lipofectamine RNAiMAX (Invitrogen) as per manufactures instructions. 48 hr post transfection
siRNA treated U2OS-GFP were mixed with anti-Luciferase siRNA treated U2OS-RFP cells at a 1:1 ratio. 72 hr post transfection cells
were treated with DNA damaging agents as depicted. Cells were harvested for FACS analysis 7 days post treatment. siRNA duplex
sequences were as follows: Luc: CGTACGCGGAATACTTCGA (siRNA targeting firefly luciferase mRNA), CEP164#1: GGACCATC
CATGTGACGAA; CEP164#2: GGCTGGAACGTGTCAAGAA; CEP164#3: GAGTTGGAGTCTCAACAGA; ZNF423#1: GGAGAACCA
CAAGAACATT; ZNF423#2: CGAGTGCAGTGTCAAGTTT; ZNF423#3: GCATCAACCACGAGTGTAA, all from Ambion; BRCA2:
(Stealth siRNA, Invitrogen) used as a combination of three siRNAs: GGAACCAAATGATACTGATCCATTA, GGAGGACTCCTTATGTC
CAAATTTA, GAGCGCAAATATATCTGAAACTTC;ATM (Stealth siRNA, Invitrogen) used as a combination of three siRNAs: GCGCA
GTGTAGCTACTTCTTCTATT, GGGCCTTTGTTCTTCGAGACGTTAT, GCAACATTTGCCTATATCAGCAATT; anti-CEP164 antibody
for immunoblot was from Novus (cat #45330002).
Quantitative RT-PCR
Intron spanning primer pairs were designed for quantitative RT-PCR of ZNF423 and beta-actin as control. RNA was extracted from
the siRNA treated U2OS cells using QIAGEN RNeasy Plus Mini Kit. First-strand cDNAs were then synthesized using the Invitrogen
SuperScript III Reverse Transcriptase kit. Quantitative RT-PCR was performed using Platinum SybrGreen Super Mix (Invitrogen)
according to the manufacturer’s instructions. Sequences of primer pairs were: Beta-actin forward: GCTACGAGCTGCCTGACG,
Beta-actin reverse: GGCTGGAAGAGTGCCTCA, ZNF423 forward: GTCTCTGGCAGACCTGACG, ZNF423 reverse: AGAGTTGTGGG
TCGTCATCA.
ZNF423 DNA Damage Response
Lentivirus constructs were obtained in a pLKO vector (Sigma) modified to express Emerald GFP in place of the Puromycin marker.
Transduction efficiencies were $70% by GFP fluorescence. For DDR assays, transduced cells were plated at 1x105
per well in
12-well plate containing poly-L-lysine coated glass cover slides one day before irradiation with a calibrated source (Moores
UCSD Cancer Center). Two hr after irradiation, cells were fixed with 4% PFA. Mouse anti-gH2AX (Upstate, clone JBW30) and rabbit
anti-ZNF423 (Y-W Cho and B.A.H. unpublished data) antibodies were added at room temperature for 2 hr. Donkey anti-mouse (Alexa
fluor 555) and anti-rabbit (Alexa fluor 488) antibodies (Jackson Immunoresearch) were incubated at room temperature for 1 hr.
Images were captured on an Olympus FV1000 confocal microscope. Signal intensities of gH2AX were quantified from image files
in ImageJ software. Distribution of foci in Zfp423-knockdown cells did not meet the conditions of a t test and were analyzed by
the Mann-Whitney U (Wilcoxon rank sum) test implemented in R 2.8.1.
FACS Analysis of gH2AX
Both control and Cep164 stable knockdown IMCD3 cells were irradiated with indicated doses (Figure 6Q). Cells were then fixed
60 min post-irradiation with 2% paraformaldehyde, permeabilized with 0.1% SDS and stained with rabbit gH2AX (Cell Signaling).
Alexa-fluor-488 conjugated secondary anti-rabbit antibody was used to analyze the mean fluorescent intensity (MFI) of samples
in triplicate in the FACS facility (Cancer Center, University of Michigan). Results shown are representation of mean and SD of triplicate
samples.
Statistical Analysis
Student’s two-tailed nonpaired t tests and normal distribution two-tailed z tests were carried out using pooled standard error and s.d.
values to determine the statistical significance of different cohorts.
SUPPLEMENTAL REFERENCES
Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown, C.G., Hall, K.P., Evers, D.J., Barnes, C.L., Bignell, H.R., et al. (2008). Accurate
whole human genome sequencing using reversible terminator chemistry. Nature 456, 53–59.
Bryja, V., Gradl, D., Schambony, A., Arenas, E., and Schulte, G. (2007a). Beta-arrestin is a necessary component of Wnt/beta-catenin signaling in vitro and in vivo.
Proc. Natl. Acad. Sci. USA 104, 6690–6695.
Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007b). Wnt-5a induces Dishevelled phosphorylation and dopaminergic differentiation via a CK1dependent
mechanism. J. Cell Sci. 120, 586–595.
Bukanov, N.O., Smith, L.A., Klinger, K.W., Ledbetter, S.R., and Ibraghimov-Beskrovnaya, O. (2006). Long-lasting arrest of murine polycystic kidney disease with
CDK inhibitor roscovitine. Nature 444, 949–952.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S5
Coene, K.L., Mans, D.A., Boldt, K., Gloeckner, C.J., van Reeuwijk, J., Bolat, E., Roosing, S., Letteboer, S.J., Peters, T.A., Cremers, F.P., et al. (2011). The ciliopathy-associated
protein homologs RPGRIP1 and RPGRIP1L are linked to cilium integrity through interaction with Nek4 serine/threonine kinase. Hum. Mol.
Genet. 20, 3592–3605.
Giorgio, G., Alfieri, M., Prattichizzo, C., Zullo, A., Cairo, S., and Franco, B. (2007). Functional characterization of the OFD1 protein reveals a nuclear localization and
physical interaction with subunits of a chromatin remodeling complex. Mol. Biol. Cell 18, 4397–4404.
Habbig, S., Bartram, M.P., Mu¨ ller, R.U., Schwarz, R., Andriopoulos, N., Chen, S., Sa¨ gmu¨ ller, J.G., Hoehne, M., Burst, V., Liebau, M.C., et al. (2011). NPHP4,
a cilia-associated protein, negatively regulates the Hippo pathway. J. Cell Biol. 193, 633–642.
Letteboer, S.J., and Roepman, R. (2008). Versatile screening for binary protein-protein interactions by yeast two-hybrid mating. Methods Mol. Biol. 484, 145–159.
Liebau, M.C., Ho¨ pker, K., Mu¨ ller, R.U., Schmedding, I., Zank, S., Schairer, B., Fabretti, F., Ho¨ hne, M., Bartram, M.P., Dafinger, C., et al. (2011). Nephrocystin-4
regulates Pyk2-induced tyrosine phosphorylation of nephrocystin-1 to control targeting to monocilia. J. Biol. Chem. 286, 14237–14245.
Otto, E.A., Schermer, B., Obara, T., O’Toole, J.F., Hiller, K.S., Mueller, A.M., Ruf, R.G., Hoefele, J., Beekmann, F., Landau, D., et al. (2003). Mutations in INVS
encoding inversin cause nephronophthisis type 2, linking renal cystic disease to the function of primary cilia and left-right axis determination. Nat. Genet. 34,
413–420.
Otto, E.A., Ramaswami, G., Janssen, S., Chaki, M., Allen, S.J., Zhou, W., Airik, R., Hurd, T.W., Ghosh, A.K., Wolf, M.T., et al.; GPN Study Group (2011). Mutation
analysis of 18 nephronophthisis associated ciliopathy disease genes using a DNA pooling and next generation sequencing strategy. J. Med. Genet. 48, 105–116.
Sayer, J.A., Otto, E.A., O’Toole, J.F., Nurnberg, G., Kennedy, M.A., Becker, C., Hennies, H.C., Helou, J., Attanasio, M., Fausett, B.V., et al. (2006). The centrosomal
protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nat. Genet. 38, 674–681.
Sivasubramaniam, S., Sun, X., Pan, Y.R., Wang, S., and Lee, E.Y. (2008). Cep164 is a mediator protein required for the maintenance of genomic stability through
modulation of MDC1, RPA, and CHK1. Genes Dev. 22, 587–600.
Smith, L.A., Bukanov, N.O., Husson, H., Russo, R.J., Barry, T.C., Taylor, A.L., Beier, D.R., and Ibraghimov-Beskrovnaya, O. (2006). Development of polycystic
kidney disease in juvenile cystic kidney mice: insights into pathogenesis, ciliary abnormalities, and common features with human disease. J. Am. Soc. Nephrol.
17, 2821–2831.
Smogorzewska, A., Matsuoka, S., Vinciguerra, P., McDonald, E.R., 3rd, Hurov, K.E., Luo, J., Ballif, B.A., Gygi, S.P., Hofmann, K., D’Andrea, A.D., and Elledge,
S.J. (2007). Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell 129, 289–301.
Zhou, W., Dai, J., Attanasio, M., and Hildebrandt, F. (2010). Nephrocystin-3 is required for ciliary function in zebrafish embryos. Am. J. Physiol. Renal Physiol. 299,
F55–F62.
S6 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Figure S1. Links of Identified Nephronophthisis-Related Ciliopathy (NPHP-RC) Proteins to DDR Signaling and Cell-Cycle Control
DDR pathways function to sense and repair DNA damage and, if repair is incomplete, arrest cell cycle at checkpoints to avoid propagation of DNA replication
errors.
Columns depict two pathways of DDR signaling, the ATM (ataxia-telangiectasia mutated) pathway (A), and the ATR (ATM-and-Rad-related) pathway (C).
Rows depict stages of DDR signaling including DNA damage sensing and repair (A, C), as well as outcomes regarding checkpoint activation, cell-cycle arrest, and
apoptosis (D).
Some known components of DDR are shown in gray. Proteins relevant to this study are shown in color. Gene products identified in this study as mutated in
individuals with NPHP-RC are encircled with a red dashed oval.
Each of the 3 NPHP-RC proteins that we discovered most recently, MRE11, ZNF423 and CEP164 as well as others that we discovered recently, including ATXN10
(Sang et al., 2011) and SDCCAG8/NPHP10 (Otto et al., 2010) exhibit a functional connection to DDR pathways as follows:
(A) Within the ATM-Chk2 pathway ionizing radiation (IR) can induce DNA double-strand breaks (DSB) activating PARP1. PARP1 may interact with ZNF423 (Figure
2E) (Ku et al., 2003), which we found here to be defective in individuals with NPHP-RC (Figures 1C and 1D). PARP1 recruits the MRN/ATM complex to DSBs.
Activation of the ATM kinase activity by MRN (a heterotrimer of MRE11, Rad50 and Nbs) and TIP60 leads to i) induction of the gH2AX-dependent signaling
cascade, ii) phosphorylation of CHK2 and p53 and, iii) to the recruitment of a large number of other DDR factors (not shown). We here detect an MRE11 mutation in
an individual with NPHP-RC (Figures 1A and 1B). The ATM activator TIP60 is part of the ‘TIP60 protein complex’ (B).
(B) Relationships of TIP60 with other proteins are shown within a blue inset, including gene products that are mutated in NPHP-RC of humans (red), mouse
(orange rim), and zebrafish (yellow). Indirect protein interactions are depicted as black lines, direct interaction as black dots. Protein-protein interactions identified
within this study are shown as purple lines or dots. Proteins that we detected as defective in NPHP-RC in this study are encircled by a red dotted line.
TIP60 activates SC35/SRSF2 (Edmond et al., 2011) and directly interacts with the NPHP-RC protein OFD1 (Giorgio et al., 2007). TIP60 colocalizes to nuclear foci
with the proteins encircled by a black dashed line (see Figure 4). The proteins marked with a lightning have known functions in DDR signaling.
(C) Within the ATM-to-Chk1 pathway DNA lesions induced by UV light or replication stress (denoted by blue oval) cause replication fork stalling and accumulation
of RPA-coated ssDNA regions, which recruit the ATR/ATRIP and the RAD17/RFC2-5 complexes. RAD17/RFC2-5 loads the 9-1-1 complex and stimulates ATR
kinase activity by the 9-1-1-associated protein TOPBP1. ATR then activates Chk1 phosphorylation (modified from Ciccia and Elledge, 2010). CEP164 interacts
with ATRIP through its N-terminal interaction domain and is phosphorylated by ATR in response to DNA damage by UV light (Sivasubramaniam et al., 2008).
(D) The DDR pathways are important to sense and repair DNA damage and, if repair is incomplete, arrest cell cycle at checkpoints. If DNA repair is successful, cell
cycle progresses. If DNA repair fails, apoptosis may result or, through activation of checkpoint proteins (Chk1 and Chk2) and inhibition of the CDC25s, cell-cycle
arrest in G1/S or G2/M may result.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S7
Figure S2. Alternative Transcripts, Knockdown Targets, and Human Mutations of CEP164 with Interacting Domains, Interaction Partners,
and Antigens of the Cep164 Protein
(A) The CEP164 gene extends over 85.4 kb, contains 33 exons (vertical hatches) and an alternative exon 5a used in isoform 2.
(B) Exon structure of human CEP164 cDNA. Positions of start codon (ATG) and of stop codon (TGA) are indicated. For the mutations detected (see (F) arrows
indicate positions in relation to exons and protein domains (see (C). Positions of exon-targeting shRNAs are shown for knockdown in human (orange) and mouse
(blue).
(C) Domain structure of the CEP164 protein. One N-terminal globular domain (WW), a lysine-rich repeat (LR), a glutamate-rich region (Glu), and five coiled-coil
domains (CC1-5) are predicted.
(D) Minimal segment to which CEP164 binds the interaction partner ATRIP has been mapped.
(E) Extent of antigens used for a-CEP164 antibody production.
(F) CEP164 mutations detected in 4 families with NPHP-RC. Family number and predicted translational change are indicated (see Table 1). Sequence traces are
shown for mutations above normal controls. Mutated nucleotides are indicated by arrow heads in traces of normal controls. (H), homozygous mutation; (h),
heterozygous mutation (see also Figure 1).
S8 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
G
50
64
hTERT-RPE
No doxycyclin Doxycyclin 10 ng/ml
D
hTERT-RPE
-Tubulin
hTERT-RPE
GFPcontrol
IMCD3
GFPcontrol
F
*
E
-Tubulin
C
A B
Figure S3. Subcellular Localization of CEP164
(A) Characterization of anti-CEP164 antibodies by immunoblotting. IMCD3 cells that doxycycline-inducibly express GFP-CEP164 isoform 1 were induced with (+)
or without (-) 10 ng/ml doxycyclin for 20 hr. 20 mg of RIPA extracted cell lysates were subjected to SDS-PAGE and blotted with the indicated antibodies. Molecular
weight is shown in kDa. Note that anti-CEP164 antibodies recognize a band compatible with the size of EGFP-CEP164 isoform 1 (191 kDa; arrow heads). Loading
control (on right) uses an anti-aÀtubulin antibody.
(B) Characterization of a-CEP164 antibodies by overexpression of N terminally GFP-labeled human isoform 1 wild-type construct EGFP-CEP164-WT and
immunofluorescence in cell lines. Cells were costained with antibodies a-CEP164-NR, -ENR, and -SR (red), respectively, demonstrating colocalization (Merge)
with N-EGFP-hCEP164-WT (green). The secondary antibody alone (lower panels) does not result in a signal. Scale bars, 5 mm.
(C) CEP164 in GFP-Centrin-2 mouse photoreceptors. In photoreceptors of centrin-2-GFP mice, immunofluorescence using anti-CEP164-ENR antibody detects
Cep164 at basal bodies/mother centrioles (visible as a single red dot), whereas centrin-2-GFP is expressed at both centrioles, mother and daughter. Inset shows
enlargement of a representative centrosome at 3-fold higher magnification. Nuclei are stained with DAPI. Scale bars, 5 mm. ONL, outer nuclear layer; PRL,
photoreceptor layer; RPE, retinal pigment epithelium.
(D–G) Expression of mutant CEP164 in hTERT-RPE cells abrogates localization to centrosomes. (D) Doxycyclin (Dox)-inducible overexpression of N terminally
GFP-tagged human full-length CEP164 wild-type isoform 1 (NGFP-hCEP164-WT) in hTERT-RPE (human retinal pigment epithelium) cells demonstrates, in
addition to a cytoplasmic expression pattern, localization at centrosomes. (E) In contrast, the signal at centrosomes is abrogated upon overexpression of an N
terminally GFP-tagged truncated CEP164 construct (NGFP-CEP164-Q525X) representing the mutation p.Q525X occurring in NPHP-RC family F59. Similar data
was obtained upon CEP164 expression in IMCD3 cells (see also Figures 3B–3D). (F) Expression of GFP alone as a negative control yielded no centrosomal
expression in IMCD3 or hTERT-RPE cells. hTERT-RPE cells were stably transfected with the CEP164 constructs in a retroviral vector for doxycyclin-inducible
expression (pRetroX-Tight-Pur). Following selection with puromycin for 2weeks, cells were induced with10 ng/ml of doxycyclin for 20 hr. Cells were then costained
with g-tubulin (red) for the colocalization with NGFP-hCEP164-WT fusion proteins (green) (see also Figures 3B–3D). Scale bars, 10 mm. (G) Immunoblot of IMCD3
and hTERT-RPE cells expressing inducible GFP-CEP164 constructs confirmed doxycyclin-inducible NGFP-CEP164 fusion protein expression ($191 kDa) both
with a-CEP164-NR and a-GFP antibody blotting (arrow heads). The band at $85 kDa (asterisk) may represent the endogenous isoform 2 of CEP164 (84 kDa).
IMCD3 and hTERT-RPE cells were stably transfected with the N terminally tagged-GFP-CEP164 construct in a retroviral vector (pRetroX-Tight-Pur) for doxycyclin-inducible
expression. Cells were selected on puromycin for 2 weeks. Both cell lines were plated and treated with the indicated doses of doxycycline and
lyzed with RIPA buffer 24 hr after induction. A total of 50 mg of cell lysates were loaded onto SDS-PAGE and blotted with the antibodies indicated. The same
membranes were reprobed with anti-a-tubulin antibody as an indicator of equal loading (GFP-blotted membrane shown) (see also Figure 3). See also Figure 3.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S9
Figure S4. Subcellular Localization of CEP164 and SDCCAG8 by Immunofluorescence
(A) CEP164 colocalizes with the mother centriole (labeled with g-tubulin), the mitotic spindle poles (actetylated tubulin), and the midbody throughout the cell cycle
in hTERT-RPE cells. Whereas in the centriole-engaged state (upper panel) g-tubulin antibody labels both centrioles, the a-CEP164 antibody only labels one
centriole (the mother centriole) in hTERT cells. Immunofluorescence of endogenous CEP164 was performed in hTERT cells. Cells were fixed (4% PFA), permeabilized
(0.1% SDS) and immuno-stained with antibody anti-CEP164-NR (red) and costained with anti-g-tubulin or anti-acetylated tubulin antibodies (green).
DAPI was used to label DNA (Blue). Scale bars, 2.5 mm.
(B)–(D) Upon immunofluorescence (IF) in hTERT-RPE cells antibody a-SDCCAG8-CG recognizes nuclear foci that are absent upon transient SDCCAG8/NPHP10
knockdown. Left panels show transfected hTERT-RPE cells, middle panels show IF with a-SDCCAG8-CG, right panels show merge of left and middle panels.
Antibody a-SDCCAG8-CG recognizes nuclear foci in hTERT-RPE cells (middle and right panels). (B) hTERT cells transiently transfected with GFP-labeled
negative control shRNA construct exhibit nuclear foci upon IF with a-SDCCAG8-CG (arrow heads in right panel), whereas in cells transfected with GFP-labeled
SDCCAG8 shRNA knockdown constructs pGIPZ-259547 (C) or pGIPZ-90858 (D) nuclear foci are absent (asterisks in right panels of (C) and (D), demonstrating
specificity of the nuclear foci signal detected by a-SDCCAG8-CG. Scale bars, 5 mm. See also Figure 4.
S10 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Figure S5. (A–B) Immuofluorescence Imaging of the NPHP-RC Protein SDCCAG8/NPHP10 with Other Proteins of Nuclear Foci in hTERT-RPE
Cells, and (C–J) Identification of CCDC92 and TTKB2 as Direct Interaction Partners of CEP164
(A–B) SDCCAG8 labeled with antibody a-SDCCAG8-CG exihibits a similar number and size of nuclear foci in comparison to signals from antibodies against the
nuclear foci markers promyelocytic leukemia protein (PML) (A) and centromere protein C (CENP-C) (B). However, these proteins do not colocalize with
SDCCAG8. Scale bars, 5 mm.
(C–J) Identification of CCDC92 and TTKB2 as direct interaction partners of CEP164. (C) Four baits, BD-CEP164fl
, BD-CEP1641-550
, BD-CEP164551-1100
, and BD-
CEP1641101-1640
were used to screen two retinal cDNA libraries, a human oligo-dT primed library and a bovine randomly primed library, employing a GAL-4 based
yeast two-hybrid system. CEP164 was found to interact with two proteins, coiled coil domain containing protein 92 (CCDC92) and tau tubulin kinase 2 (TTBK2).
The CEP164, CCDC92 and TTBK2 fragments are indicated with amino acids numbering in superscript. (D) Lysates from COS-1 cells transfected with 3xFlag-
CCDC92fl
or 3xFlag-TTBK2fl
were used in a pull-down assay of GST fusion proteins GST-CEP164fl
(191kDa), GST-CEP1-550
(87kDa), GST-CEP164551-1100
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S11
(92kDa), and GST-CEP1641101-1640
(68kDa). 3xFlag-CCDC92fl
preferentially binds GST-CEP164fl
and GST-CEP1641-550
, while 3xFlag-TTBK2fl
binds all four GST
fusion proteins. The results are further confirmed by unbound GST (26kDa), which shows no interaction with 3xFlag-CCDC92fl
nor 3xFlag-TTBK2fl
. (E–F) For
coimmunoprecipitation 3xHA-CEP164fl
in combination with 3xFlag-CCDC92fl
were overexpressed in COS-1 cells (10% protein input shown). In an anti-HA
immunoprecipitation 3xHA-CEP164fl
coprecipitated with 3xFlag-CCDC92fl
(E), whereas the coprecipitation with the unrelated 3xHA-dNp63 is very limited. This
was confirmed in the reciprocal coIP using an anti-Flag antibody against 3xFlag-CCDC92fl
(F).
(G–H) For coimmunoprecipitation 3xHA-CEP164fl
in combination with 3xFlag-TTBK2fl
were overexpressed in COS-1 cells (10% protein input shown). In an antiHA
immunoprecipitation of 3xHA-CEP164fl
, this protein coprecipitated with 3xFlag-TTBK2fl
(G), whereas the coprecipitation with the unrelated 3xHA-dNp63 was
negative. This was confirmed in the reciprocal coIP using an anti-Flag antibody to immunoprecipitate 3xFlag-TTBK2fl
(H).
(I–J) (I) The a-CCDC92 antibody signal fully colocalizes with a-CEP164-M26 at the mother centriole upon immunofluorescence imaging in hTERT-RPE cells. (J)
TTBK2 weakly colocalizes with a-CEP164-M26 at one of the centrioles, but yields a strong signal at the mid body in dividing hTERT-RPE cells. See also Figure 4.
S12 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Figure S6. Molecular Interaction of NPHP-RC Gene Products with DDR Proteins.
(A and B) Interaction of NPHP3 with CEP164. (A) To determine whether CEP164 interacts with known NPHP proteins, HEK293T cells were cotransfected with
expression constructs for N terminally V5-tagged human full-length CEP164 and FLAG-tagged human full length NPHP1-NPHP5, NPHP8, NPHP9, or the control
protein CD2AP as indicated. Comparable amounts of CEP164 were present in all lysates (middle panel). NPHP proteins were precipitated, using anti-Flag M2
beads (bottom panel). NPHP3 immobilized V5-tagged CEP164; a weak interaction was also detectable for NPHP1, 2 and 4 (top panel). (B) The reciprocal
interaction confirmed an interaction between CEP164 and NPHP3. Flag-tagged CEP164 or CD2AP were coexpressed with V5-tagged NPHP1-NPHP4.
Precipitation of NPHP3, but not the control protein CD2AP immobilized V5-tagged NPHP3. A weak, but reproducible interaction was also detected for NPHP4
(top panel).
(C and D) Interaction of NPHP2 with DDB1. (C) HEK293T cells were transiently transfected with the Flag-tagged NPH-proteins NPHP1, NPHP2, NPHP4 or
a control protein (Flag-EPS). Following immunoprecipitation with Flag-antibody Western blot analysis revealed that endogenous DDB1 coprecipitated with
NPHP2 and to a lesser extent with NPHP4 but not with NPHP1 or the control protein.
(D) Control experiment for protein expression using anti-FLAG antibody.
(E and H) Cep164 and Dvl3 are in a precipitable complex. (E) CEP164 and Dvl colocalize at centrosomes. Whereas CEP164 is known to localize to the mother
centriole only, Dvl3 is noted to label both centrioles (upper panel) or to the daughter centriole only (lower panel). HEK293 cells were fixed, labeled with antibody
a-CEP164-PR and a-Dvl3. (F) Domain mapping of the CEP164 interaction with Dvl3. Series of bacterially produced CEP164-GST fragments were incubated with
HEK293 cell lysates, precipitated using GST pull-down, and probed for presence of Dvl3 by immunoblotting against Dvl3 and GST, respectively. Endogenous
Dvl3 interacts with a region within the first 194 amino acids of CEP164, which corresponds to the ATRIP binding domain. (G) CEP164 interacts with the proline-rich
region of Dvl3. HEK293 cells were transfected with GFP-tagged full-length human CEP164 and a panel of truncation mutants of Flag-Dvl3 as indicated, and
coimmunoprecipitation was performed with an anti-GFP antibody. Note that CEP164 only interacts with Dvl3 fragments that contain the proline-rich region (Pro).
(H) Full length CEP164 but not the mutant CEP164-Q525X interacts with Dvl3. HEK293 cells were transfected with the indicated plasmids and subjected to
immunoprecipitation using antibodies against FLAG-Dvl3 (upper panel) or CEP164-mCherryRFP (middle panel). Immunoblot analysis demonstrates strong
interaction with Dvl3 for wild-type (wt) CEP164-mCherryRFP, whereas interactions is strongly reduced for CEP164-Q525X to Dvl3.
Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc. S13
Figure S7. Depletion of CEP164 or ZNF423(Zpf423) Results in Sensitivity to DNA Damaging Agents
(A) Multicolor competition assay (MCA) (Smogorzewska et al., 2007). GFP-U2OS cells were transfected with the indicated siRNAs against CEP164 and ZNF423.
Seventy-two hours after after transfection they were mixed with RFP-U2OS cells transfected with Luciferase (Luc) and DNA damage was induced using the
indicated agents. After 7 days, percent of gfp-positive cells was measured using fluorescence-activated cell sorting and the resistance to DNA damage was
calculated in comparison to untreated cells. DNA damage resistance was set at 100% for GFP-U2OS cells transfected with an siRNA against Luciferase (Luc).
Cells transfected with siRNAs against ATM were used as a positive control. Experiments were done in triplicate. Standard deviations are indicated.
Depletion of CEP164 (B) led to sensitivity to camptothecin (CPT) and gamma irradiation (IR). In addition, depletion with siRNA #3 led to sensitivity to mitomycin C
(MMC). Furthermore, transfection of two separate ZNF423 siRNAs (#2 and #3), that resulted in ZNF423 mRNA depletion as assessed by RT-qPCR (C), caused
sensitivity to MMC, CPT, and IR (L). An siRNA that did not result in ZNF423 mRNA depletion (C), siRNA #1 did not result in increased sensitivity to DNA damage.
(B) Western blot analysis of CEP164 expression after siRNA transfection in cells used in the MCA assay shown in (A)
(C) RT-qPCR in U2OS cells transfected with the three siRNAs against ZNF423 used in the MCA assay shown in (A). Reactions were performed in triplicate.
Standard deviations are indicated.
See also Figure 6.
S14 Cell 150, 533–548, August 3, 2012 ª2012 Elsevier Inc.
Vítězslav Bryja, 2014    Attachments 
 
 
#14 
 
 
L. Čajánek1
, R. Sri Ganji1
, C. Henriques‐Oliveira, P. Koník, S. Theofilopoulos, V. Bryja*, E. 
Arenas*  (2013):  Tiam1  regulates  the  Wnt/Dvl/Rac1  signaling  pathway  and  the 
differentiation of midbrain dopaminergic neurons. Mol. Cell. Biol. 33(1):59‐70. 
1
 equal contribution, *corresponding authors 
 
 
Impact factor (2012): 5.372 
Times cited (without autocitations, WoS, Feb 21st 2014): 4 
Significance:  In  the  non‐canonical  Wnt  pathway,  Wnts  are  known  to  activate  small 
GTPase Rac1 via Dishevelled. Dvl, however, cannot activate Rac1 directly but has 
to act via guanine exchange factor (GEF). Here, we identify Tiam1, a Rac1‐GEF, as 
a  long  searched  protein  responsible  for  Dvl‐mediated  activation  of  Rac1  in  the 
non‐canonical Wnt pathway. 
Contibution  of  the  author/author´s  team:  Identification  and  validation  of  Dvl‐Tiam1 
interaction, and characterization of Tiam1 function in non‐canonical Wnt pathway 
 
 
   
 
 
 
Tiam1 Regulates the Wnt/Dvl/Rac1 Signaling Pathway and the
Differentiation of Midbrain Dopaminergic Neurons
Lukáš Cˇajánek,a
* Ranjani Sri Ganji,b
Catarina Henriques-Oliveira,a
Spyridon Theofilopoulos,a
Peter Koník,c
Víteˇzslav Bryja,b,d
Ernest Arenasa
Molecular Neurobiology Unit, Department of Medical Biochemistry and Biophysics, Karolinska Institute, Stockholm, Swedena
; Institute of Experimental Biology, Faculty of
Science, Masaryk University, Brno, Czech Republicb
; Laboratory of Structural Biology, Faculty of Science, JCU, Ceske Budejovice, Czech Republicc
; Department of
Cytokinetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republicd
Understanding the mechanisms that drive the differentiation of dopaminergic (DA) neurons is crucial for successful development
of novel therapies for Parkinson’s disease, in which DA neurons progressively degenerate. However, the mechanisms underlying
the differentiation-promoting effects of Wnt5a on DA precursors are poorly understood. Here, we present the molecular
and functional characterization of a signaling pathway downstream of Wnt5a, the Wnt/Dvl/Rac1 pathway. First, we
characterize the interaction between Rac1 and Dvl and identify the N-terminal part of Dvl3 as necessary for Rac1 binding. Next,
we show that Tiam1, a Rac1 guanosine exchange factor (GEF), is expressed in the ventral midbrain, interacts with Dvl, facilitates
Dvl-Rac1 interaction, and is required for Dvl- or Wnt5a-induced activation of Rac1. Moreover, we show that Wnt5a promotes
whereas casein kinase 1 (CK1), a negative regulator of the Wnt/Dvl/Rac1 pathway, abolishes the interactions between Dvl and
Tiam1. Finally, using ventral midbrain neurosphere cultures, we demonstrate that the generation of DA neurons in culture is
impaired after Tiam1 knockdown, indicating that Tiam1 is required for midbrain DA differentiation. In summary, our data
identify Tiam1 as a novel regulator of DA neuron development and as a Dvl-associated and Rac1-specific GEF acting in the Wnt/
Dvl/Rac1 pathway.
Wnt ligands are known to activate a number of highly evolutionary
conserved pathways that regulate various essential
aspects of embryo development and adult tissue homeostasis. The
Wnt/␤-catenin pathway, also referred to as the canonical Wnt
signaling pathway, is the most intensively studied and best defined
pathway (1, 2). In this study, we focus on Wnt signaling pathways
independent of ␤-catenin, in particular on Wnt-mediated activation
of small GTPases (3, 4). These pathways are also involved in
many aspects of embryogenesis, such as proper morphogenesis
and differentiation of neuronal tissue (5), including the ventral
midbrain (6, 7), the area where dopaminergic (DA) neurons are
born. We and others have previously shown that Wnt5a activates
a ␤-catenin-independent signaling in DA cells (8) and promotes
DA differentiation of primary ventral midbrain precursor cells, as
well as of mouse neural and embryonic stem cells (9–12).
To date, the precise molecular mechanisms underlying the
prodifferentiation effects of Wnt5a and the signaling pathways
activated by Wnt5a in DA cells, as well as in other cell types, are
only beginning to emerge. We recently demonstrated that the
prodifferentiation effects of Wnt5a require the activity of the Rac1
GTPase (6). Rac1 belongs to the Rho family of small GTPases, and
its activity is controlled by guanosine exchange factors (GEFs),
GTPase activity-activating proteins (GAPs), and guanine nucleotide
exchange inhibitors (GDIs) (13, 14). While Wnt ligands are
known to trigger activation of various small GTPases from the
Rho and Ras families in various cell types (4), evidence for the
employment of specific GEFs in Wnt5a/Rac1 signaling is missing,
and the mechanism of small GTPase activation in context of Wnt
signaling is poorly understood.
In the present study, we aimed to elucidate the mechanism of
Rac1 activation in the Wnt5a/Rac1 pathway. Earlier work proposed
that Rac1 interacts with Dishevelled (Dvl) (15, 16), a cytosolic
protein with three homologs in mammals. Dvl is a critical
component of Wnt-driven signaling, acts as a scaffolding protein
associated with many different intracellular proteins (17, 18), and
is phosphorylated by several kinases, such as casein kinase 1 (CK1)
(9, 19).
In our study, we first characterize the Dvl-Rac1 interaction and
show that the N-terminal part of Dvl3 is required for complex
formation between Rac1 and Dvl3, as well as for the activation of
Rac1. We next searched for Dvl interactors and found that the
Rac1 GEF T-cell lymphoma invasion and metastasis 1 (Tiam1)
(20) is a novel binding partner of Dvl. Moreover, using loss-offunction
(LOF) approaches, we demonstrated that Tiam1 is functionally
required for the activation of Rac1 by Wnt5a or Dvl, as
well as for generation of DA neurons from DA progenitors in
neurosphere cultures. In sum, we hereby provide biochemical and
functional evidence that Tiam1 is a novel regulator of Wnt/Dvl/
Rac1 signaling that is required for midbrain DA neuron differen-
tiation.
MATERIALS AND METHODS
Cell culture, transfection, and treatments. The mouse SN4741 DA cell
line was propagated as described before (21). For the purpose of transient
Received 5 June 2012 Returned for modification 10 July 2012
Accepted 11 October 2012
Published ahead of print 29 October 2012
Address correspondence to Vitezslav Bryja, bryja@sci.muni.cz, or Ernest Arenas,
ernest.arenas@ki.se.
* Present address: Lukáš Cˇajánek, Biozentrum, University of Basel, Switzerland.
L.C. and R.S.G. contributed equally to this work.
Copyright © 2013, American Society for Microbiology. All Rights Reserved.
doi:10.1128/MCB.00745-12
January 2013 Volume 33 Number 1 Molecular and Cellular Biology p. 59–70 mcb.asm.org 59
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
gene overexpression, cells were transfected with Superfect (Qiagen) according
to the manufacturer’s instructions. The following constructs were
used: MYC-Dvl2 (22), FLAG-Dvl3, hemagglutinin (HA)-Dvl3 (23), Dvl2enhanced
green fluorescent protein (EGFP) (24), HA-Dvl2 (wild type
[wt] and M1, M2, and M4 mutants) (25), FLAG-Tiam1 (26), and MYCRac1
(27). For experiments involving small interfering RNA (siRNA), the
SN4741 cells were transfected with 50 to 100 nM siGENOME Tiam1
siRNA (SMARTpool M-047-08-01) or nontargeting siRNA (both from
Dharmacon) by using Lipofectamine 2000 (Invitrogen) according to the
manufacturer’s recommendations. The efficiency of the silencing was assessed
by Western blotting or quantitative PCR (qPCR). For analysis of
cellular signaling, the cells were stimulated with 100 ng/ml of mouse
Wnt5a (R&D Systems) for 2.5 h. Control stimulations were done with
vehicle (0.1% bovine serum albumin [BSA], 0.05% CHAPS in phosphatebuffered
saline [PBS]). HEK293A cells, T98G cells, U78MG cells, or
mouse embryonic fibroblasts (MEFs) were grown in Dulbecco’s modified
Eagle’s medium (DMEM) containing 10% fetal calf serum (FCS), 2 mM
L-glutamine, 50 units/ml penicillin, and 50 units/ml streptomycin. Transient
transfections of HEK293A cells were carried out with polyethylimin
(PEI) with a ratio of 1 ␮g DNA per 3 ␮l of PEI in 100 ul serum-free
medium, incubating the mixture for 10 min at room temperature, and
adding the mixture dropwise to HEK293A cells in their culture medium.
The following constructs, in addition to those listed above, were used:
FLAG-Dvl3 deletion mutants (23). Inhibitors of CK1 (D4476, Calbiochem;
PF-670462, Tocris Bioscience) were used as described previously
(28, 29), where indicated.
Immunoprecipitation, Western blotting, and densitometry analyses.
HEK293A cells (24 to 36 h after transfection), SN4741 cells, T98G
cells, or U78MG cells (endogenous immunoprecipitation [IP]) were harvested
for total cell extract in RIPA buffer (150 mM NaCl, 50 mM Tris-Cl
[pH 7.4], 1 mM EDTA, 0.5% NP-40, 1ϫ protease inhibitor cocktail
[Roche]) or RIPA plus 0.05% SDS buffer (for Rac1 immunoprecipitations).
Whole adult brain extract has been prepared by mechanical dissociation
of brain tissue and subsequent lysis in complete RIPA buffer. Cell
extracts were cleared from cell debris by centrifugation (16,000 ϫ g for 15
min at ϩ4°C), and supernatants were incubated with protein G-Sepharose
(GE Healthcare) (1 h at ϩ4°C in an orbital shaker) to pull down
nonspecific interactors. Subsequently, precleared extracts obtained after
centrifugation (200 ϫ g for 5 min at ϩ4°C) were incubated with 1 ␮g (10
␮g in case of IPs for mass spectrometry [MS] analyses) of the following
antibodies: mouse monoclonal anti-Rac1 (clone 23A8; Millipore), rabbit
polyclonal anti-Tiam1 (sc-872), mouse monoclonal anti-MYC (sc-40),
mouse monoclonal anti-Dvl2 (sc-8026), mouse monoclonal anti-Dvl3
(sc-8027) (Santa Cruz Biotechnology), rabbit polyclonal anti-FLAG
(F7425; Sigma) antibodies, for 30 min at ϩ4°C in an orbital shaker and
subsequently with protein G-Sepharose. Following overnight incubation,
samples were rigorously washed with RIPA buffer and subsequently analyzed
by Western blotting. Sample preparation and Western blotting was
done as described before (30). Luminescence was detected by either film
exposure (Agfa), in the case of Fig. 3G and H and 4B to E, or the ChemiDoc
XRS system (Bio-Rad). Nonsaturated images, within dynamic range
of the charge-coupled-device (CCD) camera, were chosen as representative
and used for densitometric analyses. The following antibodies were
used, in addition to those described before: mouse monoclonal antiFLAG
antibody (M2; Sigma), rabbit polyclonal anti-Dvl2 antibody
(sc-13974; Santa Cruz Biotechnology), horseradish peroxidase (HRP)conjugated
anti-mouse secondary antibody (GE Healthcare), and
HRP-conjugated anti-rabbit secondary antibody (Sigma).
GTPase pulldown assay. Cells were harvested in GTPase lysis buffer
(150 mM NaCl, 10 mM Tris-Cl [pH 7.4], 10 mM MgCl2, 1% Triton
X-100, 0.1% SDS, 1 mM dithiothreitol [DTT], 1ϫ protease inhibitor
cocktail [Roche]). The pulldowns were performed with recombinant
GST-PAK-CRIB as described before (31). For experiments with Tiam1
siRNA, the SN4741 cells were seeded out (750,000 cells/6-well plate),
transfected first with either control or Tiam1 siRNA 24 h after seeding,
and then transfected with the indicated expression constructs after an
additional 24 h, processed 24 h after the last transfection, and subsequently
analyzed by Western blotting. In experiments involving Dvl overexpression,
MYC-Rac1 was cotransfected, and changes in Rac1 activity
were subsequently measured for MYC-Rac1. A densitometry analysis was
performed using Image J software, where indicated. The level of activated
Rac1 (GTP-Rac1) was normalized to the level of Rac1 in total cell lysate
(TCL).
LC-MS/MS and data mining. Following the coimmunoprecipitation
(extracts from 5- by 15-cm plates of 80 to 90% confluent MEFs were used
per one condition), samples were washed in detergent-free RIPA buffer
and subjected to proteomics grade trypsin digest (10 ng/␮l at 37°C for 12
h) (Sigma). Liquid chromatography-tandem mass spectrometry (LC-MS/
MS) was performed on a NanoAcquity ultraperformance liquid chromatograph
(UPLC; Waters) coupled to an ESI Q-Tof Premier (Waters)
mass spectrometer. Digested peptides were first desalted using a ZipTip
C18 column (Millipore), diluted in MQ water, and loaded onto a nanoAcquity
UPLC symmetry trap column (Waters) packed with 5 ␮m BEH
C18 beads. Peptides were eluted through a nanoAcquity (Waters) analytical
column packed with 1.7 ␮m BEH C18 beads at a flow rate of 400
nl/min using a gradient of 3 to 40% acetonitrile with 0.1% formic acid for
35 min. Effluent was directly fed into the ESI source of the MS instrument.
Raw data were acquired in MSE
Identity mode and later subjected to a
search using UniProt and NCBI mouse protein database by the PLGS2.3
software (Waters). Acetyl N terminus, deamidation N and Q, carbamidomethyl
C, and oxidation M were set as variable modifications. Peptide
accuracy and MS/MS fragment mass accuracy was set to less than 20 ppm.
Generated hit lists were manually curated to remove common contaminants
and hits found in IgG IP samples.
Immunocytochemistry and confocal microscopy. SN4741 cells
(20,000 to 40,000 cells/well of a 24-well plate) were grown overnight on
glass coverslips and transfected with the indicated plasmids. Twenty-four
hours posttransfection, cells were fixed in 4% paraformaldehyde (15 min
at ϩ4°C), serum blocked, and incubated in the appropriate primary and,
subsequently, secondary antibodies as previously described (32). The following
antibodies were used: mouse monoclonal anti-Rac1 (1:100; Millipore),
rabbit polyclonal anti-FLAG (1:1,000; Sigma), rabbit polyclonal
anti-MYC, mouse monoclonal anti-MYC (both 1:1,000; Santa Cruz Biotechnology),
Alexa Fluor 488–goat anti-mouse or anti-rabbit, and Alexa
Fluor 555–donkey anti-mouse or anti-rabbit (all 1:1,000; Molecular
Probes, Invitrogen) antibodies. Fluorescent labeling was examined using
a Zeiss LSM5 exciter inverted confocal scanning laser microscope.
Precursor cultures. Ventral midbrain (VM) precursor cultures were
grown as neurospheres, as previously described (12). Briefly, VMs were
dissected from E10.5 mouse embryos, dissociated with collagenase/dispase
(30 min at 37°C on a rocking platform), followed by mechanical
trituration. Next, cells were plated at a density of 100,000 cells/cm2
in 1 ml
of N2 medium (supplemented with 250 ng/nl Shh, 25 ng/ml fibroblast
growth factor 8 [FGF8], and 20 ng/ml FGF2) and grown as neurospheres
for 7 days. A total of 0.5 ml of fresh medium was added every second day.
At day 7, spheres were collected and broken into small cell clusters (collagenase/dispase
treatment plus mechanical trituration), which were then
seeded at a density of 100,000 cells/cm2
on poly-D-lysine–laminin-precoated
plates in N2 medium (no growth factors) and transfected with
appropriate siRNA (50 to 100 nM) using Lipofectamine 2000. Fresh N2
medium was added 24 h after transfection (supplemented with brainderived
neurotrophic factor (BDNF) and glial cell-derived neurotrophic
factor (GDNF) to a final concentration 20 ng/ml of each), and cells were
harvested 3 days after the transfection.
For experiments with lentiviral particles, the VM tissue was dissected
and plated as described above. The cells were transduced immediately
after dissection in N2 medium containing Shh, FGF2, FGF8, and polybrene
(2 ␮g/ml). After 24 h, the medium was replaced with a fresh one.
Cells were grown as neurospheres for 5 days, with the addition of fresh
medium every 2 to 3 days. At day 5, spheres were collected and seeded at a
Cˇajánek et al.
60 mcb.asm.org Molecular and Cellular Biology
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
density of 50 spheres/cm2
on PDL-laminin-precoated plates in N2 medium
(with BDNF and GDNF, 20 ng/ml each) and differentiated for 3
days.
The efficiency of the silencing was determined by qPCR. For immunocytochemistry
experiments, the following antibodies were used: rabbit
polyclonal anti-tyrosine hydroxylase (anti-TH) (1:500; Pel-Freeze),
mouse monoclonal anti-␤III tubulin (Tuj, 1:1,000; Promega), mouse
monoclonal anti-TH (1:400; Sigma), mouse anti-GFP (1:75; Millipore),
and rabbit anti-GFP (1:800; Invitrogen) antibodies. Two or three wells per
condition were analyzed in each experiment. The DA neuron numbers
were counted as either the number of THϩ
cells per area of Tujϩ
cell
clusters (10 randomly selected observation fields per well, siRNA experiments)
or the number of THϩ
cells per area of DAPIϩ
(4=,6-diamidino-
2-phenylindole) clusters (all spheres within the well analyzed, short hairpin
RNA [shRNA] experiments). The area of DAPIϩ
clusters was
measured in square pixels and subsequently converted into square micrometers
(1 square pixel ϭ 0.6209 square ␮m, for 10ϫ objective and 2ϫ
zoom).
CD1 mice (Charles River) were housed, fed, and sacrificed according
to Karolinska Institute guidance for animal experiments and the ethical
permits to E.A.
Production of lentiviral shRNA particles. Third-generation replication-incompetent
lentiviral vectors (pLKO.1-CMV-tGFP) encoding either
nontargeting shRNA or Tiam1 shRNA (TRCN0000042594 and
TRCN0000042595) were obtained from Sigma. The viral particles, vesicular
stomatitis virus glycoprotein (VSVG) pseudotyped, were produced
using the four-plasmid system as previously described (33). Forty-eight
hours later, after transfection of HEK293T cells, the supernatant was collected
and filtered. High-titer stocks were obtained by ultracentrifugation
(50,000 ϫ g for 2 h), and the pellets were resuspended in PBS with 1% BSA
and stored at Ϫ80°C until further use. The titers used for primary cell
transduction were in the range of 1 ϫ 107
to 1.5 ϫ 107
transducing units
per ml, and the multiplicity of infection was 1 to 2.
Reverse transcription (RT)-PCR and quantitative PCR. Total RNA
from either SN4741 or differentiated VM cultures was extracted using the
RNeasy extraction kit (Qiagen) according to the manufacturer’s instructions.
Preparation of cDNA, quantitative PCR (qPCR), and primers used
in this study were described previously (10), with the exception of the
following: Tiam1 primers (forward, GAG CCA GAG GGA GGC GTG GA;
reverse, TGG CAT CCT GAG GGG ACG GG), Rac1 primers (forward,
CGT CCC CTC TCC TAC CCG CA; reverse, CTT TCG CCA TGG CCA
GCC CC). 18S was used as an internal control. Relative mRNA expression
was calculated as a fold change versus the control.
Statistical analyses. Statistical analyses (Student’s t test, Mann-Whitney
test, one-way analysis of variance [ANOVA] with Neumann-Keuls
multiple comparison test, and Kolmogorov-Smirnov test) were performed
using Prism 4 (GraphPad Software). P values of Ͻ0.05 were considered
statistically significant differences. Results are presented as
means Ϯ standard errors of the means (SEM).
RESULTS
Characterization of the interaction between Rac1 and Dvl. We
previously found that Wnt5a treatment activates the small GTPase
Rac1 in DA cells (6). Indeed, stimulation of SN4741 dopaminergic
(DA) cells with recombinant Wnt5a increased the level of Rac1GTP
(activated Rac1) compared to vehicle-treated cells (Fig. 1A
and B). It has been shown that Dishevelled (Dvl), a critical component
of Wnt signaling machinery, is sufficient to increase Rac1
activity (15) and that it coimmunoprecipitates with Rac1 in hippocampal
neurons (16). We thus decided to examine and characterize
the possible interaction between Rac1 and Dvl in DA cells.
As Dvl2 and Dvl3 are both involved in Wnt5a-mediated signaling
in DA cells (9), we first analyzed the cellular distribution of
Dvl2-MYC or Dvl3-FLAG after overexpression in SN4741 cells.
Dvl, as a scaffolding protein, undergoes highly dynamic polymerization.
This was reflected by formation of dynamic protein complexes
in the cytosol (34), referred to as Dvl dots/puncta (35, 36).
Interestingly, Dvl2-MYC/Dvl3-FLAG immmunoreactive puncta
colocalized with endogenous Rac1 in cells where either Dvl2MYC
or Dvl3-FLAG was overexpressed (Fig. 1C and D), suggesting
that endogenous Rac1 is recruited to the Dvl-containing protein
complexes.
We next performed coimmunoprecipitation experiments in
HEK293A cells and observed that endogenous Rac1 coimmunoprecipitates
with both Dvl2-MYC (Fig. 1E) and Dvl3-FLAG (Fig.
2A) with similar efficiency. To get further insight into the interaction
between Dvl and Rac1 and its possible functional consequences
for Wnt signaling, the region of Dvl that mediates binding
FIG 1 Dvl and Rac1 form a complex. (A) Wnt5a treatment (100 ng/ml; 2.5 h)
triggers the activation of Rac1 (increase in Rac1-GTP) in SN4741 DA cells. (B)
Quantification of the effect of Wnt5a on Rac1 activity, compared to vehicle
treatment. The levels of Rac1-GTP were normalized to the total amount of
Rac1 under each condition. (C) Colocalization of Rac1 (Alexa 555, red) and
Dvl2-MYC (Alexa 488, green). Note the recruitment of endogenous Rac1 into
immunoreactive puncta by expression of Dvl2-MYC. (D) Colocalization of
Dvl3-FLAG (Alexa 555, red) and Rac1 (Alexa 488, green). (E) Dvl2-MYC
coimmunoprecipitates with endogenous Rac1 in HEK293A cells. The right
panel shows total cell lysate (TCL). *, P Ͻ 0.05 by Student t test.
Tiam1 Regulates Noncanonical Wnt Signaling
January 2013 Volume 33 Number 1 mcb.asm.org 61
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
to Rac1 was determined using the FLAG-tagged deletion constructs
of Dvl3 (23). The full-length Dvl3-FLAG and the three
C-terminal deletion Dvl3 mutants coimmunoprecipitated with
endogenous Rac1 (Fig. 2A and B). Importantly, however, deletion
mutants lacking the N-terminal part, including the DIX domain,
failed to be detected after Rac1 immunoprecipitation (see lanes
2 to 4 in Fig. 2A). Note that Dvl3 mutant 5, which lacks the
C-terminal part, including the PDZ and DEP domains, showed
somewhat weaker coimmunoprecipitation with Rac1 than the
remaining Dvl mutants. These results indicated that the DIX
domain of Dvl is required for its interaction with Rac1 and that
this complex is possibly stabilized by interaction(s) with the
C-terminal part of Dvl.
Since the DIX domain of Dvl is required for the formation of
Dvl-containing polymers (25), we tested whether the failure to
interact with Rac1 could be due to impaired polymerization of
Dvl. Several amino acids (Y27, F43, and V67 together with K68)
within the DIX domain have been demonstrated as critical for Dvl
polymerization and Wnt/␤-catenin signaling (25). While Dvl2
DIX domain mutant M4 (Y27D) retained some of the capacity of
Dvl2 to form large cytosolic complexes in SN4741 cells, mutants
M1 (F43S) and M2 (V67A and K68A) completely failed to form
such complexes (Fig. 2C) (25). Interestingly, M1 and M2 mutants
retained both (i) the ability to coimmunoprecipitate with Rac1
(Fig. 2D), even if the M1 mutant was somewhat less efficient in
coimmunoprecipitation, and (ii) the potential to induce Rac1 acFIG
2 The N-terminal part of Dvl is required to interact with Rac1. (A) Deletion mapping of the Dvl3 domain mediating the interaction with Rac1 in HEK293A
cells. The FLAG-Dvl3 expression constructs used in coimmunoprecipitation experiments are showed in panel B (total cell lysates [TCL] shown to the right). Note
that FLAG-Dvl3 pulldown after Rac1 immunoprecipitation (IP) was lost in Dvl3 mutants lacking the N-terminal part, including the DIX domain. Arrows point
to the Dvl3-FLAG variants coimmunoprecipitating with endogenous Rac1. (B) Schematic representation of the constructs used in panel A and the results
obtained. ϩ or Ϫ symbols indicate the efficiency of coimmunoprecipitation for the different mutants. (C) HEK293A cells were transfected with the indicated
expression constructs of Dvl2 harboring point mutations in the DIX domain. Subcellular localization of individual Dvl2 mutants has been determined by
immunocytochemical staining using anti-HA antibody. (D) Coimmunoprecipitation of all Dvl2 constructs was detected after Rac1 immunoprecipitation but not
if control IgG was used instead of an anti-Rac1 antibody. (E) HEK293A cells were transfected with the indicated Dvl constructs and Rac1-MYC. Rac1 activity was
determined by the level of Rac1-GTP pulldown. Note that Rac1 was not activated by the Dvl3 ⌬N-FLAG construct. (F) Summary of experiments shown in panel
E. *, P Ͻ 0.05; **, P Ͻ 0.01 by Student t test (compared to mock).
Cˇajánek et al.
62 mcb.asm.org Molecular and Cellular Biology
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
tivation, as shown by the increased levels of Rac1-GTP (Fig. 2E
and F). On the other hand, Dvl3-⌬N (construct 2 in Fig. 2B),
which lacks the whole DIX domain, failed to activate Rac1 (Fig. 2E
and F). These results indicate that the N terminus of Dvl, including
the DIX domain (amino acids 1 to 81), is required for the
Dvl-Rac1 interaction and for the Dvl-mediated Rac1 activation. In
contrast, structural integrity of the DIX domain, which is absolutely
crucial for DIX-mediated polymerization and Dvl function
in Wnt/␤-catenin signaling, is dispensable for activation of Rac1.
These findings prompted us to examine alternative mechanisms
of Rac1 activation by Dvl.
Tiam1, a Rac1 GEF, interacts with Dvl. We next used a proteomic
approach to identify endogenous interactors of Dvl that
could be involved in the activation of Rac1. The PDZ domaincontaining
proteins have been previously found to act as critical
scaffolds for the activation of GTPases from the Rho family (37,
38). In our experiments, we performed immunoprecipitation of
Dvl3 in mouse embryonic fibroblasts (MEFs) and subsequent
LS-MS/MS. In addition to previously described Dvl binding partners
such as nucleoredoxin (NXN) (17) or Ror2 (17), we found
T-cell lymphoma invasion and metastasis-inducing protein 1
(Tiam1) (Fig. 3A), which is a Rac1 GEF known to activate Rac1
(20).
In order to verify the Dvl-Tiam1 interaction, we first overexpressed
Tiam1-FLAG and Dvl2-EGFP in SN4741 DA cells and
subsequently analyzed their subcellular localization by confocal
microscopy. In cells transfected with Tiam1-FLAG only, Tiam1FLAG
was localized both in cytosol and at the membrane (Fig.
3B). Upon Dvl2-EGFP coexpression, the membrane-localized
pool of Tiam1-FLAG was not significantly mobilized, but the cytosolic
pool was efficiently relocated and colocalized with Dvl2EGFP
in cytosolic puncta. These findings thus supported the possibility
of a Dvl-Tiam1 protein-protein interaction in the cytosolic
puncta (Fig. 3C).
To further confirm that Dvl and Tiam1 are part of the same
protein complex, we performed coimmunoprecipitations in
HEK293A cells. We found that Tiam1 interacted with both
Dvl2-HA (Fig. 3D) and Dvl3-FLAG (Fig. 3E), as detected by their
coimmunoprecipitation with Tiam1-FLAG. Importantly, analysis
of adult mouse brain lysates showed that endogenous Tiam1
could be pulled down both with Dvl3 (Fig. 3F) and Dvl2 antibodies
(Fig. 3G). These results thus show that both endogenous Dvl2
FIG 3 Tiam1 is a novel Dvl binding partner. (A) Tiam1 is present in Dvl3-associated complexes, identified by LC-MS/MS after endogenous Dvl3 coimmunoprecipitation.
(B) Tiam1-FLAG protein (red) localizes both in the cytosol and at the membrane (arrow) upon overexpression in SN4741. Topro3 was used to
counterstain the cell nucleus. (C) Coexpression of Dvl2-EGFP (green) and Tiam1-FLAG (red) in SN4741 cells leads to a cytoplasmic colocalization of Dvl2-EGFP
and Tiam1-FLAG in puncta. Arrowheads show that a small pool of Tiam1-FLAG that did not colocalize with Dvl2-EGFP remained in the membrane. (D)
Dvl2-HA was found to form a complex with Tiam1-FLAG, as assessed by immunoprecipitation with Tiam1-FLAG in HEK293A cells (first panel, last lane). The
next panel shows total cell lysates (TCL). (E) Dvl3-FLAG was also immunoprecipitated by Tiam1-FLAG in HEK293A cells. The complex formed by Tiam1-FLAG
and Dvl3-FLAG was detected by immunoprecipitation with either anti-Dvl3 or anti-Tiam1 antibodies. (F and G) Endogenous Dvl3 (F) or endogenous Dvl2 (G)
were immunoprecipitated from whole adult mouse brain lysates, and the presence of Tiam1 has been detected with an anti-Tiam1 antibody. IgG, control
antibody.
Tiam1 Regulates Noncanonical Wnt Signaling
January 2013 Volume 33 Number 1 mcb.asm.org 63
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
and Dvl3 form complexes with endogenous Tiam1. Detailed mapping
of the interaction domains using Dvl3 deletion constructs
described in Fig. 2B showed that the proline-rich domain between
PDZ and DEP is essential for Tiam1 binding (Fig. 4A and B). Our
domain mapping of Dvl suggests that while Rac1 binds at the
N-terminal DIX domain, Tiam1 binds at the C-terminal prolinerich
domain of Dvl, and hence Dvl can serve as a scaffold for the
Rac1-Tiam1 interaction.
Tiam1 interaction with Dvl is promoted by Wnt5a and CK1
inhibition. We next examined whether the interaction between
Dvl and Tiam1 could be modulated by casein kinase 1 (CK1), a
critical regulator known to phosphorylate several components of
the Wnt pathway, including Dvl (9, 19). Importantly, the prolinerich
domain of Dvl, which we found to be required for Tiam1
binding, contains many residues phosphorylated by CK1 (39, 40).
We previously identified CK1ε as a negative regulator of Dvlinduced
Rac1 activation and found that pharmacological inhibition
of CK1 by D4476 increases the level of Rac1-GTP in mouse
embryonic fibroblasts (31). As shown in Fig. 5A, D4476 (50 ␮M, 2
h) led to increased Rac1 activity also in SN4741 cells. We therefore
examined whether the interaction between Dvl and Tiam1 is
modified by CK1ε overexpression or pharmacological inhibition
of CK1. Overexpression of CK1ε completely abrogated the interFIG
4 Proline-rich region of Dvl3 is required for interaction with Tiam1. (A)
Schematic representation of the domain mapping of the interaction between
Tiam1-HA and Dvl3-FLAG deletion mutants. ϩ or Ϫ symbols indicate the
efficiency of coimmunoprecipitation for the different mutants used in panel B.
The top panel shows detection of Dvl3-FLAG mutants after immunoprecipitation
of Tiam1-HA by anti-HA antibody. Note the lack of signal from FLAG
antibody in lanes with Dvl3 mutants 496-716 and 1-246. Bottom panel shows
total cell lysate (TCL).
FIG 5 CK1 and Wnt5a regulate Tiam1-Dvl3 interaction. (A) Inhibition of
CK1 with 50 ␮M D4476 (for 2 h) induced the activation of Rac1 in SN4741
cells. Activation was determined by pulldown of Rac1-GTP and subsequent
Western blotting. The efficiency of the inhibition of CK1 was monitored by the
disappearance of the hyperphosphorylated form of Dvl2 after D4476 treatment.
(B) CK1 negatively regulates the interaction between Tiam1-FLAG and
Dvl3-HA as assessed by coimmunoprecipitation of Dvl3-HA by FLAG antibodies
and subsequent Western blotting. Note that the coexpression of CK1ε
abrogated the Tiam1-Dvl3 interaction (compare lanes 4 and 7), while pharmacological
inhibition of CK1 increased the coimmunoprecipitation of
Dvl3-HA (lanes 5 and 6) and rescued the effect of CK1ε overexpression (lane
8). CK1 inhibitors D4476 (50 ␮M) and PF-670462 (5 ␮M) were added to the
medium 2 to 3 h before cells were harvested for immunoprecipitation. (C to E)
Wnt5a and CK1 inhibitor (PF-670462) promoted the interaction between
endogenous Dvl3 and Tiam1 in dopaminergic SN4741 (C), glioma T98G (D),
and U78G (E) cell lines. Immunoprecipitation with anti-Tiam1 antibodies was
followed by Western blot detection of Dvl3 interacting with Tiam1.
Cˇajánek et al.
64 mcb.asm.org Molecular and Cellular Biology
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
action between Tiam1-FLAG and Dvl3-HA (compare lanes 4 and
7 in Fig. 5B). Moreover, both endogenous and overexpressed CK1
was found to coimmunoprecipitate with Tiam1-FLAG (lanes 5 to
8 in Fig. 5B). On the other hand, the inhibition of CK1 by either
D4476 (50 ␮M) or PF-670462 (5 ␮M) for 2 to 3 h led to a robust
increase in the amount of Dvl3-HA that coimmunoprecipitated
with Tiam1-FLAG. Importantly, the negative effect of CK1 overexpression
was rescued by CK1 inhibition (compare the last two
lanes in Fig. 5B). These results demonstrate that the interaction
between Dvl and Tiam1 is under the dynamic control of CK1 and
suggest that CK1 may also regulate the interaction between Dvl
and Tiam1 in the context of endogenous Wnt signaling. In order
to test this possibility, we have analyzed the effects of Wnt5a treatment
and CK1 inhibition on the interaction of endogenous Dvl3
and Tiam1 in dopaminergic SN4741 cells. Our results show that
while the interaction between Tiam1 and Dvl3 is almost negligible
in control conditions, it can be clearly induced by Wnt5a treatment
or by the CK1 inhibition by PF-670462 (Fig. 5C). These
findings were also confirmed in other neural cell lines, such as
U78MG (Fig. 5D) and T98G (Fig. 5E). Thus, our results indicate
that Wnt5a and CK1 inhibition promote the interaction between
endogenous Dvl and Tiam1 in different neural types, including
midbrain DA neurons.
Does Tiam1 regulate Rac1 function and the formation of
Dvl-Rac1 complexes? The results obtained until this point indicated
that Dvl2 and Dvl3 interact and colocalize not only with
Rac1 but also with Tiam1 and that Tiam1-Dvl interaction is under
tight control of CK1 and Wnt5a. We thus decided to examine
whether Tiam1 can regulate the formation of the Dvl-Rac1 complex
and the activity of Rac1. We found that the coimmunoprecipitation
of Dvl2-MYC with Rac1 was enhanced when Tiam1FLAG
was overexpressed (Fig. 6A). Quantification of these results
(n ϭ 5) indicated that the expression of Tiam1 increased the Dvl2Rac1
coimmunoprecipitation by 46%, compared to the condition
without Tiam1 expression (Fig. 6B). Thus, our results suggest that
the presence of Tiam1 facilitates the Dvl-Rac1 interaction.
We next examined whether Tiam1 also acts as a Rac1 GEF and
regulates the activity of Rac1. As expected, Tiam1 overexpression
was sufficient to induce Rac1 activation in both HEK293A and
SN4741 cells (Fig. 6C). In light of these data, we found it plausible
that Tiam1 could be functionally required for Rac1 activation in
context of the Wnt/Dvl/Rac1 pathway. In order to test this possibility,
we knocked down Tiam1 protein in SN4741 DA cells using
a Tiam1 siRNA. While Dvl2-MYC or Dvl3-FLAG overexpression
increased the level of activated MYC-tagged Rac1-GTP in control
siRNA cells, they did not activate Rac1 when Tiam1 expression
was knocked down (Fig. 6D and data not shown). Moreover, the
relative increases in Rac1-GTP levels after Dvl2-MYC or Dvl3FLAG
overexpression were significantly decreased to almost basal
levels after Tiam1 knockdown (Fig. 6E and data not shown). Next,
we tested whether Tiam1 was similarly required for Wnt5a liganddependent
activation of Rac1 in SN4741 DA cells. We found that
the ability of Wnt5a to increase Rac1-GTP levels was impaired
when Tiam1 expression was knocked down by siRNA (Fig. 6F and
G). In sum, our results show that Tiam1 is sufficient for Rac1
activation in DA cells and, more importantly, that Tiam1 is required
for the activation of Rac1 by either Dvl overexpression or
acute stimulation by Wnt5a. Thus, our results identify Tiam1 as a
novel regulator of the noncanonical Wnt/Dvl/Rac1 signaling
pathway.
FIG 6 Tiam1 functionally interacts with Dvl to regulate Rac1 activation. (A)
Dvl2-MYC was pulled down by Rac1 (first lane), and this coimmunoprecipitation
was enhanced by coexpression of Tiam1-FLAG (third lane). (B) Densitometric
quantification of the relative amount of Dvl2-MYC coimmunoprecipitating
with Rac1 in control or Tiam1 cotransfected cells. Values were
normalized to the total level of Dvl-MYC in total cell lysate (TCL). (C) SN4741
and HEK293A cells were transfected with a Tiam1-FLAG or mock plasmid and
analyzed for the level of GTP-Rac1 24 h after transfection. Tiam1-FLAG was
sufficient to increase GTP-Rac1 levels, compared to that of the control, in both
cell lines. (D) SN4741 cells were transfected with control or Tiam1 siRNAs and
subsequently with Rac1-MYC and Dvl3-FLAG or mock vector. Dvl3-FLAG
increased the levels of MYC-tagged Rac1-GTP compared to those of mocktransfected
SN4741 cells, but not in cells where Tiam1 expression was knocked
down by siRNA. (E) Densitometric quantification of the relative level of Rac1GTP
(normalized to total MYC-tagged Rac1) induced by Dvl3-FLAG in control
or Tiam1 siRNA conditions. (F) SN4741 cells transfected with control or
Tiam1 siRNA and 24 h after they were stimulated with Wnt5a (100 ng/ml) or
vehicle (PBS-CHAPS) for 2.5 h and subsequently analyzed for Rac1 activation
(level of Rac1-GTP). (G) Densitometric quantification of the relative level of
Rac1-GTP (normalized to total Rac1) induced by Wnt5a stimulation in control
siRNA versus Tiam1 siRNA (second versus fourth lane). *, P Ͻ 0.05 by
Mann-Whitney test.
Tiam1 Regulates Noncanonical Wnt Signaling
January 2013 Volume 33 Number 1 mcb.asm.org 65
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
Cˇajánek et al.
66 mcb.asm.org Molecular and Cellular Biology
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
Tiam1 is required for the differentiation of midbrain DA
precursors into neurons. As we hereby report that Tiam1 regulates
the function of Rac1 in the context of the Wnt/Dvl/Rac1
pathway and we have previously reported that Wnt5a and Rac1
are involved in differentiation of primary ventral midbrain DA
neurons (6), we decided to examine the possible contribution of
Tiam1 to this process. First, we analyzed the expression of Tiam1
mRNA in mouse ventral midbrain (VM) at different embryonic
(E) stages, from E10.5 to E15.5, by qPCR. We found that the expression
of Tiam1 mRNA progressively increased during embryonic
development, reaching maximal levels at E15.5 (Fig. 7A).
Moreover, when we examined the levels of Tiam1 protein in the
developing VM, we found that Tiam1 is present as early as at E10.5
(Fig. 7B). These results indicated a possible function of Tiam1 in
midbrain development, at the indicated developmental stages.
We therefore tested whether Tiam1 mRNA interference impaired
the generation of midbrain DA neurons in midbrain neural
stem/progenitor cells expanded as neurospheres in the presence of
Shh, basic FGF, and FGF8 for 7 days (12). Primary neurospheres
were gently dissociated to smaller cell clusters, transfected with
either control siRNA or Tiam1 siRNA, and differentiated for 3
days. Transfection of differentiated progenitor cultures with
Tiam1 siRNA reduced the expression of Tiam1 mRNA by 50%
(Fig. 7D) at day 3 of differentiation. Tiam1 gene knockdown led to
significant decreases in the mRNA expression of beta III tubulin
(Tuj), a neuronal marker, and tyrosine hydroxylase (TH), the
rate-limiting enzyme in dopamine synthesis and marker of DA
neurons (Fig. 7D). Similarly, Rac1 siRNA, which efficiency reduced
Rac1 mRNA levels in SN4741 DA cells by 50 to 75% (data
not shown), caused a decrease in the expression of TH mRNA
(and Rac1 mRNA) in VM neurospheres differentiated for 3 days
(Fig. 7C). Interestingly, Tiam1 gene knockdown also decreased
the mRNA expression of Pitx3 (paired-like homeodomain transcription
factor 3), a specific marker of VM DA neurons, but did
not affect the expression of Nurr1, a transcription factor expressed
both in DA neurons and postmitotic neuroblasts (Fig. 7D). These
results suggested a role of Tiam1 in the last stages of differentiation,
in the acquisition of two DA neuron markers, Pitx3 and TH,
by Nurr1ϩ
neuroblasts. Indeed, immunocytochemical analysis of
differentiated ventral midbrain neurospheres showed that Tiam1
gene knockdown reduced by 50% the number of THϩ
DA neurons
in Tujϩ
clusters normalized by area (Fig. 7E and F). These
results indicated that Tiam1 is required for the generation of midbrain
DA neurons from neural stem/progenitor cell preparations.
Finally, since our biochemical data identified Tiam1 as a downstream
component of Wnt5a-mediated signaling, we examined
whether Tiam1 knockdown can also block the Wnt5a-induced
DA differentiation in neurosphere cultures. In our experiments,
Wnt5a treatment (100 ng/ml) increased the number of THϩ
DA
neurons per area by 58%, from 59.2 Ϯ 3.8 THϩ
cells/mm2
to
93.6 Ϯ 8.3 THϩ
cells/mm2
(Fig. 7G and H). These effects were
efficiently ablated by lentiviral delivery of Tiam1 shRNA (61.9 Ϯ
6.5 THϩ
cells/mm2
). In sum, our data suggest that Rac1 and its
upstream regulator Tiam1 are involved in the differentiation of
midbrain DA neurons and that Tiam1 works downstream of
Wnt5a in DA differentiation.
DISCUSSION
In this study, we investigated the mechanisms of activation of the
small GTPase, Rac1, in the context of Wnt signaling in DA cells
and found that the Rac1 GEF Tiam1 regulates the Wnt/Dvl/Rac1
signaling pathway and the differentiation of midbrain dopaminergic
(DA) neurons. We previously reported that Wnt5a promotes
the differentiation of DA neurons via a Wnt/␤-cateninindependent
pathway (6, 8, 9) that involves Rac1 (31). The
activation of Rac1 by Wnt/␤-catenin-independent signaling has
been reported in various cellular systems (4), and Rac1 has been
found to play a role in cytoskeleton rearrangements, cell polarity,
and cell migration (13, 41), as well as in neuronal development
and differentiation (42–44). Surprisingly, however, little is known
about upstream mechanisms involved in the regulation of small
GTPases in the context of the Wnt/␤-catenin independent signaling.
Previous studies have shown that Dvl is both required and
sufficient for the activation of Rac1 (15, 31, 45). Our results further
suggest that the activation of Rac1 by Dvl requires the formation
of protein complexes containing Dvl and Rac1, as Dvl mutants
lacking the ability to interact with Rac1 also fail to induce
Rac1 activation. We identified the N-terminal region of Dvl3 (1 to
81 amino acids) as critical for mediating the Dvl3-Rac1 interaction
and the activation of Rac1 by Dvl3. Our results differ from the
study by Habas and colleagues (15), who reported that the DEP
domain of Dvl2 is sufficient to bind and activate Rac1 and failed to
detect activation of Rac1 by Dvl3. In our study, we found that both
Dvl2 and Dvl3 are sufficient to induce Rac1 activation and that the
DEP domain of Dvl3 is not sufficient for Rac1 interaction. It is
possible that methodological and cell-type-specific factors account
for the discrepancy. However, data in the literature indirectly
support an interaction of Rac1 with the N-terminal part of
Dvl, as the N-terminal part of Dvl1 is sufficient for association
with PAK, a direct effector and binding partner of Rac1 (46).
Evidence for the employment of specific GEFs in Wnt/␤catenin-independent
signaling has only recently begun to emerge.
WGEF, p114-RhoGEF, and GEF-H1 have been proposed as GEFs
for RhoA (47, 48). However, GEFs involved in the Wnt5a/Dvlmediated
activation of Rac1 have not been described until now.
Our data show first evidence for the involvement of a specific Rac1
FIG 7 Tiam1 is expressed in the developing VM and is required for Wnt5a-induced DA neuron differentiation. (A) qPCR analysis showed that Tiam1 mRNA
is expressed between E10.5 and E15.5 in mouse ventral midbrain (VM). *, P Ͻ 0.05 by Mann-Whitney test (compared to E10.5). (B) Western blot analyses
confirmed the presence of Tiam1 protein in both ventral midbrain and dorsal midbrain (DM) samples at E10.5. The floor plate marker Foxa2 was used to confirm
the identity of the VM sample. (C) Rac1 siRNA of Rac1 and TH mRNA in differentiating ventral midbrain precursors, 3 days after transfection. (D) Tiam1 siRNA
decreased the expression of Tiam1 mRNA, as well as Tuj, Th, and Pitx3 mRNAs but not Nurr1 mRNA in differentiating ventral midbrain precursors 3 days after
transfection. These results suggested an effect of Tiam1 in DA differentiation, similar to that of Wnt5a. (E) Immunostaining of control or Tiam1 siRNA VM
neurospheres showed similar numbers of Tuj1ϩ
cells (green) but lower numbers of THϩ
dopamine neurons (red) after 3 days of differentiation. (F) Quantification
of the number of THϩ
cells per area of Tujϩ
neurospheres revealed that Tiam1 siRNA significantly reduced the number of dopamine neurons. (G)
Treatment with Wnt5a (100 ng/ml, 3 days) increased the number of THϩ
neurons in neurosphere cultures treated with control shRNA lentiviruses but not in
Tiam1 shRNA lentiviruses. DAPI was used for nuclei counterstaining. (H) Quantification of the number of THϩ
cells per area (mm2
) of sphere, summary of 4
independent experiments. *, P Ͻ 0.05; **, P Ͻ 0.01; ***, P Ͻ 0.001 by Student t test or one-way analysis of variance (ANOVA) (Fig. 7H).
Tiam1 Regulates Noncanonical Wnt Signaling
January 2013 Volume 33 Number 1 mcb.asm.org 67
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
GEF, Tiam1, in the noncanonical Wnt/Dvl/Rac1 pathway. This
conclusion is based on the following lines of evidence. First, we
found that Tiam1 interacts with Dvl and enhances the Dvl-Rac1
interaction. Second, we showed that the Dvl-Tiam1 interaction is
regulated by CK1. Third, siRNA knockdown experiments demonstrated
that Tiam1 is functionally required for the activation of
Rac1 by Wnt5a or Dvl. These findings are in full agreement with
the known negative role of CK1 in Wnt/Dvl/Rac1 signaling and
provide a possible molecular mechanism by which CK1 regulates
DA differentiation, namely by regulating both the interaction between
Dvl and Tiam1 and the activation of Rac1. We previously
reported that inhibition of CK1 or overexpression of dominant
negative CK1ε increases the level of Rac1-GTP, in a Dvl-dependent
manner, while overexpression of CK1 blocks the activation of
Rac1 mediated by Dvl (31). Here, we show that inhibition of CK1
facilitates, whereas CK1 overexpression blocks, the interaction between
Dvl and Tiam1. Moreover, we could detect CK1 present in
Tiam1 immunoprecipitates. Interestingly, a recent proteomic
study also found CK1 as a Tiam1-associated protein (49). Combined,
our results suggest that CK1 controls changes in proteinprotein
interactions between Dvl and Tiam1, which result in the
activation of Rac1 by Tiam1. Surprisingly, however, we were unable
to detect the interaction between Tiam1 and Rac1. One possible
explanation for this is the instability of the trimeric complex
formed by Tiam1-Rac1-GTP (50). Evidence in the literature supports
the view that the activity of small GTPases is regulated by
protein-protein interactions between GEFs and scaffolding proteins
(37, 38, 51). This possibility is in agreement with our observation
of a Dvl-Tiam1 interaction and a negative effect of CK1 on
Dvl-Tiam1 binding and Wnt/Dvl/Rac1 signaling. We thus propose
a model where CK1 activity determines the amount of Tiam1
associated with the scaffolding protein Dvl, which is hence available
to bind and activate Dvl-bound Rac1. In this model, the Wntinduced
activation of CK1 (9, 52) may thus represent a negative
feedback mechanism to fine-tune the level of Rac1-GTP.
Future experiments should aim at addressing whether the activation
of Rac1 by Wnt5a/Dvl is exclusively controlled by Tiam1
or is redundantly controlled by other GEFs. Another pending issue
is the identity of the signaling component(s) downstream of
the Wnt5a/Dvl/Rac1 pathway. It has been previously shown that
cJun acts downstream of Tiam1/Rac1 (53), opening the intriguing
possibility that the Wnt5a/Dvl/Rac1 pathway directly regulates
transcription via cJun. However, we found that Wnt5a did not
activate a cJun-luciferase reporter in DA cells (data not shown).
Thus, our results suggest that (i) cJun may not be downstream of
Rac1 in the context of Wnt5a-mediated signaling and that (ii) an
alternative factor(s) mediates the Wnt5a/Dvl/Rac1 pathway in DA
neurons.
At a functional level, Tiam1 has been previously shown to regulate
neurite and axon outgrowth in neuroblastoma cells (54, 55)
as well as in hippocampal neurons (56), migration of cortical neurons
(57), and the formation of dendritic spines (26). Previous
studies have also shown that the attenuation of Tiam1 and/or
Rac1 activity impairs cytoskeleton remodeling and leads to loss of
cell polarity, which in context of neuronal differentiation can be
reflected by impaired neurogenic cell division, migration, and/or
neuritogenesis (43, 58–60). Moreover, Wnt5a/Dvl-mediated signaling
events have been implicated in the regulation of polarity in
differentiating neurons (4, 6, 61). Thus, it is plausible that cell
polarity underlies the requirement of Wnt5a/Dvl/Rac1 signaling
for neuronal differentiation. Importantly, the role of Tiam1 in the
ventral midbrain (VM) and its possible implication in the differentiation/development
of DA neurons has not been addressed
before. Here, we show that Tiam1 is expressed in the VM at the
time when DA neurons are born. Moreover, we found that Tiam1
knockdown impairs the generation of DA neurons in VM progenitor
cultures. Thus, it is plausible to expect that Tiam1 regulates a
signaling pathway(s) relevant to DA development and differentiation
(62). Interestingly, Wnt5a and Rac1 activation had previously
been shown to promote the differentiation of Nurr1ϩ
THϪ
postmitotic neuroblasts into Nurr1ϩ
THϩ
Pitx3ϩ
DA neurons (6,
10). In this regard, our biochemical and functional data suggest
that Tiam1 mediates Wnt5a-induced DA neuron differentiation.
Furthermore, our results indicating that Tiam1 knockdown decreases
TH, Pitx3, and Tuj mRNA levels but does not affect the
expression of Nurr1 are fully in agreement with the idea that
Wnt5a promotes the transition of Nurr1ϩ
DA neuroblasts into
mature DA neurons. Thus, combined, our results suggest that
Tiam1 plays a role in the differentiation of Nurr1ϩ
DA precursors
and is a key modulator of the Wnt/Dvl/Rac1 pathway.
In summary, we hereby show that Rac1 interacts with its upstream
regulator Dvl. We identified Tiam1, a Rac1-specific GEF,
as a binding partner of Dvl and a critical regulator of Rac1 activation
in the context of the Wnt5a/Dvl/Rac1 pathway. Finally, we
provide functional evidence that Tiam1 is required for the Wnt5amediated
generation of DA neurons in ventral midbrain progenitor
cultures. Hence, our data highlight the important role of the
Wnt5a/Dvl/Rac1 signaling pathway in DA neuron differentiation
and pinpoint Tiam1, the first Rac1 GEF identified in noncanonical
Wnt signaling.
ACKNOWLEDGMENTS
We thank R. J. Lefkowitz (HHMI, Duke University, Durham, NC) for
Dvl2-EGFP, S. Yanagawa (Kyoto University) for Dvl2-MYC, R. T. Moon
(HHMI, University of Washington, Seattle, WA) for Dvl3 constructs,
Alan Hall (Memorial Sloan-Kettering Cancer Center, New York, NY) for
Rac1-MYC, M. Bienz (LMB, MRC, Cambridge, United Kingdom) for Dvl
DIX mutants (M1 to M4), Pontus Aspenström (KI, Stockholm, Germany)
for GST-PAK CRIB, K. Tolias (Baylor College of Medicine, Houston, TX)
for Tiam1-FLAG constructs, and Ondrˇej Slabý for U78MG and T98G
cells. We acknowledge Johnny Söderlund, Nad’a Bílá, Jakub Harnoš, and
Alessandra Nanni for excellent assistance.
This work was supported by grants from the European Union (Neurostemcell),
Swedish Foundation for Strategic Research (SRL Program
and CEDB project), Swedish Research Council (VR2008:2811, VR2011:
3116, and DBRM), Norwegian Research Council, and Karolinska Institute
to E.A., as well as grants from the Ministry of Education, Youth, and
Sports of the Czech Republic (MSM0021622430, CZ.1.07/2.3.00/
20.0180), EMBO Installation Grant, and Czech Science Foundation (204/
09/0498; 204/09/H058) to V.B. L.C. was supported by a KID Ph.D. student
fellowship (6110/06-225) from Karolinska Institute. S.T. was supported
by a VR fellowship for visiting scientists and short-term fellowship from
the Onassis Foundation.
We declare no competing interests.
REFERENCES
1. Angers S, Moon RT. 2009. Proximal events in Wnt signal transduction.
Nat. Rev. Mol. Cell Biol. 10:468–477.
2. MacDonald BT, Tamai K, He X. 2009. Wnt/beta-catenin signaling:
components, mechanisms, and diseases. Dev. Cell 17:9–26.
3. Lai SL, Chien AJ, Moon RT. 2009. Wnt/Fz signaling and the cytoskeleton:
potential roles in tumorigenesis. Cell Res. 19:532–545.
Cˇajánek et al.
68 mcb.asm.org Molecular and Cellular Biology
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
4. Schlessinger K, Hall A, Tolwinski N. 2009. Wnt signaling pathways meet
Rho GTPases. Genes Dev. 23:265–277.
5. Montcouquiol M, Crenshaw EB, III, Kelley MW. 2006. Noncanonical
Wnt signaling and neural polarity. Annu. Rev. Neurosci. 29:363–386.
6. Andersson ER, Prakash N, Cajanek L, Minina E, Bryja V, Bryjova L,
Yamaguchi TP, Hall AC, Wurst W, Arenas E. 2008. Wnt5a regulates
ventral midbrain morphogenesis and the development of A9-A10 dopaminergic
cells in vivo. PLoS One 3:e3517. doi:10.1371/journal.pone.
0003517.
7. Inestrosa NC, Arenas E. 2010. Emerging roles of Wnts in the adult
nervous system. Nat. Rev. Neurosci. 11:77–86.
8. Schulte G, Bryja V, Rawal N, Castelo-Branco G, Sousa KM, Arenas E.
2005. Purified Wnt-5a increases differentiation of midbrain dopaminergic
cells and dishevelled phosphorylation. J. Neurochem. 92:1550–1553.
9. Bryja V, Schulte G, Rawal N, Grahn A, Arenas E. 2007. Wnt-5a induces
Dishevelled phosphorylation and dopaminergic differentiation via a CK1dependent
mechanism. J. Cell Sci. 120:586–595.
10. Castelo-Branco G, Wagner J, Rodriguez FJ, Kele J, Sousa K, Rawal N,
Pasolli HA, Fuchs E, Kitajewski J, Arenas E. 2003. Differential regulation
of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a, and
Wnt-5a. Proc. Natl. Acad. Sci. U. S. A. 100:12747–12752.
11. Hayashi H, Morizane A, Koyanagi M, Ono Y, Sasai Y, Hashimoto N,
Takahashi J. 2008. Meningeal cells induce dopaminergic neurons from
embryonic stem cells. Eur. J. Neurosci. 27:261–268.
12. Parish CL, Castelo-Branco G, Rawal N, Tonnesen J, Sorensen AT, Salto
C, Kokaia M, Lindvall O, Arenas E. 2008. Wnt5a-treated midbrain
neural stem cells improve dopamine cell replacement therapy in parkinsonian
mice. J. Clin. Invest. 118:149–160.
13. Jaffe AB, Hall A. 2005. Rho GTPases: biochemistry and biology. Annu.
Rev. Cell Dev. Biol. 21:247–269.
14. Rossman KL, Der CJ, Sondek J. 2005. GEF means go: turning on RHO
GTPases with guanine nucleotide-exchange factors. Nat. Rev. Mol. Cell
Biol. 6:167–180.
15. Habas R, Dawid IB, He X. 2003. Coactivation of Rac and Rho by Wnt/
Frizzled signaling is required for vertebrate gastrulation. Genes Dev. 17:
295–309.
16. Rosso SB, Sussman D, Wynshaw-Boris A, Salinas PC. 2005. Wnt signaling
through Dishevelled, Rac and JNK regulates dendritic development.
Nat. Neurosci. 8:34–42.
17. Gao C, Chen YG. 2010. Dishevelled: the hub of Wnt signaling. Cell Signal.
22:717–727.
18. Wallingford JB, Habas R. 2005. The developmental biology of Dishevelled:
an enigmatic protein governing cell fate and cell polarity. Development
132:4421–4436.
19. Cong F, Schweizer L, Varmus H. 2004. Casein kinase Iepsilon modulates
the signaling specificities of Dishevelled. Mol. Cell. Biol. 24:2000–2011.
20. Habets GG, Scholtes EH, Zuydgeest D, van der Kammen RA, Stam JC,
Berns A, Collard JG. 1994. Identification of an invasion-inducing gene,
Tiam-1, that encodes a protein with homology to GDP-GTP exchangers
for Rho-like proteins. Cell 77:537–549.
21. Bryja V, Cajanek L, Grahn A, Schulte G. 2007. Inhibition of endocytosis
blocks Wnt signalling to beta-catenin by promoting Dishevelled degradation.
Acta Physiol. (Oxf.) 190:55–61.
22. Lee JS, Ishimoto A, Yanagawa S. 1999. Characterization of mouse Dishevelled
(Dvl) proteins in Wnt/Wingless signaling pathway. J. Biol.
Chem. 274:21464–21470.
23. Angers S, Thorpe CJ, Biechele TL, Goldenberg SJ, Zheng N, Maccoss
MJ, Moon RT. 2006. The KLHL12-Cullin-3 ubiquitin ligase negatively
regulates the Wnt-beta-catenin pathway by targeting Dishevelled for degradation.
Nat. Cell Biol. 8:348–357.
24. Chen W, ten Berge D, Brown J, Ahn S, Hu LA, Miller WE, Caron MG,
Barak LS, Nusse R, Lefkowitz RJ. 2003. Dishevelled 2 recruits betaarrestin
2 to mediate Wnt5A-stimulated endocytosis of Frizzled 4. Science
301:1391–1394.
25. Schwarz-Romond T, Fiedler M, Shibata N, Butler PJ, Kikuchi A, Higuchi
Y, Bienz M. 2007. The DIX domain of Dishevelled confers Wnt
signaling by dynamic polymerization. Nat. Struct. Mol. Biol. 14:484–492.
26. Tolias KF, Bikoff JB, Burette A, Paradis S, Harrar D, Tavazoie S,
Weinberg RJ, Greenberg ME. 2005. The Rac1-GEF Tiam1 couples the
NMDA receptor to the activity-dependent development of dendritic arbors
and spines. Neuron 45:525–538.
27. Ridley AJ, Paterson HF, Johnston CL, Diekmann D, Hall A. 1992. The
small GTP-binding protein Rac regulates growth factor-induced membrane
ruffling. Cell 70:401–410.
28. Badura L, Swanson T, Adamowicz W, Adams J, Cianfrogna J, Fisher K,
Holland J, Kleiman R, Nelson F, Reynolds L, St Germain K, Schaeffer
E, Tate B, Sprouse J. 2007. An inhibitor of casein kinase I epsilon induces
phase delays in circadian rhythms under free-running and entrained conditions.
J. Pharmacol. Exp. Ther. 322:730–738.
29. Rena G, Bain J, Elliott M, Cohen P. 2004. D4476, a cell-permeant
inhibitor of CK1, suppresses the site-specific phosphorylation and nuclear
exclusion of FOXO1a. EMBO Rep. 5:60–65.
30. Cajanek L, Ribeiro D, Liste I, Parish CL, Bryja V, Arenas E. 2009.
Wnt/beta-catenin signaling blockade promotes neuronal induction and
dopaminergic differentiation in embryonic stem cells. Stem Cells 27:
2917–2927.
31. Bryja V, Schambony A, Cajanek L, Dominguez I, Arenas E, Schulte G.
2008. Beta-arrestin and casein kinase 1/2 define distinct branches of noncanonical
WNT signalling pathways. EMBO Rep. 9:1244–1250.
32. Parish CL, Parisi S, Persico MG, Arenas E, Minchiotti G. 2005. Cripto
as a target for improving embryonic stem cell-based therapy in Parkinson’s
disease. Stem Cells 23:471–476.
33. Dull T, Zufferey R, Kelly M, Mandel RJ, Nquyen M, Trono D, Naldini
L. 1998. A third-generation lentivirus vector with a conditional packaging
system. J. Virol. 72:8463–8471.
34. Yokoyama N, Golebiewska U, Wang HY, Malbon CC. 2010. Wntdependent
assembly of supermolecular Dishevelled-3-based complexes. J.
Cell Sci. 123:3693–3702.
35. Schwarz-Romond T, Merrifield C, Nichols BJ, Bienz M. 2005. The Wnt
signalling effector Dishevelled forms dynamic protein assemblies rather
than stable associations with cytoplasmic vesicles. J. Cell Sci. 118:5269–
5277.
36. Smalley MJ, Signoret N, Robertson D, Tilley A, Hann A, Ewan K, Ding
Y, Paterson H, Dale TC. 2005. Dishevelled (Dvl-2) activates canonical
Wnt signalling in the absence of cytoplasmic puncta. J. Cell Sci. 118:5279–
5289.
37. Garcia-Mata R, Burridge K. 2007. Catching a GEF by its tail. Trends Cell
Biol. 17:36–43.
38. Marinissen MJ, Gutkind JS. 2005. Scaffold proteins dictate Rho GTPasesignaling
specificity. Trends Biochem. Sci. 30:423–426.
39. Bernatik O, Ganji R, Dijksterhuis J, Konik P, Cervenka I, Polonio T,
Krejci P, Schulte G, Bryja V. 2011. Sequential activation and inactivation
of Dishevelled in the Wnt/beta-catenin pathway by casein kinases. J. Biol.
Chem. 286:10396–10410.
40. Klein TJ, Jenny A, Djiane A, Mlodzik M. 2006. CKIepsilon/discs overgrown
promotes both Wnt-Fz/beta-catenin and Fz/PCP signaling in Drosophila.
Curr. Biol. 16:1337–1343.
41. Etienne-Manneville S, Hall A. 2002. Rho GTPases in cell biology. Nature
420:629–635.
42. de Curtis I. 2008. Functions of Rac GTPases during neuronal development.
Dev. Neurosci. 30:47–58.
43. Govek EE, Newey SE, Van Aelst L. 2005. The role of the Rho GTPases in
neuronal development. Genes Dev. 19:1–49.
44. Tahirovic S, Hellal F, Neukirchen D, Hindges R, Garvalov BK, Flynn
KC, Stradal TE, Chrostek-Grashoff A, Brakebusch C, Bradke F. 2010.
Rac1 regulates neuronal polarization through the WAVE complex. J. Neurosci.
30:6930–6943.
45. Ishida-Takagishi M, Enomoto A, Asai N, Ushida K, Watanabe T,
Hashimoto T, Kato T, Weng L, Matsumoto S, Asai M, Murakumo Y,
Kikuchi A, Takahashi M. 2012. The Dishevelled-associated protein Daple
controls the noncanonical Wnt/Rac pathway and cell motility. Nat. Commun.
3:89.
46. Luo ZG, Wang Q, Zhou JZ, Wang J, Luo Z, Liu M, He X, WynshawBoris
A, Xiong WC, Lu B, Mei L. 2002. Regulation of AChR clustering by
Dishevelled interacting with MuSK and PAK1. Neuron 35:489–505.
47. Tanegashima K, Zhao H, Dawid IB. 2008. WGEF activates Rho in the
Wnt-PCP pathway and controls convergent extension in Xenopus gastrulation.
EMBO J. 27:606–617.
48. Tsuji T, Ohta Y, Kanno Y, Hirose K, Ohashi K, Mizuno K. 2010.
Involvement of p114-RhoGEF and Lfc in Wnt-3a- and Dishevelledinduced
RhoA activation and neurite retraction in N1E-115 mouse neuroblastoma
cells. Mol. Biol. Cell 21:3590–3600.
49. Woodcock SA, Jones RC, Edmondson RD, Malliri A. 2009. A modified
tandem affinity purification technique identifies that 14-3-3 proteins inTiam1
Regulates Noncanonical Wnt Signaling
January 2013 Volume 33 Number 1 mcb.asm.org 69
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
teract with Tiam1, an interaction which controls Tiam1 stability. J. Proteome
Res. 8:5629–5641.
50. Worthylake DK, Rossman KL, Sondek J. 2000. Crystal structure of Rac1
in complex with the guanine nucleotide exchange region of Tiam1. Nature
408:682–688.
51. Buchsbaum RJ, Connolly BA, Feig LA. 2003. Regulation of p70 S6 kinase
by complex formation between the Rac guanine nucleotide exchange factor
(Rac-GEF) Tiam1 and the scaffold spinophilin. J. Biol. Chem. 278:
18833–18841.
52. Swiatek W, Tsai IC, Klimowski L, Pepler A, Barnette J, Yost HJ,
Virshup DM. 2004. Regulation of casein kinase I epsilon activity by Wnt
signaling. J. Biol. Chem. 279:13011–13017.
53. Fanto M, Weber U, Strutt DI, Mlodzik M. 2000. Nuclear signaling by
Rac and Rho GTPases is required in the establishment of epithelial planar
polarity in the Drosophila eye. Curr. Biol. 10:979–988.
54. Leeuwen FN, Kain HE, Kammen RA, Michiels F, Kranenburg OW,
Collard JG. 1997. The guanine nucleotide exchange factor Tiam1 affects
neuronal morphology; opposing roles for the small GTPases Rac and Rho.
J. Cell Biol. 139:797–807.
55. Tanaka M, Ohashi R, Nakamura R, Shinmura K, Kamo T, Sakai R,
Sugimura H. 2004. Tiam1 mediates neurite outgrowth induced by ephrin-B1
and EphA2. EMBO J. 23:1075–1088.
56. Kunda P, Paglini G, Quiroga S, Kosik K, Caceres A. 2001. Evidence for
the involvement of Tiam1 in axon formation. J. Neurosci. 21:2361–2372.
57. Kawauchi T, Chihama K, Nabeshima Y, Hoshino M. 2003. The in vivo
roles of STEF/Tiam1, Rac1 and JNK in cortical neuronal migration.
EMBO J. 22:4190–4201.
58. Mertens AE, Pegtel DM, Collard JG. 2006. Tiam1 takes PARt in cell
polarity. Trends Cell Biol. 16:308–316.
59. Minobe S, Sakakibara A, Ohdachi T, Kanda R, Kimura M, Nakatani S,
Tadokoro R, Ochiai W, Nishizawa Y, Mizoguchi A, Kawauchi T, Miyata
T. 2009. Rac is involved in the interkinetic nuclear migration of cortical
progenitor cells. Neurosci. Res. 63:294–301.
60. Schlessinger K, McManus EJ, Hall A. 2007. Cdc42 and noncanonical
Wnt signal transduction pathways cooperate to promote cell polarity. J.
Cell Biol. 178:355–361.
61. Zhang X, Zhu J, Yang GY, Wang QJ, Qian L, Chen YM, Chen F, Tao
Y, Hu HS, Wang T, Luo ZG. 2007. Dishevelled promotes axon
differentiation by regulating atypical protein kinase C. Nat. Cell Biol.
9:743–754.
62. Sasaki N, Kurisu J, Kengaku M. 2010. Sonic hedgehog signaling regulates
actin cytoskeleton via Tiam1-Rac1 cascade during spine formation. Mol.
Cell. Neurosci. 45:335–344.
Cˇajánek et al.
70 mcb.asm.org Molecular and Cellular Biology
onDecember11,2012byguesthttp://mcb.asm.org/Downloadedfrom
Vítězslav Bryja, 2014    Attachments 
 
 
#15 
 
 
A. Soldano, Z. Okray, P. Janovská, K. Tmejová, E. Reynaud, A. Claeys, J. Yan, B. De 
Strooper, J.‐M. Dura, V. Bryja, B. A. Hassan (2013): The Amyloid Precursor Proteins are 
conserved modulators of the Wnt/PCP pathway required for robustness of axonal 
outgrowth. PLoS Biol. 11(5):e1001562.  
 
 
Impact factor (2012): 12.690 
Times cited (without autocitations, WoS, Feb 21st 2014):  0 
Significance: This paper for the first identifies endogenous role of the family of amyloid 
precursor proteins (APP). APP and APP‐like proteins are well characterized in the 
pathogenesis  of  Alzheimer  disease,  where  they  significantly  contribute  to  the 
formation of amyloid plaques. Here we showed that proteins from APP family are 
regulators  of  non‐canonical  Wnt  pathway  and  are  required  for  proper  signal 
transduction between the Wnt ligand and Dishevelled. 
Contibution of the author/author´s team: Biochemical and functional analysis of the 
role of APP/APLP2 in the mammalian model system. 
 
 
   
 
 
 
The Drosophila Homologue of the Amyloid Precursor
Protein Is a Conserved Modulator of Wnt PCP Signaling
Alessia Soldano1,2,3
, Zeynep Okray1,2,3
, Pavlina Janovska4
, Katerˇina Tmejova´4
, Elodie Reynaud5,6
,
Annelies Claeys1,2
, Jiekun Yan1,2
, Zeynep Kalender Atak2
, Bart De Strooper1,2,3
, Jean-Maurice Dura5,6
,
Vı´teˇzslav Bryja4,7
, Bassem A. Hassan1,2,3
*
1 VIB Center for the Biology of Disease, Leuven, Belgium, 2 Center for Human Genetics, University of Leuven School of Medicine, Leuven, Belgium, 3 Doctoral Program in
Molecular and Developmental Genetics, University of Leuven Group Biomedicine, Leuven, Belgium, 4 Institute of Experimental Biology, Faculty of Science, Masaryk
University, Brno, Czech Republic, 5 Institut de Ge´ne´tique Humaine/Centre National de la Recherche Scientifique UPR1142, Montpellier, France, 6 Laboratoire
Neuroge´ne´tique et Me´moire, De´partement Ge´ne´tique et De´veloppement, Montpellier, France, 7 Institute of Biophysics of the Academy of Sciences of the Czech Republic,
Brno, Czech Republic
Abstract
Wnt Planar Cell Polarity (PCP) signaling is a universal regulator of polarity in epithelial cells, but it regulates axon outgrowth
in neurons, suggesting the existence of axonal modulators of Wnt-PCP activity. The Amyloid precursor proteins (APPs) are
intensely investigated because of their link to Alzheimer’s disease (AD). APP’s in vivo function in the brain and the
mechanisms underlying it remain unclear and controversial. Drosophila possesses a single APP homologue called APP Like,
or APPL. APPL is expressed in all neurons throughout development, but has no established function in neuronal
development. We therefore investigated the role of Drosophila APPL during brain development. We find that APPL is
involved in the development of the Mushroom Body ab neurons and, in particular, is required cell-autonomously for the baxons
and non-cell autonomously for the a-axons growth. Moreover, we find that APPL is a modulator of the Wnt-PCP
pathway required for axonal outgrowth, but not cell polarity. Molecularly, both human APP and fly APPL form complexes
with PCP receptors, thus suggesting that APPs are part of the membrane protein complex upstream of PCP signaling.
Moreover, we show that APPL regulates PCP pathway activation by modulating the phosphorylation of the Wnt adaptor
protein Dishevelled (Dsh) by Abelson kinase (Abl). Taken together our data suggest that APPL is the first example of a
modulator of the Wnt-PCP pathway specifically required for axon outgrowth.
Citation: Soldano A, Okray Z, Janovska P, Tmejova´ K, Reynaud E, et al. (2013) The Drosophila Homologue of the Amyloid Precursor Protein Is a Conserved
Modulator of Wnt PCP Signaling. PLoS Biol 11(5): e1001562. doi:10.1371/journal.pbio.1001562
Academic Editor: Konrad Basler, University of Zurich, Switzerland
Received December 17, 2012; Accepted April 2, 2013; Published May 14, 2013
Copyright: ß 2013 Soldano et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by VIB (BAH and BDS), Concerted Research Action (GOA) and Methusalem grants from the KU Leuven (BDS and BAH), Fonds
Wetenschappelijke Oderzoeks (FWO) grants G.0543.08, G.0680.10, G.0681.10, and G.0503.12 (BAH), grant ANR-07-NEURO-034 from the Agence Nationale pour la
Recherche (JMD) and the Czech Science Foundation (grants 204/09/0498, 301/11/0747), Ministry of Education, Youth and Sports of the Czech Republic (grant
MSM0021622430), Academy of Sciences of the Czech Republic (AVOZ50040507, AVOZ50040702), and an EMBO Installation Grant (VB). The funders had no role in
study design, data collection and analysis, decision to publish, or preparation of the manuscript
Competing Interests: The authors have declared that no competing interests exist.
Abbreviations: Abl, Abelson kinase; AD, Alzheimer’s disease; APP, Amyloid precursor protein; APP-C99, C-terminus of human APP; APPL, APP Like; ApplDC, APPL
delta C-terminal domain; dKO, double knock-out; Dsh, Drosophila Dishevelled; Dvl, mammalian Dishevelled; Dvl2, Dishevelled2; FasII, FascilinII; Fmi, Flamingo; Fz,
Frizzled; Fzd5, Frizzled 5; MB, Mushroom Bodies; MEF, mouse embryonic fibroblast; PCP, Wnt Planar Cell Polarity; sAPPL, soluble APPL; Vangl2, Van Gogh2; Vang/
Stbm, Van Gogh/Strabismus.
* E-mail: Bassem.Hassan@cme.vib-kuleuven.be
Introduction
The Wnt Planar Cell Polarity (PCP) pathway is a highly
conserved regulator of cellular orientation within the plane of an
epithelium [1,2]. Genetic and molecular studies in Drosophila
indicate Disheveled (Dsh), a cytoplasmic transducer of Wnt
signaling; Frizzled (Fz), a seven-transmembrane receptor for Wnt
ligands; and Van Gogh (Vang), a four-pass transmembrane
protein, as core Wnt-PCP proteins. Intriguingly, the Wnt-PCP
pathway regulates axon outgrowth rather than neuronal polarity
during brain development of both vertebrates and Drosophila [3–5].
The Amyloid Precursor Protein (APP) is a member of a highly
conserved family of type I transmembrane proteins that includes
APP, APLP1, and APLP2 [6] in mammals and APP-Like, or
APPL, in Drosophila melanogaster [7]. APP proteins show not only
structural but also functional conservation, as exemplified by the
ability of human APP to rescue behavioral phenotypes of APPL
null flies [8]. APP is the subject of intense research because of
genetic and biochemical links to Alzheimer’s disease (AD),
whereby the proteolytic processing of APP generates the Amyloid
Beta peptide whose accumulation in the brain is widely thought to
induce neurodegeneration [9–12]. Despite these efforts, the
normal physiological function of APP in vivo in the nervous
system remains elusive and highly controversial. This is due to the
lack of a consensus over the neuronal phenotypes in null mutant
animals and the mechanism of APP action in vivo. APP knock-out
mice are viable and show developmental neuronal deficits, namely
cortical migration and agenesis of the corpus callosum, at variable
penetrance depending on genetic background [13–15]. In
contrast, another in vivo report, based mainly on gain of function
PLOS Biology | www.plosbiology.org 1 May 2013 | Volume 11 | Issue 5 | e1001562
and RNA interference experiments, suggests that APP may be
required for developmental axonal degeneration [16], although it
is unclear whether APP knock-out mice show these phenotypes.
Finally, initial findings proposed an axonal transport function for
APP [17] but later studies strongly questioned the presence of
these defects in APP knock-out mice [18].
Mechanistically, there is also disagreement on whether APP acts
cell autonomously or non autonomously. For example, an
extensive network of molecular interactions has been described
for the intracellular domain of APP [19], yet a knock-in of APP
lacking the intracellular domain appears to rescue physiological
and learning deficits reported in APP knock-out mice, suggesting
that the intracellular domain is dispensable [20]. Because current
models based on Amyloid toxicity do not provide a complete
explanation for the onset of neuronal dysfunction in AD, it has
long been argued that greater attention needs to shift towards
understanding the normal physiological function of APP in order
to assess its potential contribution to AD pathology [21,22].
Therefore, a mechanistic understanding of the in vivo physiological
function of APP proteins is of paramount importance. To
elucidate the function and mechanism of action of APP proteins in
vivo, we first investigated Drosophila APPL, the APP homologue in
the fruit fly, as a model system. We show that APPL is a novel
neuronal-specific modulator of the PCP pathway required for the
robustness of axonal outgrowth during the development of the
Mushroom Bodies (MB), a Drosophila center for learning and
memory. APPL carries out this function through facilitating the
PCP-specific phosphorylation of the Wnt adaptor protein Dishevelled
(Dsh/Dvl) by the Abelson kinase (Abl). Furthermore, we
show that APPL is part of the membrane complex formed by WntPCP
core proteins. Finally, biochemical and cell biological
analyses show that human APP immunoprecipitates mammalian
PCP proteins and that APP proteins are necessary for Dvl
phosphorylation in response to the PCP ligand Wnt5a. Therefore,
the APP proteins represent a novel and conserved family of
neuronal modulators of Wnt-PCP signaling required for the
robustness of brain wiring during development.
Results
APPL Is a Robustness Factor Required Cell-Autonomously
for MB b-Lobe Development
Drosophila APPL is a neuronal-specific protein expressed in most,
if not all, neurons throughout development and adult life. In
particular, APPL is highly expressed in the developing Drosophila
MB, especially the so-called ab neurons (Figure 1A–D). Flies null
for Appl (henceforth Appl2/2
) are viable, fertile, and reported to
show no gross structural defects in the brain [8]. While a
requirement for APPL in learning and memory specifically in
adult flies has been shown [23], the function of its pan-neuronal
expression throughout development remains unknown, as does the
in vivo mechanism of its action(s).
We began addressing the function of APPL in neuronal
development by carefully examining the development of the
Drosophila MB in Appl2/2
mutant flies. The MB derives from two
groups of four neuroblasts, one in each hemisphere, that
sequentially generate three subsets of neurons: the c-, a9b9 and
ab neurons, where APPL is highly expressed. Each ab neuron
projects an axon that branches into a dorsal ‘‘a branch’’ and a
medial ‘‘b branch.’’ The fascicles generated by each of these
branches are referred to as the a lobe and b lobe. The a and b
lobes can be easily visualized using the anti-FascilinII (FasII)
antibody. The lobes were present and morphologically normal in
97 adult control animals (Figure 1E) examined. In contrast, 26%
of Appl2/2
brains examined (n = 101) showed axonal defects
(Figure S1). Specifically, 14% of the brains show a-lobe loss
(Figure 1F), whereas 12% of the brains show b-lobe loss
(Figure 1G). These defects are developmental in origin as they
can be observed during ab lobe formation at 48 h of pupal
development (Figure 1H–J). To ascertain whether APPL acts cell
autonomously to regulate MB axonal outgrowth, we generated
GFP-marked single Appl2/2
cell clones using the MARCM
technique [24]. While none of the control clones showed any
defects (Figure 2A), 10% of the mutant clones showed lack of blobe
growth (Figures 2B and S2A), similar to the penetrance
observed in null mutant brains. However, none of the mutant
clones showed loss of a-lobe growth. Taken together, these data
indicate that APPL is required for normal MB axonal outgrowth
and that it is required cell-autonomously for the growth of the blobe
and non-cell autonomously for the growth of a lobe. To verify
the specificity of the Appl2/2
phenotype, we rescued the defects by
restoring APPL expression in ab neurons. Expression of full-length
membrane-bound APPL, but not a secreted form or a form
lacking the intracellular domain (ApplDC), strongly suppresses the
b-lobe loss phenotype (Figures 2C–H and S2B). These results
indicate that APPL is required as a full-length, membrane-tethered
protein and that the intracellular signaling downstream of APPL is
necessary for normal b-lobe outgrowth. Interestingly, secreted
APPL strongly reduces the loss of the a lobe (Figure S2C and
S2D), confirming that APPL acts non-autonomously in a-lobe
outgrowth. All together, the results suggest that APPL is a
robustness factor for an unknown axon growth signal whereby
Appl2/2
ab neurons are at a phenotypic threshold that causes
them to fail to grow in approximately 26% of the cases.
Abelson Kinase Is a Downstream Effector of APPL
Required for MB Axon Outgrowth
To unravel the mechanism by which APPL supports MB axon
outgrowth, we chose to focus on the cell-autonomous function of
APPL in the b lobe. A previous study using APPL gain of function
indicates that APPL overexpression induces axonal outgrowth that
is dependent on Abl kinase activity [25]. We asked whether Abl
Author Summary
Wnt Planar Cell Polarity (PCP) signaling is a universal
regulator of polarity in epithelial cells, but in neurons it
regulates axon outgrowth, suggesting the existence of
axonal modulators of Wnt-PCP activity. The Amyloid
Precursor Proteins (APPs) are intensely investigated
because of their link to Alzheimer’s disease (AD). APP’s in
vivo function in the brain and the mechanisms underlying
it remain unclear and controversial. In the present work we
investigate the role of the Drosophila neuron-specific APP
homologue, called APPL, during brain development. We
find that APPL is required for the development of ab
neurons in the mushroom body, a structure critical for
learning and memory. We find that APPL is a modulator of
the Wnt-PCP pathway required for axonal outgrowth, but
not for cell polarity. Molecularly, both human APP and fly
APPL are found in membrane complexes with PCP
receptors. Moreover, we show that APPL regulates PCP
pathway activation through its downstream effector
Abelson kinase (Abl), which modulates the phosphorylation
of the Wnt adaptor protein Dishevelled (Dsh) and the
subsequent activation of Wnt-PCP signaling. Taken together
our data suggest that APPL is the first example of a
neuron-specific modulator of the Wnt-PCP pathway.
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 2 May 2013 | Volume 11 | Issue 5 | e1001562
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 3 May 2013 | Volume 11 | Issue 5 | e1001562
kinase also acts downstream of APPL during MB b-lobe growth.
First, we tested if APPL genetically interacts with Abl. To this end
we analyzed the adult MB morphology of Appl2/2
; Abl2/+
flies.
Loss of one copy of Abelson causes a dramatic increase (up to
51%) in complete (41%) or partial (10%) b-lobe loss, compared to
Appl2/2
alone (Figure 3A, 3B and 3E, 3F). As controls we
analyzed the siblings heterozygous for both Appl and Abl (Appl2/+
;
Abl2/+
) and observed no phenotypes (Figure 3F). Similarly to
Appl2/2
mutants alone, the phenotypes arise at early developmental
stages (Figure S3A). To further confirm that Abl is the
downstream mediator of APPL signaling during b-lobe growth, we
tested if overexpression of Abl specifically in MB ab neurons
rescues the Appl null phenotype. We find that wild-type Abl, but
not a Kinase Dead (Abl-KD) form of Abl, rescues the Appl null
phenotype (Figure 3C–F) to the same extent as MB ab expression
of APPL itself (Figure S2B). Taken together these data indicate
that Abl is the effector of APPL required for the b-lobe growth.
Next, we further characterized the downstream pathway involved.
APPL Is a Novel Neuronal-Specific Modulator of PCP
Signaling
It has been recently shown that Abl phosphorylates Disheveled
(Dsh), a core intracellular component of the Wnt pathway, on the
Tyrosine 473. This modification is required for the efficient
activation of the PCP signaling pathway in epithelial cells [26].
Interestingly, in the nervous system the Wnt-PCP pathway is
required for robust axonal outgrowth both in Drosophila [27] and
mouse [28,29]. More recently, several PCP pathway components,
like the Wnt receptor Frizzled (Fz), Flamingo (Fmi), Strabismus
(Stbm or Vang), and Dsh, have been shown to play a role in the
correct targeting and bifurcation of MB axons [4,30,31]. Indeed,
we observe that flies harboring a PCP-specific mutation in Dsh
(dsh1
) [32] show the same MB developmental defects observed in
Appl2/2
flies (Figure 4A).
Together, these observations prompted us to speculate that
APPL acts to facilitate Wnt-PCP pathway activation during MB
development by mediating Dsh phosphorylation by Abl. To verify
this hypothesis we tested if the phosphorylation of Dsh on Y473 is
required for MB development. We analyzed dsh1
flies harboring
one of two genomic rescue constructs: a wild-type construct (dshDshGFP-wt)
or a Tyrosine 473 phospho-mutant construct (dshDshGFP-Y473F).
Whereas the restoration of wild-type Dsh fully
rescues the dsh1
MB phenotype (Figures 4B and S4A), DshY473F
completely fails to do so (Figures 4C and S4A). To exclude that
DshY473F
failure to rescue the phenotype is due to a perturbation
in the expression pattern resulting from the point mutation, we
performed anti-GFP staining on adult brains of both transgenic
lines. As shown in Figure 4D and 4E, both wild type and mutant
Dsh are expressed in the MB lobes. These results clearly indicate
that Abl phosphorylation of Dsh on Tyrosine 473 and the
subsequent activation of Wnt-PCP signaling are required for the
b-lobe growth.
Collectively, the data suggest the exciting possibility that APPL
may be a neuronal-specific component of the Wnt-PCP pathway.
To address this issue, we first asked if APPL interacts genetically
with core members of the Wnt-PCP pathway like the classical
Wnt-PCP receptor Fz and the canonical Wnt-PCP protein Van
Gogh/Strabismus (Vang/Stbm). We first analyzed the b-lobe of
Appl2/2
; Fz2/+
flies. Reduction of Fz in the APPL null
background increases the frequency of the b lobe loss up to
21%, whereas no phenotype is observed in control siblings
(Figures 5B, E and S5A). This interaction is specific to the MB
because expression of a dominant negative form of Fz (Fz-DN) in
Appl2/2
ab neurons yields similar results (Figures 5C, 5E and
S5A). In both experiments described, the increase in b-lobe loss is
relatively mild compared to the dramatic increase in b-lobe loss
due to APPL-Abl epistasis for example, suggesting that APPL and
Fz may act together for Wnt-PCP activation. To clarify this, we
tested if inhibition of Fz alone is sufficient to induce the b
phenotype. Overexpression of Fz-DN in ab neurons of wild-type
flies did not cause any morphological defects (Figure S5A and
S5B). These data were further confirmed by the analysis of Fz
mutant ab clones of different sizes. None of the analyzed MB
clones showed morphologically aberrant axons (Figure S5C). To
rule out compensation by Fz2, we examined Fz2 expression in the
brain and found that it is not detectable in MB (unpublished data).
Furthermore, MARCM clones null for Fz2 alone or Fz and Fz2
together show no aberrant morphology (Figure S5D and S5E).
Therefore, APPL function is a critical determinant of the role of
PCP in the outgrowth of MB b axons. To further ascertain the
interaction with the Wnt-PCP pathway, we analyzed if APPL
interacts with the Wnt-PCP four-pass transmembrane protein
Vang/Stbm. Reduction of Van Gogh in the Appl null background
(Appl2/2
;vang2/+
) increases the frequency of the b-lobe loss
phenotype to 33% (Figures 5D,E and S5A), whereas no phenotype
is observed in control siblings. APPL is also expressed in the
developing fly retina (Figure S5F), where the PCP pathway
regulates the polarity of photoreceptor cells. However, we did not
observe defects in photoreceptor polarity (Figure S5G–I), suggesting
that the role of APPL in Wnt-PCP signaling is specific to
axonal outgrowth. Together, the data above identify APPL as the
first neuronal-specific modulator of the Wnt-PCP pathway’s role
in axonal outgrowth. Next, we analyzed if the expression pattern
of Vang and APPL overlaps during MB development. For this
purpose, we used a line that expresses a YFP tagged form of Vang
under the control of the Actin promoter. As shown in Figure 5F,
during the development of the b lobe both APPL and Vang are
expressed at a high level in the growing axons. Interestingly, in
adult stage, APPL expression is reduced in the rest of the brain and
enriched in the ab neurons while Vang levels are strongly reduced
Figure 1. APPL is a robustness factor required for Mushroom Bodies development. (A–D) Developmental APPL expression in MB. Immunofluorescence
analysis using anti-APP-Cterm (A–D in magenta) and anti-FasII (A9–D9 in green) antibodies. The A-–D- panels show the merge of the
FasII and GFP channel for the indicated samples. APPL is expressed at high levels in the developing brain and is enriched along MB axons both during
development and in adult stages. (A, B) 48 h APF MB lobes. The images are single confocal stacks; zoom shows 636magnification of the boxed area
(scale bar, 50 mm in A, 25 mm in B). (C) Adult MB axons. The images are single confocal stacks (scale bar, 50 mm). (D) Zoom shows 636magnification
of the boxed area in panel C. The images are z-projections of two confocal image stacks (step size, 0.6 mm; scale bar, 25 mm). (E–G) Adult MB lobes
labeled with FascilinII antibody (FasII). All images are z-projections of confocal image stacks (scale bar, 50 mm). (E) Morphologically normal a/b
neurons in control adult brain. (F–G) Structure of a/b neurons in Appld
w* null mutant adult brains. In the absence of APPL, MB lobes show an aberrant
pattern of growth in 26% of the analyzed sample (n = 101). In particular, in 14% of the cases (F), the a lobe fails to project towards the dorsal side of
the brains (as indicated by the arrow), whereas in 12% of the cases (G), the b lobe fails to project towards the midline (as indicated by the arrow). (H)
Morphologically normal a/b neurons of a 48APF Canton S brain. (I–J) Morphologically aberrant a/b neurons of an Appld w*48APF brain. The a- (I) and
b-lobe (J) loss observed in the adult brain is already present at 48 APF, thus suggesting that is not due to degeneration but rather to failure in axon
growth.
doi:10.1371/journal.pbio.1001562.g001
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 4 May 2013 | Volume 11 | Issue 5 | e1001562
Figure 2. APPL is cell-autonomously required for b-lobe development. (A–B) Z-projections of confocal image stacks of GFP-labeled clones.
Recombination was induced at 0–24 h APF. Immunofluorescence analysis of adult MBs using anti-GFP (green) and anti-FasII (A9, B9 in magenta)
antibodies (scale bar, 50 mm). The A0 and B0 panels show the merge of the FasII and GFP channel for the indicated samples. (A) Morphologically
normal a/b neurons in single-cell control clones obtained by crossing FRT19A; ry506
flies with FRT19A,tub-Gal80,hsFLP/FM7;UAS-CD8-GFP/CyO;OK107
(n = 41 clones). (B) Appld
single-cell clones. Clones were obtained by crossing Appld
FRT19A/FM7 with FRT19A, tub-Gal80, hsFLP/FM7; UAS-CD8-GFP/
CyO; OK107. The cell-autonomous loss of APPL leads to b-lobe loss in 10% of the clones analyzed as indicated by the arrow (n = 44 clones). (C–G)
Adult MB lobes labeled with FasII antibody. All the images are z-projections of confocal image stacks (scale bar, 50 mm). (C) Morphologically normal a/
b neurons in a control adult brain. (D) Morphologically aberrant ab neurons in Appld
w*/Y;L/+;P247Gal4 analyzed as a control for the rescue
experiment (n = 47). In 13% of the brains the b axons failed to grow towards the midline. (E) Morphologically normal ab neurons in Appld
w*/Y;UASAppl/+;P247Gal4
adult brains. The re-introduction of full-length APPL in MBs during development is sufficient to rescue the b-lobe defect. Only 2% of
the samples show a phenotype; p value = 0.03467 calculated with G-test (n = 50). (F) Morphologically aberrant ab neurons in Appld
w*/Y;UAS-sAppl/
+;P247Gal4. The re-introduction of a secreted form of APPL fails to rescue the b-lobe defect, where 12% of the analyzed brains showed phenotype. p
value = 0.9831 calculated with G-test (n = 50). (G) Morphologically aberrant ab neurons in Appld
w*/Y;UAS-ApplDC/+;P247Gal4. The re-introduction of a
form of APPL lacking the C-terminal domain fails to rescue the b-lobe defect, where 11% of the analyzed brains showed phenotype (n = 54); p
value = 0.8863 calculated with G-test. (H) The graph shows the penetrance of the b-lobe loss in the rescue flies normalized against the penetrance of
the phenotype in the Appld
w* background. * Indicates a p value,0.05 calculated with G-test.
doi:10.1371/journal.pbio.1001562.g002
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 5 May 2013 | Volume 11 | Issue 5 | e1001562
in these axons (Figure 5G). Moreover, in the developing fly retina,
APPL and Vang do not colocalize and are found in juxtaposed
domains (Figure S5L). Taken together these results suggest that
both APPL and Vang are present in developing ab axons where
their genetic interaction is required for the correct development of
the b axons. On the contrary, the two proteins are expressed in
different compartments in the fly retina where APPL function is
not required for PCP activity.
Finally, to confirm that PCP signaling is indeed positively
modulated by APPL and that the activation of the signaling is
required for the b-lobe growth, we performed rescue experiments
with Dsh. As shown in Figure 5F, overexpression of Dsh in the
Appl2/2
background strongly reduces (7%) the b-lobe loss but does
not fully rescue the phenotype. This result indicates that the
phosphorylation of Dsh by Abelson is the limiting step in the
activation of PCP signaling; increasing the amount of Dsh present
in the neurons improves the phenotype, but probably the
endogenous Abelson is not sufficient to phosphorylate the whole
pool of Dsh. To overcome this problem we decided to enhance the
activation of PCP signaling by overexpressing Wnt5 in the Appl2/
2
background. Interestingly, overexpression of Wnt5 significantly
rescues the b-lobe loss (Figure 5H), indicating that the PCP
signaling activation is required for the development of the b lobe
and is reduced in absence of APPL.
APP Is Required for Dvl2 Phosphorylation in Response to
Wnt5 and Forms Complexes with PCP Core Proteins
The previously described results raise two important questions.
First, is the interaction between APPL and the Wnt-PCP pathway
conserved in mammalian APP proteins? Second, if so, do the
genetic interactions observed in Drosophila reflect a biochemical
association of APPL/APP with the Wnt-PCP receptors? To
address these issues, we first investigated if mouse APP proteins
mediate the phosphorylation of mouse Disheveled (Dvl) in
response to the Wnt-PCP ligand Wnt5a. To this end, we analyzed
Dvl phosphorylation in response to Wnt5a treatment in wild-type
versus APP/APLP2 double knock-out mouse embryonic fibroblast
(dKO MEFs). In WT MEFs, Dvl2 phosphorylation increases
dramatically upon treatment with Wnt5a. In contrast, Dvl2 in
dKO MEFs completely fails to respond to Wnt5a treatment
(Figure 6A). The effect on the activation of Dvl2 is a direct
consequence of APP loss because upon reintroduction of APP
cDNA Dvl2 phosphorylation is restored (Figure 6A). Next, we
tested if APPL and APP interacts with core Wnt-PCP receptor
proteins. In particular, we performed co-immunoprecipitation
(Co-IP) analyses of tagged proteins expressed in HEK-293T cells.
As shown in Figures 6B and S6B, APPL immunoprecipitates Vang
when the two proteins are co-expressed in the same cells. Drosophila
APPL immunoprecipitates human Van Gogh 2 (Vangl2)
Figure 3. Abelson kinase is a downstream effector of APPL required for MB axons outgrowth. (A–B) Loss of b lobes in Appld
w*/Y;Abl4
/+
adult brains. (A) In 40% of the flies that have lost one copy of Abl in the Appl2/2
background, no axons grow toward the midline (indicated by the
arrow), whereas in 10% of the cases (B) only few axons project normally (n = 29); p value = 1.29E-02 calculated with G-test. (C) Morphologically normal
ab neurons in Appld
w*/Y;UAS-Abl/+;P247Gal4 adult brains. Overexpression of Abl in the MB rescues the b-lobe loss in the Appl2/2
background. Only
2% of the analyzed samples show b-lobe loss (n = 46); p value = 0.03192 calculated with G-test. (D) Morphologically aberrant ab neurons in Appld
w*/
Y;UAS-Abl-KD/+;P247Gal4 adult brains. Overexpression of a Kinase dead form of Abl fails to rescue the b-lobe loss in the Appl2/2
background. Thirteen
percent of the analyzed brains showed b-lobe loss as indicated by the arrow (n = 31). (E) The graph shows the penetrance of b-lobe loss in the Abl
rescue flies and in the flies heterozygous for Abl, normalized against the penetrance observed in the Appld
w* background. (F) The table lists the
number of brains analyzed in the rescue experiments. * Indicates a p value,0.05 calculated with G-test; ** indicates a p value,0.001 calculated with
G-test.
doi:10.1371/journal.pbio.1001562.g003
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 6 May 2013 | Volume 11 | Issue 5 | e1001562
(Figures 6C and S6C). Importantly, this multiprotein complex can
only be detected when the proteins are expressed in the same cells,
but not when lysates from separately expressing cells are mixed
(Figure S6E). This observation also accounts for the absence of
rescue observed when a form of APPL lacking the C terminal is
expressed in the Appl2/2
animals (Figure 2H). Similarly, the
membrane tethered C-terminus of human APP (APP-C99)
immunoprecipitates Vangl2 (Figures 6D and S6D). Moreover,
we tested if APPL also immunoprecipitates other PCP receptors
like Fz. As shown in Figures 6E and S6F, APPL immunoprecipitates
Fz, suggesting that the core PCP proteins and APPL might
form a multiprotein complex on the membrane, responsible for
the efficient activation of the pathway. Similarly, the membranetethered
C-terminus of human APP (APP-C99) immunoprecipitates
human Fzd5 (Figure 6F).
Discussion
AD is a neurodegenerative disorder characterized by progressive
loss of neurons in specific regions of the brain that correlates
with progressive impairment of higher cognitive functions. A
growing body of evidence identifies the APP and its metabolite the
Ab peptide as main players in the pathogenesis of AD. In
particular, the accumulation of Ab peptides in the brain seems to
be the trigger of the pathological cascade that eventually results in
neuronal loss and degeneration [33]. Despite efforts to characterize
the molecular mechanisms underlying Ab’s toxic function, it is
Figure 4. Dsh phosphorylation is required for MB b-lobe development. Structure of ab neurons labeled with FasII antibody. All the images
are z-projections of confocal image stacks (scale bar, 50 mm). (A) Morphologically aberrant ab neurons in dsh1
adult brains. Flies homozygous for a
PCP specific allele of dsh (dsh1
) show a phenotype comparable to Appl2/2
mutants but with increased penetrance of b-lobe loss as indicated by the
arrow (30%; n = 36). (B) Morphologically normal ab neurons in dsh1
/Y;dsh-DshGFP-wt/+ adult brains. Reintroduction of wild-type Dsh in the dsh1
mutant background completely rescues b-lobe loss with no brains showing defects (n = 31). (C) Morphologically aberrant ab neurons in dsh1
/Y;;dshDshGFP-Y473F/+
adult brains. Reintroduction of a Tyrosine 473 phospho-mutant form of Dsh in a dsh1
mutant background fails to rescue the b-lobe
loss as indicated by the arrow (n = 41). (D–E) Expression pattern of Dsh-GFP in ;dsh-DshGFP-wt/TM6b and of Dsh-Y473F-GFP in ;dsh-DshGFP-Y473F/+.
Immuno-fluorescence analysis of adult brains using anti-GFP (green) and anti-FasII (D9, E9 in magenta) antibodies (scale bar, 50 mm). All images are zprojections
of two confocal sections (0.9 mm steps). The D0 and E0 panels show the merge of the FasII and GFP channel for the indicated samples.
doi:10.1371/journal.pbio.1001562.g004
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 7 May 2013 | Volume 11 | Issue 5 | e1001562
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 8 May 2013 | Volume 11 | Issue 5 | e1001562
Figure 5. APPL interacts with PCP signaling during MB development. (A–D) Structure of ab neurons labeled with the FasII antibody. All the
images are z-projections of confocal image stacks (scale bar, 50 mm). (A) Morphologically normal ab neurons in a control adult brain. (B)
Morphologically aberrant ab neurons in Appld
w*/Y;;FzKD
/+ adult brains. Loss of one copy of Fz in the Appl2/2
background increases moderately, but
not significantly, the penetrance of b-lobe loss (indicated by the arrow) to 21% (n = 28); p value = 0.2166 calculated with G-test. (C) Morphologically
aberrant a/b neurons in Appld
w*/Y;UAS-Fz-DN/+;P247Gal4/+ adult brains. Overexpression of a dominant negative form of Fz in the Appl2/2
background increases moderately, but not significantly, the penetrance of the phenotype to 18% (n = 28); p value = 0.4226 calculated with G-test. (D)
Morphologically aberrant ab neurons in Appld w*/Y;Vangstbm-6
/+ adult brains. Loss of one copy of Vang in the Appl2/2
background increases the
penetrance of the b-lobe loss up to 33% (n = 21); p value = 0.02304 calculated with G-test. (E) The graph shows the penetrance of b-lobe loss in
genetic interaction experiments, normalized against the penetrance in the Appld
w* background. (F, G) APPL and Vang localization during
development in brain of flies Act-Stbm-EYFP expressing an EYPF tagged form of Vang under the control of the Actin promoter. Immuno-fluorescence
analysis using anti-APP-Cterm (F, G in blue), anti-GFP (F9, G9 in green), and anti-FasII (F0, G0 in red) antibodies. The images are single confocal stacks
(scale bar, 25 mm). The F- and G- panels show the merge of the FasII and GFP channel for the indicated samples. (F) At 48 h APF, Vang is broadly
expressed along the MB b axons, where also APPL is expressed as indicated by the arrow. (G) At adult stage, the level of Vang detectable in the b
axons is strongly reduced compared to the previously analyzed time point, while APPL is enriched in the MB neurons (as indicated by the arrow). (H)
The graph shows the penetrance of the b-lobe loss in the Appldw*
flies overexpressing Dsh or Wnt5 (p value equal to 0.1287 and 0.0006692,
respectively). Activation of Wnt-PCP signaling upon Wnt5 signaling rescues the b-lobe phenotype. ** Indicates a p value,0.001 calculated with G-
test.
doi:10.1371/journal.pbio.1001562.g005
Figure 6. APP is required for the proper response to Wnt5 and forms complexes with PCP core proteins. (A) Analysis of the
responsiveness of wt MEFs and MEFs lacking all the APP isoforms to Wnt5 treatment. MEFs were treated for 2 h with rmWnt5a and subsequently
analyzed by Western blot. After the Wnt5 treatment, Dvl2 is phosphorylated and this modification is indicated by a shift of the band detected by Dvl2
Ab. KO MEFs respond less efficiently to Wnt5. Re-introduction of hAPP rescues the responsiveness to Wnt5. The graph shows a quantification of the
ratio between phospho-Dvl2 and Dvl2 in the analyzed samples. * Indicates a p value,0.05 calculated with one-way ANOVA plus Tukey’s multiple
comparison test. (B) Co-immunoprecipitation (Co-IP) of Appl-FLAG and Vang-Myc. The tagged proteins were co-expressed in HEK293T cells and
immunoprecipitated with anti-FLAG antibody. Vang-Myc can be precipitated upon IP of Appl-FLAG. (C) Co-IP of Appl-FLAG and human Vangl2-HA.
Human Vangl2-HA can be precipitated upon IP of Appl-FLAG. (D) Co-IP of human APP (C99)-FLAG and human Vangl2-HA. Human Vangl2-HA can be
precipitated upon IP of APP (C99)-FLAG, indicating that interaction with PCP proteins is a conserved feature of APP proteins. (E) Co-IP of Appl-FLAG
and dFz-GFP. Drosophila Fz can be precipitated upon IP of Appl-FLAG. (F) Co-IP of human APP (C99)-FLAG and human V5-Fzd5. V5-Fzd5 can be
precipitated upon IP of APP (C99)-FLAG.
doi:10.1371/journal.pbio.1001562.g006
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 9 May 2013 | Volume 11 | Issue 5 | e1001562
still not clear what triggers the accumulation of the peptide and how
this is correlated with the pathogenesis of the disease and the
dementia. In fact, most of the work done to unveil the pathogenesis
of the disease has focused on the analysis of Ab-peptide and the
search for its receptors and downstream effectors. Even though the
numerous in vitro studies performed in cell culture identified several
molecules that interact with Ab peptide, the in vivo biological
relevance of these interactions remains to be clarified. The amyloid
cascade hypothesis has also dominated the search for AD treatments,
but the promising molecular candidates developed to modulate the
Ab peptide and reached clinical trials failed [34,35]. Finally, over the
last few years many studies indicated that there is no linear
correlation between the accumulation of the peptide and the
cognitive decline, leading to a revision of the amyloidogenic
hypothesis. Taken together, these observations suggest that the
accumulation of the peptide is not the only cause of the pathology
and that other factors are involved. Interestingly, under physiological
conditions APP is mainly found in its uncleaved or a-cleaved form,
suggesting that the shift towards amyloidogenic processing not only
increases the production of Ab peptide but also depletes the pool of
APP that undergoes non-amyloidogenic processing, with hitherto
unknown consequences. It is therefore of paramount importance to
understand the physiological role of APP and how perturbing this
role could contribute to the pathogenesis of the disease. An
important contribution to the study of the function of a protein
comes from the analysis of the knock-out (KO) animals. In the case of
APP, several KO models have been generated and analyzed in detail
both from the morphological and behavioral point of view [13,36–
38]. Despite these efforts, the normal physiological function of APP
in vivo in the nervous system remains largely elusive and highly
controversial. This is due to the lack of consensus over the neuronal
phenotypes in null mutant animals and the mechanism of action in
vivo. The data collected by different labs confirmed the involvement
of APPs in development and function of the nervous system, but
these studies do not provide an in-depth analysis of the development
of the brain during the pre-natal stages or the molecular mechanism
underlying APPs’ putative functions. We therefore took advantage of
Drosophila melanogaster to further analyze the consequence of loss of
APP Like (APPL) during brain development.
In the present study we demonstrate that APPL is involved in
brain development of Drosophila melanogaster, particularly in the
Mushroom Body (MB) neurons. We show that APPL is required
for the development of ab neurons. In Appl2/2
flies, MB neurons
fail to project the a lobe in 14% of the cases and the b-lobe in 12%
of the cases (Figure 1). Further analysis of the phenotype reveals
that APPL is required cell-autonomously for the development of
the b lobe and non-cell autonomously for the development of the a
lobe. In fact, single cell Appl2/2
clones display only b-lobe loss and
no a loss. The re-introduction of a full-length, membrane-tethered
form of APPL, but not a soluble form, rescues b-lobe loss
(Figure 2). This is of particular interest because it confirms that,
similar to mammalian APPs, the physiological role of APPL is
mediated both by its full-length form, required in the neurons to
achieve the correct b-lobe pattern, and by its soluble form (sAPPL)
that regulates the extension of the a lobe. Moreover, the rescue
data indicate that, at least in this context, the function of sAPPL is
mediated not by homo-dimerization with the full-length form but
by some other receptor, hitherto unknown. Further experiments
are required to clarify the sAPPL non-cell autonomous effect, but
we hypothesize that it might be involved in modulating signaling
mediated by the cells that surround the MB axons. Taken
together, the analysis of the Appl2/2
animals confirmed the
important role of APPs during brain development but reinforced
the idea that the phenotypes are present with incomplete
penetrance and might be subtle. It would therefore be of interest
to analyze the phenotype of the KO mice in greater detail and, in
particular, to better characterize the APP’s downstream pathway
leading to these defects.
Moreover, the results described clearly support a model of
APPL as a novel, neuronal-specific positive modulator of the WntPCP
pathway (Figure 4). The PCP pathway was initially described
because of its role in tissue polarity establishment and, in
particular, of its regulation of cell orientation in plane of an
epithelium. Among the different processes regulated by PCP
signaling, we are interested in axon growth and guidance. It has
been described that mice null for Fzd3/Ceslr32/2
genes show
severe defects in several major axon tracts like thalamocortical,
corticothalamic, and nigrostriatal tracts, defects of the anterior
commissure, and similarly to APP KO mice, the variable loss of
the corpus callosum [5,39].
The molecular mechanism underlying the function of PCPsignaling
in regulating tissue polarity has been broadly studied.
The current model suggests that, upon polarized expression of the
different core proteins, Dsh is recruited to the membrane via Fz
and leads to the activation of a cascade of small GTPases finally
resulting in cytoskeleton rearrangements. In the case of regulation
of axon growth and guidance, it is less clear how the signaling is
regulated and transmitted to the cytoskeleton. A recent publication
suggested that during axon growth the transmembrane PCP
receptor-like Vang and Fzd are localized at the growth cone area
on the tip of the fillopodia, thus suggesting that in this context the
asymmetric localization is not needed [28].
Furthermore, Dsh needs to relocalize from the cytoplasm to
the membrane to ensure the proper activation of PCP signaling,
and this is dependent on its phosphorylation status. Singh and
colleagues showed that Abelson is one kinase responsible for this
modification, but the receptor upstream of the kinase was not
identified [26]. Based on the evidence we generated, we propose
that APPL is a novel regulator of Wnt-PCP pathway involved in
axon growth and guidance (Figure 7). This is of interest because
while the PCP core proteins are ubiquitously expressed, APPL is
restricted to the nervous system, suggesting that it could be the
first described tissue-specific modulator of the pathway.
Mechanistically, we propose that APPL-Abl complex modulates
Dsh via dual protein-protein interactions. First, Abl might have an
intrinsic affinity for its substrate Dsh [26]. Secondly, this interaction
is strengthened or stabilized by the inclusion of APPL in a PCP
receptor complex. This dual affinity complex leads to increased PCP
signaling efficiency at the developing growth cone. Both biochemical
and physiological data show that this function is highly conserved in
mammalian APP, suggesting that it may play a similar role in the
mammalian brain. The canonical-Wnt signaling pathway has
already been connected to AD pathogenesis because of its link to
the tau-kinase GSK-3b. Interestingly, no clear link between the WntPCP
pathway and this neurodegenerative disorder has been made.
Previous reports [27,28] show that, in flies and mice, Jun N-terminal
Kinase (JNK) is the final effector of PCP in axon outgrowth and JNK
was shown to be required for the effect of APP overexpression in the
fly [25,40]. Interestingly, JNK signaling has also been linked to the
neuronal loss observed in AD [41]. It is therefore worth investigating
whether the physiological function of APP as a neuronal PCP
modulator explains the JNK-AD connection.
Materials and Methods
Fly Stocks
Drosophila stocks used include Appld
w*
, Appld
,FRT19A w*
,
elavC155
,hsFLP,w*;UAS-mCD8::GFP.,UAS-lacZ/CyO;tubP-GAL80,
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 10 May 2013 | Volume 11 | Issue 5 | e1001562
FRT2A/TM6,Tb,Hu, hsFlp,UAS-CD8-GFP;;FRT2A,tubGal80/
TM3;OK107, hsFlp, UAS-CD8-GFP; FRT2A, tubGal80/
TM3;OK107, Flp122; sp/CyO;Fz p21,ri,FRT2A/TM2,
fz2C1
ri,FRT2A/TM3,Sb, yw,hsflip;Fz1H51
Fz2C1
riFRT2A
/TM2,
UAS-Fz-DN/CyO;P247Gal4/TM6c, UAS-Abl-KD/CyO;P247Gal.
Abl4
kar1
red1
e1
/TM6B, Tb1
, w*;UAS-Abl/CyO;P247, w;
fz [KD]
/TM3,Sb, Vangstbm-6
, w;201Y,UAS-GFP, FRT19A;ry50
,
FRT19A,tub-Gal80,hsFLP/FM7;UAS-CD8-GFP/CyO;OK107,
UAS-Appl/CyO;P247Gal4, UAS-sAppl/Cyo;P247Gal4, w1
,
dsh:1
, dsh.Dsh-GFP (J7)/TM6. dshV26,dsh.Dsh-GFP;
dsh.Dsh-GFP Y473F, and Act-stbm-EYFP/TM3.
Accession Numbers/ID Numbers
APPL (FBgn0000108), fz (FBgn0001085), fz2 (FBgn0016797),
Fzd5 (NP_003459.2), dsh (FBgn0000499), dvl1 (AAB65242.1),
dvl2 (AAB65243.1), Vang (FBgn0015838), Vagl2 (NP_065068.1),
and Abl (FBgn0000017).
Immunochemistry
Larval, pupal, or adult brains were dissected in phosphate
buffered saline (PBS) and fixed in 3.7% formaldehyde in PBT
(PBS+ Triton 6100 0.1%) for 15 min. The samples were
subsequently rinsed three times in PBT and blocked in PAXDG
for 1 h. Following these steps, the brains were incubated with
the primary antibody diluted in PAX-DG overnight at 4uC. This
incubation was followed by three washes with PBT and a
subsequent incubation with the appropriate fluorescent secondary
antibodies for 2 h at RT. After three rinses in PBT, the brains
were put in 50% Glycerol diluted in PBS and then mounted in
Vectashield (Vector Labs) mounting medium. The following
antibodies were used: rabbit anti-GFP (Invitrogen, 1:1,000),
mouse anti-FasII (Hybridoma Bank, 1:50), rabbit anti-APP-Cterm
(kind gift of Bart de Strooper lab, 1:5,000), and antiPhalloidin
TRITC (1:1,000).
Microscopy and Image Analysis
The mounted brains were imaged either on a LEICA DM 6000
CS microscope coupled to a LEICA CTR 6500 confocal system or
on a Nikon A1-R confocal (Nikon) mounted on a Nikon Ti-2000
inverted microscope (Nikon) and equipped with 405, 488, 561,
and 639 nm lasers from Melles Griot. The pictures were then
processed using ImageJ and Adobe Photoshop.
MARCM Procedure
Crosses were set up at 25uC and transferred every day. We
transferred 0 to 24 pupae in a fresh vial, and they were heath
shocked for 459 at 37uC and shifted back at 25uC until eclosion.
The morphology of the MB clones was analyzed in flies 0–7 d old.
Cell Culture and Treatments
WT MEFs, APP/APLP2 double KO MEFs, APP/APLP2
double KO+hAPP, and HEK-293T cells were propagated in
DMEM, 10% FCS, 2 mM L-glutamine, 50 units/ml penicillin, 50
units/ml streptomycin. MEFs (200,000 cells per well) were seeded
in 24-well plates for biochemical analyses. MEFs were treated 2 d
after seeding with rmWnt5a (R&D Systems) for 2 h. Cells were
harvested for immunoblotting by direct lysis in 16Laemmli buffer
followed by boiling at 95uC for 5 min. Control stimulations were
done with 0.1% BSA in PBS.
Gel Electrophoresis and Western Blots
Protein from total cell lysates/samples was resolved in 10%
polyacrylamide gels (SDS-PAGE) under denaturing conditions
and then transferred to nitrocellulose membranes. The blots were
probed using polyclonal anti-FLAG M2 (F1804, Sigma-Aldrich
1:1,000), monoclonal anti-Myc (M4439,Sigma-Aldrich 1:1,000),
anti-Dvl1 (sc-8025, Santa Cruz Biotechnologies, 1:1,000), antiDvl2
(#3224, Cell Signaling Technologies, 1:1,000), anti-V5
(R960-25, Invitrogen, 1:1,000), anti-HA (HA.11, MMS-101R,
Covance, 1:2,000), and anti-beta-actin (sc-1615, Santa Cruz
Biotechnology, 1:2,000). Bands were visualized using anti-IgG
HRP-conjugated secondary antibodies, and the ECL Western
Blotting Detection System (GE Healthcare, UK).
Co-Immunoprecipitation
For the Co-IP of Drosophila proteins, pCDNA3-APPL-FLAG
and pCDNA3-Vang-Myc were transiently transfected in
HEK293T cells (4.56106
cells per 10 cm dish) using Fugene
HD (Roche). After 3 d, cells were collected in Lysis Buffer
(150 mM NaCl, 50 mM Tris/HCl pH 7.5, 10% glycerol, 0.4%
Nonidet P-40) and cleared with Dynabeads M-270 epoxy
(Invitrogen) for 459 at 4uC. After the clearing, lysates (half volume)
were incubated with anti-FLAG covalently conjugated to
Dynabeads M-270 (pre-saturated with BSA) for 1 h at 4uC. Beads
were then washed, and bound proteins were resuspended in 66
Laemmli and subjected to SDS-PAGE followed by Western blot
analysis. For the Co-IP of Drosophila and human proteins,
HEK293 cells grown at 50% confluency on 10-cm plates were
transfected with 6 mg of each plasmid. After 2 d, cells were lysed
for 15 min in 1 ml of lysis buffer ([0 mM Tris buffer pH 7.4,
150 mM NaCl, 1 mM EDTA, 0.5% NP40 supplemented with
1 mM DTT and protease inhibitor cocktail (Roche, cat.
no. 11836145001)]. Lysates were centrifuged at 13,2006 g for
20 min at 4uC, supernatants were collected, and 0.4 ml of the
supernatant was incubated with 1 mg of indicated immunoprecipitating
antibody for 1 h at 4uC. Immunoprecipitates were collected
on Protein G sepharose beads by overnight rotation, washed four
times with lysis buffer, resuspended in 26Laemmli sample buffer,
Figure 7. APPL is a novel modulator of Wnt-PCP signaling
required for axon guidance. Schematic representation of the
proposed model. APPL is a novel regulator of Wnt-PCP pathway. In
the presence of Wnt signaling, Fz binds Dsh, which needs to be
phosphorylated by Abelson kinase to correctly relocalize to the
membrane. We propose that Appl is part of the membrane complex
formed by the core PCP proteins Fz1 and Vang. In turn, Appl recruits
Abelson kinase to the complex and positively modulates Dsh
phosphorylation. The subsequent activation of the signaling is required
for MB b-axon growth.
doi:10.1371/journal.pbio.1001562.g007
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 11 May 2013 | Volume 11 | Issue 5 | e1001562
and subjected to SDS-PAGE followed by Western blot analysis.
The antibodies used for immunoprecipitation include FLAG M2
(F1804 Sigma-Aldrich), anti-HA (ab9110; Abcam), anti-Myc
(M4439, Sigma-Aldrich), and anti-V5 (R960-25, Invitrogen).
Supporting Information
Figure S1 Appl is required during the development of
Mushroom Bodies for a- and b-lobe growth. (A) The table shows
the number of brains analyzed to characterize the Appl loss of
function phenotype.
(PDF)
Figure S2 APPL is required cell-autonomously for the b-lobe
outgrowth. (A)The table lists the number of brains analyzed in the
MARCM experiments. (B, C) The table lists the number of brains
analyzed in the rescue experiments. (D) Adult MB lobes labeled
with FascilinII II antibody (FasII). The image is a z-projection of
confocal image stacks (scale bar, 50 mm). Morphologically normal
ab neurons in Appld
w*/Y;UAS-sAppl/+;P247Gal4 adult brains.
The reintroduction of soluble APPL in MBs during development
strongly reduces the loss of the a lobe.
(PDF)
Figure S3 Abelson kinase is the downstream effector of APPL in
MB development. (A) Structure of a/b neurons of a Appld;;Abl4
48APF brain. The image is a z-projection of confocal image stacks
(scale bar, 50 mm). The MBs are labeled with anti-FasII antibody.
b-lobe loss is detectable already at 48 APF, similarly to what is
observed in the Appl2/2
background.
(PDF)
Figure S4 Dsh phosphorylation is required for MB development.
(A) The table lists the number of brains analyzed in the dsh
rescue experiments.
(PDF)
Figure S5 Appl interacts with the PCP signaling during MB
development. (A) The table lists the number of brains analyzed in the
PCP genetic interaction experiments. (B) Structure of a/b neurons
labeled with anti-FasII antibody. The image is a z-projection of
confocal image stacks (scale bar, 50 mm). Morphologically normal a/
b neurons in UAS-FzDN/+;P247Gal4/+ adult brains. Expression of
a dominant negative form of fz in the MB is not sufficient to induce
defects. (C–E) Z-projections of confocal image stacks of GFP-labeled
MARCM clones. Immuno-fluorescence analysis of adult MB, using
anti-GFP (green) and anti-FasII (magenta) antibodies. (C) fzp21
mutant clones obtained by crossing elavC155,hsFLP,w*;UAS-
mCD8::GFP,UAS-lacZ/CyO;tubP-GAL80,FRT2A/TM6,Tb,Hu
or hsFlp, UAS-CD8-GFP;; FRT2A, tubGal80/TM3; OK107
with yw Flp122; sp/CyO;fz p21,ri,FRT2A/TM2. fz mutant cells
show normal axon projections, similar to their wild-type
counterparts. (D) fz2C1 mutant clones obtained by crossing
virgins elavC155,hsFLP,w*;UAS-mCD8::GFP.,UAS-lacZ./CyO;
tubP-GAL80,FRT2A/TM6,Tb,Hu or hsFlp, UAS-CD8-GFP;
FRT2A, tubGal80/TM3; OK107 with males fz2C1 ri, FRT2A/
TM3, Sb. Single-cell clones do not show any difference in their
projection pattern compared to wild-type cells. (E) fzH51, fz2C1
double mutant clones obtained by crossing elavC155,hsFLP,
w*;UAS-mCD8::GFP.,UAS-lacZ./CyO;tubP-GAL80,FRT2A/
TM6,Tb,Hu with yw,hsflip; ;fz H51fz2 C1ri FRT2A/TM2. Loss of
both fz and fz2 does not influence b-lobe growth, thus excluding
possible compensatory effects. (F) Appl expression in third instar
larvae eye disc. (G–I) Tangential adult eye sections in areas around
the equator. The colored bars indicate the orientation of the
ommatidia. (H) dsh1
mutant flies show PCP defects and reduction of
symmetric ommatidia. (I) Appl2/2
adult flies show ommatidia
orientation comparable to wild-type flies (G). (J) APPL and Vang
localization during development in brain of flies expressing a EYPF
tagged form of Vang under the control of Actin promoter. Immunofluorescence
analysis using anti-APP-Cterm (blue), anti-GFP
(green), and anti-FasII (red) antibodies. The images are single
confocal stacks (scale bar, 15 mm). APPL and Vang are expressed in
mutually exclusive compartments in the developing retina.
(PDF)
Figure S6 APP proteins are found in core PCP complexes. (A)
APP expression levels in wild-type MEFs, KO MEFs, or KO
MEFs stably transfected with APP. Two clones of rescue MEFs
were analyzed. Clone B shows detectable APP levels and was used
for the Wnt5 stimulation assay. (B) Co-immunoprecipitation (CoIP)
of Appl-FLAG and Vang-Myc. The tagged proteins were coexpressed
in HEK293T cells and immunoprecipitated with antiMyc
antibody. Appl-FLAG can be precipitated upon IP of Vang.
The Co-IP in this direction is weaker than after pull-down of ApplFlag.
(C) Co-IP of Appl-FLAG and human Vangl2-HA. ApplFLAG
can be precipitated upon IP of human Vangl2-HA. (D) CoIP
of APP (C99)-FLAG and Vangl2-HA. The tagged proteins
were immunoprecipitated from whole cells with anti-HA antibody.
APP (C99)-FLAG can be precipitated upon IP of human Vangl2HA.
(E) Control co-immunoprecipitation of overexpressed ApplFLAG
and Vangl2-HA. The proteins were separately expressed in
different cells plated in two different dishes and pooled during the
Co-IP procedure. The IP was performed with anti-FLAG and
anti-HA antibody and followed by Western blot analysis. The
proteins do not co-immunoprecipitate when expressed in different
populations of cells. (F) Co-immunoprecipitation (Co-IP) of ApplFLAG
and Fz-GFP. Appl-FLAG can be precipitated upon IP of
Fz.
(PDF)
Acknowledgments
We thank Gary Struhl for providing Flp122; sp/CyO;Fz p21,ri,FRT2A/TM2
stock, David Strutt for providing the Act-stbm-EYFP/TM3, Marek Mlodzik
for sharing with us the ;dsh.Dsh-GFP (J7)/TM6 and the dshV26,dsh.DshGFP;
dsh.Dsh-GFP Y473F stocks, Ulrike Mu¨ller for providing APP/APLP2
KO fibroblasts, Patrick Callaerts for sharing the hsFlp,UAS-CD8GFP;;FRT2A,tubGal80/TM3;OK107
stock, and the lab of Stein Aerts for
the support on the statistical analysis of the data. We thank Ariane
Ramaekers and Luca Tiberi for critical discussion.
Author Contributions
The author(s) have made the following declarations about their
contributions: Conceived and designed the experiments: AS J-MD VB
BAH. Performed the experiments: AS ZO PJ KT ER AC JY JMD.
Analyzed the data: AS ZKA J-MD VB BAH. Contributed reagents/
materials/analysis tools: BDS. Wrote the paper: AS BAH.
References
1. Bayly R, Axelrod JD Pointing in the right direction: new developments in the
field of planar cell polarity. Nat Rev Genet 12: 385–391.
2. Seifert JR, Mlodzik M (2007) Frizzled/PCP signalling: a conserved
mechanism regulating cell polarity and directed motility. Nat Rev Genet 8:
126–138.
3. Lyuksyutova AI, Lu CC, Milanesio N, King LA, Guo N, et al. (2003) Anteriorposterior
guidance of commissural axons by Wnt-frizzled signaling. Science 302:
1984–1988.
4. Ng J (2012) Wnt/PCP proteins regulate stereotyped axon branch extension in
Drosophila. Development 139: 165–177.
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 12 May 2013 | Volume 11 | Issue 5 | e1001562
5. Tissir F, Bar I, Jossin Y, De Backer O, Goffinet AM (2005) Protocadherin Celsr3
is crucial in axonal tract development. Nat Neurosci 8: 451–457.
6. Jacobsen KT, Iverfeldt K (2009) Amyloid precursor protein and its homologues:
a family of proteolysis-dependent receptors. Cell Mol Life Sci 66: 2299–2318.
7. Luo LQ, Martin-Morris LE, White K (1990) Identification, secretion, and neural
expression of APPL, a Drosophila protein similar to human amyloid protein
precursor. J Neurosci 10: 3849–3861.
8. Luo L, Tully T, White K (1992) Human amyloid precursor protein ameliorates
behavioral deficit of flies deleted for Appl gene. Neuron 9: 595–605.
9. Bayer TA, Wirths O (2008) Review on the APP/PS1KI mouse model:
intraneuronal Abeta accumulation triggers axonopathy, neuron loss and working
memory impairment. Genes Brain Behav 7 Suppl 1: 6–11.
10. Iijima K, Liu HP, Chiang AS, Hearn SA, Konsolaki M, et al. (2004) Dissecting
the pathological effects of human Abeta40 and Abeta42 in Drosophila: a
potential model for Alzheimer’s disease. Proc Natl Acad Sci U S A 101: 6623–
6628.
11. Ling D, Song HJ, Garza D, Neufeld TP, Salvaterra PM (2009) Abeta42-induced
neurodegeneration via an age-dependent autophagic-lysosomal injury in
Drosophila. PLoS One 4: e4201.
12. Pereira C, Ferreiro E, Cardoso SM, de Oliveira CR (2004) Cell degeneration
induced by amyloid-beta peptides: implications for Alzheimer’s disease. J Mol
Neurosci 23: 97–104.
13. Muller U, Cristina N, Li ZW, Wolfer DP, Lipp HP, et al. (1994) Behavioral and
anatomical deficits in mice homozygous for a modified beta-amyloid precursor
protein gene. Cell 79: 755–765.
14. Herms J, Anliker B, Heber S, Ring S, Fuhrmann M, et al. (2004) Cortical
dysplasia resembling human type 2 lissencephaly in mice lacking all three APP
family members. EMBO J 23: 4106–4115.
15. Young-Pearse TL, Suth S, Luth ES, Sawa A, Selkoe DJ Biochemical and
functional interaction of disrupted-in-schizophrenia 1 and amyloid precursor
protein regulates neuronal migration during mammalian cortical development.
J Neurosci 30: 10431–10440.
16. Nikolaev A, McLaughlin T, O’Leary DD, Tessier-Lavigne M (2009) APP binds
DR6 to trigger axon pruning and neuron death via distinct caspases. Nature
457: 981–989.
17. Kamal A, Almenar-Queralt A, LeBlanc JF, Roberts EA, Goldstein LS (2001)
Kinesin-mediated axonal transport of a membrane compartment containing
beta-secretase and presenilin-1 requires APP. Nature 414: 643–648.
18. Lazarov O, Morfini GA, Lee EB, Farah MH, Szodorai A, et al. (2005) Axonal
transport, amyloid precursor protein, kinesin-1, and the processing apparatus:
revisited. J Neurosci 25: 2386–2395.
19. Russo C, Venezia V, Repetto E, Nizzari M, Violani E, et al. (2005) The amyloid
precursor protein and its network of interacting proteins: physiological and
pathological implications. Brain Res Brain Res Rev 48: 257–264.
20. Ring S, Weyer SW, Kilian SB, Waldron E, Pietrzik CU, et al. (2007) The
secreted beta-amyloid precursor protein ectodomain APPs alpha is sufficient to
rescue the anatomical, behavioral, and electrophysiological abnormalities of
APP-deficient mice. J Neurosci 27: 7817–7826.
21. Neve RL, McPhie DL, Chen Y (2000) Alzheimer’s disease: a dysfunction of the
amyloid precursor protein(1). Brain Res 886: 54–66.
22. Selkoe DJ, Yamazaki T, Citron M, Podlisny MB, Koo EH, et al. (1996) The role
of APP processing and trafficking pathways in the formation of amyloid betaprotein.
Ann N Y Acad Sci 777: 57–64.
23. Goguel V, Belair AL, Ayaz D, Lampin-Saint-Amaux A, Scaplehorn N, et al.
(2011) Drosophila amyloid precursor protein-like is required for long-term
memory. J Neurosci 31: 1032–1037.
24. Lee T, Luo L (1999) Mosaic analysis with a repressible cell marker for studies of
gene function in neuronal morphogenesis. Neuron 22: 451–461.
25. Leyssen M, Ayaz D, Hebert SS, Reeve S, De Strooper B, et al. (2005) Amyloid
precursor protein promotes post-developmental neurite arborization in the
Drosophila brain. EMBO J 24: 2944–2955.
26. Singh J, Yanfeng WA, Grumolato L, Aaronson SA, Mlodzik M (2010) Abelson
family kinases regulate Frizzled planar cell polarity signaling via Dsh
phosphorylation. Genes Dev 24: 2157–2168.
27. Srahna M, Leyssen M, Choi CM, Fradkin LG, Noordermeer JN, et al. (2006) A
signaling network for patterning of neuronal connectivity in the Drosophila
brain. PLoS Biol 4: e348.
28. Shafer B, Onishi K, Lo C, Colakoglu G, Zou Y (2011) Vangl2 promotes Wnt/
planar cell polarity-like signaling by antagonizing Dvl1-mediated feedback
inhibition in growth cone guidance. Dev Cell 20: 177–191.
29. Zhou L, Bar I, Achouri Y, Campbell K, De Backer O, et al. (2008) Early
forebrain wiring: genetic dissection using conditional Celsr3 mutant mice.
Science 320: 946–949.
30. Shimizu K, Sato M, Tabata T (2011) The Wnt5/planar cell polarity pathway
regulates axonal development of the Drosophila mushroom body neuron.
J Neurosci 31: 4944–4954.
31. Grillenzoni N, Flandre A, Lasbleiz C, Dura JM (2007) Respective roles of the
DRL receptor and its ligand WNT5 in Drosophila mushroom body
development. Development 134: 3089–3097.
32. Axelrod JD, Miller JR, Shulman JM, Moon RT, Perrimon N (1998) Differential
recruitment of Dishevelled provides signaling specificity in the planar cell
polarity and Wingless signaling pathways. Genes Dev 12: 2610–2622.
33. Tanzi RE, Bertram L (2005) Twenty years of the Alzheimer’s disease amyloid
hypothesis: a genetic perspective. Cell 120: 545–555.
34. Hardy J, Selkoe DJ (2002) The amyloid hypothesis of Alzheimer’s disease:
progress and problems on the road to therapeutics. Science 297: 353–356.
35. Karran E, Mercken M, De Strooper B (2011) The amyloid cascade hypothesis
for Alzheimer’s disease: an appraisal for the development of therapeutics. Nat
Rev Drug Discov 10: 698–712.
36. Li ZW, Stark G, Gotz J, Rulicke T, Gschwind M, et al. (1996) Generation of
mice with a 200-kb amyloid precursor protein gene deletion by Cre
recombinase-mediated site-specific recombination in embryonic stem cells. Proc
Natl Acad Sci U S A 93: 6158–6162.
37. Zheng H, Jiang M, Trumbauer ME, Sirinathsinghji DJ, Hopkins R, et al. (1995)
beta-Amyloid precursor protein-deficient mice show reactive gliosis and
decreased locomotor activity. Cell 81: 525–531.
38. Heber S, Herms J, Gajic V, Hainfellner J, Aguzzi A, et al. (2000) Mice with
combined gene knock-outs reveal essential and partially redundant functions of
amyloid precursor protein family members. J Neurosci 20: 7951–7963.
39. Wang Y, Thekdi N, Smallwood PM, Macke JP, Nathans J (2002) Frizzled-3 is
required for the development of major fiber tracts in the rostral CNS. J Neurosci
22: 8563–8573.
40. Taru H, Iijima K, Hase M, Kirino Y, Yagi Y, et al. (2002) Interaction of
Alzheimer’s beta -amyloid precursor family proteins with scaffold proteins of the
JNK signaling cascade. J Biol Chem 277: 20070–20078.
41. Kihiko ME, Tucker HM, Rydel RE, Estus S (1999) c-Jun contributes to amyloid
beta-induced neuronal apoptosis but is not necessary for amyloid beta-induced cjun
induction. J Neurochem 73: 2609–2612.
APPL Regulates Wnt-Dependent Axon Growth
PLOS Biology | www.plosbiology.org 13 May 2013 | Volume 11 | Issue 5 | e1001562
A
Genotype n α loss β loss
Appl-/- 101 14% 12%
Appl-/+ 97 0 0
BA
Genotype n α loss β loss
Appl -/- 101 14% 12%
Appl +/- 97 0 0
Control clones 41 0 0
Appl -/- clones 44 0 10%
Genotype n β loss
Appl -/- 101 12%
Appl -/+ 97 0
Appl -/-, rescue fl -APPL 45 2%
Appl -/+, rescue fl -APPL 35 0
Appl -/-, rescue sAPPL 50 12%
Appl -/+, rescue sAPPL 23 0
Appl -/-, rescue APPL ΔC 54 11%
Appl -/+, rescue APPLΔC 47 0
Appl -/-, rescue control (driver) 47 13%
Genotype n α loss β loss
Appl -/- 101 14% 12%
Appl -/+ 97 0 0
Appl -/- , rescue sAPPL 50 4% 12%
Appl -/+, rescue sAPPL 23 0 0
Appl -/- 47 13% 13%rescue control (driver),
FasII
C D
48APF
Appl -/-, Abl -/+
FasII
A
Genotype n β loss
Dsh1
36 30%
Dsh1
, Dsh>Dsh-GFP 31 0
Dsh1
, Dsh>Dsh -Y473F-GFP 41 29%
fz-DN
FasII
B
fz mutant single cell clones
C C’ C’’
FasIIGfp Merge
MergeFasIIGfp
fz2 mutant single cell clones
fz/fz2 mutant single cell clones
MergeFasIIGfp
D D’ D’’
E E’ E’’
A Genotype n β loss
Appl -/- 101 12%
Appl +/- 97 0
dsh1 36 30%
Appl -/-, fz -/+ 28 21%
Appl -/+, fz -/+ 21 0
Appl -/-, fzDN 28 18%
fzDN 19 0
Appl -/-, Vang +/ - 21 33%
fz clones 40 0
wild type dsh1 Appl -/-F
G H I
Vang-GFP PhalloidinAPPL Merge
J J’ J’’ J’’’
B C
D
HA-Vangl2
WB: HA
+
+ +
+-App
(C99)-Flag
WB: Flag
+
+ +
+-
IPHA
INPUT
HA-Vangl 2
dAppl -Flag
+
+ +
+-
-
+
+ +
+-
WB:
HA
WB: Flag
IP HA INPUT
+ - + + - +
- + + - + +
Appl -flag
Vang-myc
WB: flag
WB: myc
IP myc INPUT
HA-Vangl2 +
+ +
+-
-dAppl-Flag
+
+ +
+-
-
+
+ +
+-
WB:
HA
WB: Flag
INPUTIP HAIP FLAG
E
- + - + - + - +
Wnt 5a
100 ng/ml
MEFwt dKO +APP A +APP BA
WB: flag
WB: GFP
- + + - + +
+ - + + - +
APPL - flag
dFz - GFP
IP GFP INPUT
F
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#16 
 
 
Kriz  V1
,  Pospichalova  V1
,  Masek  J,  Kilander  MB,  Slavik  J,  Tanneberger  K,  Schulte  G, 
Machala M, Kozubik A, Behrens J, Bryja V. (2014): β‐arrestin promotes Wnt‐induced 
Lrp6 phosphorylation via increased membrane recruitment of Amer1. J Biol Chem. 289 
(2): 1128 –1141. 
1
 equal contribution 
 
 
Impact factor (2012): 4.651 
Times cited (without autocitations, WoS, Feb 21st 2014): 0 
Significance: This work explains how β‐arrestin, a Dvl‐binding protein, regulates Wnt/β‐
catenin  signaling.  This  question  has  been  puzzling  for  a  long  time  because  in 
contrast to non‐canonical Wnt pathway, where β‐arrestin regulates endocytosis, 
the  mechanism  of  action  in  canonical  Wnt  pathway  was  unknown.  We 
demonstrate that β‐arrestin via its interaction with the scaffolding protein Amer1 
mediates phophatidyl‐inositol phosphate‐controlled contact between Fzd/Dvl and 
Lrp6/Axin membrane complexes. 
Contibution of the author/author´s team: Full design, coordination and experimental 
parts  of  the  project  with  the  exception  of  lipid  analysis  and  some  FRAP 
validations. 
 
 
   
 
 
 
␤-Arrestin Promotes Wnt-induced Low Density Lipoprotein
Receptor-related Protein 6 (Lrp6) Phosphorylation via
Increased Membrane Recruitment of Amer1 Protein*□S
Received for publication,July 1, 2013, and in revised form, November 5, 2013 Published, JBC Papers in Press,November 21, 2013, DOI 10.1074/jbc.M113.498444
Víteˇzslav Krˇízˇ‡§1
, Vendula Pospíchalová‡1,2
, Jan Masˇek‡¶
, Michaela Brita Christina Kilanderʈ
, Josef Slavík**,
Kristina Tanneberger‡‡
, Gunnar Schulte‡ʈ3
, Miroslav Machala**, Alois Kozubík‡§
, Juergen Behrens‡‡4
,
and Víteˇzslav Bryja‡§5
From the ‡
Faculty of Science, Institute of Experimental Biology, Masaryk University, 611 37 Brno, Czech Republic, the §
Department
of Cytokinetics, Institute of Biophysics, Academy of Science of the Czech Republic, 612 65 Brno, Czech Republic, the
‡‡
Nikolaus-Fiebiger-Center, University of Erlangen-Nürnberg, 91054 Erlangen, Germany, the ʈ
Department of Physiology
and Pharmacology, Karolinska Institutet, 171 77 Stockholm, Sweden, the **Department of Toxicology, Pharmacology,
and Immunotherapy, Veterinary Research Institute, 621 00 Brno, Czech Republic, and the ¶
Institute of Molecular Genetics,
Academy of Science of the Czech Republic, 142 20 Prague, Czech Republic
Background: ␤-Arrestins are required for Wnt/␤-catenin signaling, but the mechanism of their action is unclear.
Results: ␤-Arrestins bind PtdInsP2-interacting protein Amer1, bind PtdInsP2-producing kinases, and control Wnt3a-induced
PtdInsP2 production and Amer1 membrane dynamics.
Conclusion: ␤-Arrestins bridge Wnt3a-induced Dvl-associated PtdInsP2 production to the phosphorylation of Lrp6 via control
of Amer1 dynamics.
Significance: The first mechanistic explanation how ␤-arrestin regulates Wnt/␤-catenin signaling is provided.
␤-Arrestin is a scaffold protein that regulates signal transduction
by seven transmembrane-spanning receptors. Among
other functions it is also critically required for Wnt/␤-catenin
signal transduction. In the present study we provide for the first
time a mechanistic basis for the ␤-arrestin function in Wnt/␤catenin
signaling. We demonstrate that ␤-arrestin is required
for efficient Wnt3a-induced Lrp6 phosphorylation, a key event
in downstream signaling. ␤-Arrestin regulates Lrp6 phosphorylation
via a novel interaction with phosphatidylinositol 4,5-bisphosphate
(PtdIns(4,5)P2)-binding protein Amer1/WTX/
Fam123b. Amer1 has been shown very recently to bridge Wntinduced
and Dishevelled-associated PtdIns(4,5)P2 production
to the phosphorylation of Lrp6. Using fluorescence recovery
after photobleaching we show here that ␤-arrestin is required
for the Wnt3a-induced Amer1 membrane dynamics and downstream
signaling. Finally, we show that ␤-arrestin interacts with
PtdIns kinases PI4KII␣ and PIP5KI␤. Importantly, cells lacking
␤-arrestin showed higher steady-state levels of the relevant
PtdInsP and were unable to increase levels of these PtdInsP in
response to Wnt3a. In summary, our data show that ␤-arrestins
regulate Wnt3a-induced Lrp6 phosphorylation by the regulation
of the membrane dynamics of Amer1. We propose that
␤-arrestins via their scaffolding function facilitate Amer1 interaction
with PtdIns(4,5)P2, which is produced locally upon
Wnt3a stimulation by ␤-arrestin- and Dishevelled-associated
kinases.
Wnt/␤-catenin signaling plays a key role in homeostasis and
embryonic development. Deregulation of Wnt/␤-catenin pathway
has been shown to cause pathophysiological conditions
such as developmental abnormalities, tumorigenesis, or osteoporosis
(1, 2). The Wnt/␤-catenin cascade is activated by Wnts,
which act as agonists for the class Frizzled (Fzd)6
receptors (3).
When extracellular Wnt is present, it links its receptor Fzd and
its co-receptor low density lipoprotein receptor-related protein
5 or 6 (Lrp5/6). Fzds bind Dishevelled (Dvl), which is required
for the Wnt-induced phosphorylation of the intracellular
domain (ICD) of Lrp5/6 (4, 5). Dvl and two Dvl-associated
kinases, phosphatidylinositol 4-kinase type II␣ (PI4KII␣) and
* This work was supported by Czech Science Foundation Grants 204/09/
0498,204/09/J030,andGA13-32990S;aEuropeanMolecularBiologyOrganization
(EMBO) installation grant; and Ministry of Education Youth and
Sport of the Czech Republic Grant MSM0021622430. The collaboration
between Masaryk University and Karolinska Institutet is supported by Project
KI-MU Grant CZ.1.07/2.3.00/20.0180.
Author’s Choice—Final version full access.
□S
This article contains supplemental Figs. 1 and 2.
1
Both authors contributed equally to this work.
2
Supported by a project co-financed by the European Social Fund and the
state budget of Czech Republic “Postdoc I,” Grant CZ.1.07/2.3.00/30.0009.
3
Supported by Knut and Alice Wallenberg Foundation Grant KAW2008.0149,
Swedish Research Council Grants K2008-68P-20810-01-4 and K2008-68K-
20805-01-4, and The Swedish Foundation for International Cooperation in
Research and Higher Education (STINT).
4
Supported by Deutsche Forschungsgemeinschaft Grant Be1550/6-1.
5
To whom correspondence should be addressed: Institute of Experimental
Biology, Faculty of Science, Masaryk University, Kotlárˇská 2, 611 37 Brno,
Czech Republic. Tel.: 420-549-49-3291; Fax: 420-541-21-1214; E-mail:
bryja@sci.muni.cz.
6
The abbreviations used are: Fzd, Frizzled; Apc, adenomatous polyposis coli;
␤-arr, ␤-arrestin; CK1, casein kinase 1; CM, conditioned medium; DKO, double
knock-out; Dvl, Dishevelled; EGFP, enhanced green fluorescent protein;
FRAP, fluorescence recovery after photobleaching; GSK3␤, glycogen
synthase kinase 3␤; ICD, intracellular domain; Lrp, low density lipoprotein
receptor-related protein; MEF, mouse embryonic fibroblast; PI4KII␣, phosphatidylinositol
4-kinase type II␣; PIP5KI␤, phosphatidylinositol-4-phosphate
5-kinase type I␤; PtdIns, phosphatidylinositol; PtdIns(4,5)P2, phosphatidylinositol
4,5-bisphosphate; TCL, total cell lysate.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 2, pp. 1128–1141, January 10, 2014
Author’s Choice © 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
1128 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
phosphatidylinositol-4-phosphate 5-kinase type I␤ (PIP5KI␤),
which produce phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2)
in two sequential steps from phosphatidylinositol
(PtdIns), were found to be crucial for Lrp5/6 phosphorylation
(6). PtdIns(4,5)P2 is recognized by Amer1/WTX, which links
PtdIns(4,5)P2 production with the machinery phosphorylating
Lrp5/6 (7). Phosphorylated Lrp5/6 subsequently recruits Axin1
(8), which is a key component of the ␤-catenin destruction
complex formed by the scaffolding proteins Axin1 and Apc
(adenomatous polyposis coli) and kinases GSK3␤ (glycogen
synthase kinase 3␤) and CK1␣ (casein kinase 1␣). As a consequence,
phosphorylation and subsequent proteosomal degradation
of ␤-catenin are blocked, ␤-catenin is stabilized in the
cytoplasm, and following translocation into the nucleus it
drives transcription of Wnt-responsive genes in cooperation
with the Tcf/Lef transcription factors (9–11).
Previous studies by us and others have demonstrated the key
role of ␤-arrestin (␤-arr) scaffolding protein in Wnt signaling
(for review, see Ref. 12). ␤-Arrestins were shown to be required
for Wnt/␤-catenin signaling (13, 14) as well as for branches of
Wnt signaling, which do not activate ␤-catenin (collectively
referred to as noncanonical Wnt pathways) (15–18). Whereas
in noncanonical Wnt signaling ␤-arrestins regulate signal
propagation via their well defined role in the clathrin-mediated
receptor endocytosis (17, 18), the mechanism how ␤-arrestins
control Wnt/␤-catenin signaling, which does not depend on
the clathrin-mediated endocytosis (19), is unclear.
In the present study we aimed to elucidate the role of ␤-arrestins
in the process of the Wnt/␤-catenin pathway activation.
We demonstrate that ␤-arrestin is a novel binding partner of
Amer1/WTX/Fam123b (further referred to as Amer1). We
show that ␤-arrestin binds PtdIns(4,5)P2-producing kinases
PI4KII␣/PIP5KI␤ and that it is required for PtdIns(4,5)P2-controlled
membrane dynamics of Amer1 upon Wnt3a stimulation.
This function of ␤-arrestin governs Wnt-induced Lrp6
phosphorylation. We propose that ␤-arrestins acts as a scaffold,
which brings Amer1 physically close to the site of Wnt3a-induced
PtdIns(4,5)P2 production.
EXPERIMENTAL PROCEDURES
Cell Culture and Transfection—HEK293T cells were cultured
in DMEM supplemented with 10% FBS, 2 mM L-glutamine,
50 units/ml penicillin and 50 units/ml streptomycin.
Cells were transfected with polyethyleneimine (PEI) as
described earlier (20). Briefly, working stocks of 25-kDa PEI
were prepared from commercially available PEI (40.872-7; Sigma-Aldrich)
by dilution 1:500 in PBS, pH was adjusted to 7.0,
and sterile stocks of PEI were stored for months in 4 °C. DNA
and stock PEI (1 ␮g:2.5 ␮l) were mixed in serum- and antibiotic-free
DMEM and incubated for 30 min. The transfection mixture
was then added dropwise to cells. Media were changed 3 h
after transfection. Cells were harvested 24–48 h after transfection.
For immunofluorescence experiments cells were transfected
using calcium phosphate method or using Lipofectamine
2000 (Invitrogen).
siRNA transfection was performed on 24-well plates. Each
transfection reaction contained 1 ␮l of Lipofectamine RNAiMAX
(Invitrogen), 30 ␮M siRNA, and 48 ␮l of serum-free medium. Following
the incubation for 20–30 min at room temperature the
mixture was added to the suspension of trypsinized cells (0.5
ml/well). The media were changed 6 h after transfection. Cells
were harvested 48 h after transfection.
Both wild type and ␤-arrestin1/2 DKO MEFs (21) were cultured
in DMEM supplemented with 10% FBS, 2 mM L-glutamine,
50 units/ml penicillin, and 50 units/ml streptomycin. The
NB4 cell line was cultured in RPMI 1640 medium supplemented
with 10% heat-inactivated FBS, 2 mM L-glutamine, 50
units/ml penicillin, and 50 units/ml streptomycin.
Plasmids, Antibodies, and siRNA—Plasmids encoding FLAGAmer1,
EGFP-Amer1, EGFP-Amer1 deletion mutants, EGFPLrp6-ICD-Amer1
(7, 22), HA-␤-arrestin2, FLAG-␤-arrestin2,
FLAG-␤-arrestin2 deletion mutants (14), FLAG-hDvl3 (23),
FLAG-hDvll1 (24), MYC-mDvl2 (25), EGFP-mDvl2 (16),
HA-PI4KII␣ and HA-PIP5KI␤ (6), SuperTOPFLASH and
SuperFOPFLASH Tcf/Lef (26) reporters were described earlier.
Renilla luciferase (pRL-TK) was purchased from Promega.
pEGFP-Amer1(2–838)-Lrp6-ICD was cloned by inserting
Lrp6-ICD (cut from the pEGFP-Amer1-Lrp6-ICD by NotI)
into a NotI site located between EGFP and Amer1(2–838) in
the pEGFP-Amer1(2–832) construct. Lef1-VP16 was kindly
provided by V. Korˇínek (IMG AS CR, Prague) and myristoylmCherry
by Jyrki Kukkonen.
The following antibodies were used: mouse anti-FLAG antibody
(F1804; Sigma-Aldrich), rat anti-GFP antibody (3H9; Chromotek),
mouse HA.11 (MMS-101R; Covance), rabbit anti-HA
(ab9110; Abcam), anti-Dvl3 (sc-8027; Santa Cruz Biotechnology),
anti-p(S1490)-Lrp6(2568;CellSignaling),anti-␤-catenin(610153;
BD Biosciences), anti-␤-actin (sc-1615; Santa Cruz Biotechnology),
anti-Myc antibody (sc-40; Santa Cruz Biotechnology), anti␣-catenin
(sc-7894; Santa Cruz Biotechnology) mouse antiAmer1
(27), rabbit anti-Amer1 (AP17838PU-N; Tocris), rabbit
anti-␤-arrestin (3857; Cell Signaling), anti-␤-arrestin (A1CT and
A2CT), a kind gift from R. J. Lefkowitz), rabbit anti-PI4KII (a kind
gift from P. De Camilli), and rabbit anti-IgG control antibody
(3900; Cell Signaling). siRNA sequences targeting ␤-arrestin1/2
(15) and PI4KII (6) were described earlier.
Fluorescence Recovery after Photobleaching (FRAP)—Thirtyfive-mm
glass-bottom dishes (MatTek) were precoated with
0.1% collagen. MEFs were transfected in suspension with 1.6 ␮g
of EGFP-Amer1 or EGFP-Amer1(2–838) plasmid using
DreamFect Gold (OZ Bioscience) according to the protocol
recommended by the supplier and plated on the dish. FRAP
analysis was carried out 24 h after transfection as described
earlier (7) on a Zeiss LSM710 scanning microscope.
Immunoprecipitation and Western Blotting—Immunoprecipitation
of overexpressed proteins in HEK293T cells was performed
at 4 °C as described previously (28). Briefly, confluent
10-cm dishes were lysed and scraped 24 h after transfection in 1
ml of Nonidet P-40 lysis buffer (50 mM Tris, pH 7.4, 150 mM
NaCl, 1 mM EDTA, 0.5% Nonidet P-40) supplied with 0.1 mM
DTT and 1ϫ Complete protease inhibitor mix (11836145001;
Roche Applied Science). Lysates were spun down (16,000 ϫ g,
10 min, 4 °C). Similarly, protein extracts were prepared from
T75 flasks of NB4 cells for immunoprecipitation of endogenous
proteins. The total protein concentration was determined using
DCTM
Protein Assay (500-0112; Bio-Rad). Sixty ␮g were used
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1129
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
as total cell lysate (TCL), 1 mg of the lysate was mixed with 1 ␮g
of the immunoprecipitating antibody (anti-FLAG (F1804;
Sigma), anti-GFP (20R-GR011; Fitzgerald), anti-HA (ab9110;
Abcam), rabbit anti-␤-arrestin (3857; Cell Signaling), anti-␤arrestin
(A1CT and A2CT), or IgG control antibody (3900; Cell
Signaling)) and kept rotating on a carousel at 4 °C. Fifteen ␮l of
solid protein G-Sepharose beads (17-0618-05; GE Healthcare)
were added to each reaction 30 min after the addition of antibodies.
Test tubes were placed on the carousel overnight at
4 °C. The next day, beads were collected by spinning down at
100 ϫ g for 1 min at 4 °C and washed six times with the lysis
buffer. Immunoprecipitation and TCL samples were mixed
with denaturing reducing Laemmli buffer, boiled, and if necessary
also sonicated before loading on the SDS-PAGE. The proteins
were separated according their molecular mass on 8–15%
SDS-PAGE and transferred to an Immobilon-P membrane
(Millipore). When required Western blots were quantified by
densitometry analysis using ImageJ software.
Immunofluorescence Microscopy—Cell were transfected a
day after plating on 0.1% collagen-precoated coverslips. Twenty
four h after the transfection, cells were washed with PBS and
fixed with 4% formaldehyde in PBS. Cells were washed in PBS
and blocked in PBTA (1ϫ PBS, 5% BSA, 0.25% Triton X-100,
0.01% NaN3) and incubated with the primary antibody overnight
(4 °C). Cells were then washed three times with PBST (1ϫ
PBS, 0.1% Triton X-100) and incubated for 1 h with the secondary
antibody conjugated with Alexa Fluor dye 594 or 647 (Invitrogen).
Cells were washed three times with PBST, incubated
with DAPI (1 ␮g/ml in PBST) for 10 min, and washed once in
PBST. PBST was replaced with PBS, and glass coverslips were
mounted with glycerol gelatin mix (079K6006; Sigma) and
stored in the dark at 4 °C until scanning. Microscopy was performed
on a Zeiss LSM710 laser scanning microscope or sp5
confocal microscope (Leica). Quantification of co-localization
is shown as a graph of the overlap of fluorescence intensity
peaks of individual channels along profiles indicated in the
merged micrographs (Zen software - Zeiss in Fig. 2 and LAS AF
software (Leica) in Fig. 6).
Dual Luciferase Assay—Dual luciferase assay was carried out
in HEK293T cells. Cells were transfected on 24-well plates.
Transfected cells were analyzed 24 (plasmid DNA) or 48–72
(siRNA) h after transfection according to a slightly modified
protocol recommended by the supplier (E1960; Promega).
Briefly, culture medium was removed, and cells were washed
with PBS. Each well was lysed for 15 min at room temperature
in 50 ␮l of lysis buffer. To measure firefly luciferase activity 20
␮l from each well was pipetted into a microtiter plate and mixed
with 25 ␮l of luciferase substrate. Luminescence was immediately
measured with a Microtiter Plate Luminometer. The signal
was normalized to Renilla luciferase activity, which was
measured after addition of 25 ␮l of Stop and Glo mix. Graphs
represent averages Ϯ S.E. of fold changes in relative luciferase
units (ratio luciferase/Renilla) over the control condition.
Membrane Fractionation—Membrane fractions were prepared
from MEFs using a ProteoJET Membrane Protein Extraction
kit (K0321; Fermentas) down-scaled for 6-well plate format.
Briefly, cells were stimulated with Wnt3a (50 ng/ml), or
alternatively the cells were treated only with an equal volume of
0.1% BSA in PBS used for dilution of Wnt3a. After 1 h of treatment,
medium was removed and replaced with 1 ml of Cell
Wash Solution. Each well was treated with 700 ␮l of ice-cold
permeabilization buffer supplemented with 1 mM DTT, 10 mM
NaF, and 1ϫ Complete protease inhibitor mixture. Plates were
slowly shaken on ice for 10 min. Cells were scraped and spun
down at 16,000 ϫ g, 15 min, 4 °C. Supernatant was used for
membrane fractionation. Pellet was mixed with 60 ␮l of Membrane
Protein Extraction Buffer and vortexed at 1200 rpm, 30
min, 4 °C. Tube content was spun down at 16,000 ϫ g, 15 min,
4 °C. The membrane fraction was present in the supernatant.
Membrane and cytoplasmic fractions of NB4 cells were prepared
using Subcellular Protein Fractionation kit for Cultured
Cells (78840; Thermo Scientific) according to the manufacturer’s
recommendations. In short, NB4 cells were stimulated with
Wnt3a conditioned (or control) media produced in L-cells for
2 h, spun down at 200 ϫ g, 5 min, 4 °C, washed in ice-cold PBS
and Wash cells by suspending the cell pellet with ice-cold PBS.
One ml of ice-cold cytoplasm extraction buffer containing
Complete protease inhibitor mixture was added to the cell pellet,
and the tube was incubated at 4 °C for 10 min with gentle
mixing. The supernatant cytoplasmic extract was gathered
after centrifugation at 500 ϫ g for 5 min. Next, ice-cold membrane
extraction buffer containing Complete protease inhibitor
mixture was added to the pellet. The tube was vortexed for 5 s
on the highest setting and incubated at 4 °C for 10 min with
gentle mixing. The supernatant (membrane extract) was collected
by centrifugation at 3000 ϫ g for 5 min. The total amount
of protein was determined in each fraction by DC Protein
Assay, and the extracts were subjected to immunoprecipitation
and/or analyzed using Western blotting.
Phospholipid Species Analysis by Tandem Mass Spectrometry
(MS)—Wild type and ␤-arrestin1/2 DKO MEFs seeded onto
150-mm plates were treated with Wnt3a conditioned (or control)
media produced in L-cells and harvested into 3-ml icecold
methanol 2 h later. Lipid extraction was performed by
modified Bligh/Dyer extraction protocol. Briefly, the cell pellet
was transferred by 3.0 ml of methanol into glass tubes (20 ϫ 110
mm). The tubes were previously strongly sulfuric acid
degreased and ethanol washed. After adding of 1.5 ml of chloroform
and 50 ␮l of HCl (30%), the content was dispersed using
probe sonicator at room temperature. The extraction process
was continued by a 1-h incubation in an ice water bath. The
above mentioned monophase extraction system was broken by
the addition of 1.5 ml of chloroform and 2.5 ml of HCl (0.1 M).
The samples were vigorously shaken for 1 min and subsequently
centrifuged at 5000 ϫ g for 60 min until two phases
become clearly visible. The upper phase was carefully removed,
and the lower organic phase was dried by nitrogen. Solvent
mixture A (chloroform/methanol/water/glacial acetic acid/
ammonium acetate solution 60:30:1:1:1 v/v) in a volume of 300
␮l was used for reconstitution and the next mass spectrometric
analysis using liquid chromatograph (Agilent 1200, Santa Clara,
CA)-coupled mass spectrometer TripleQuand 6410 with electrospray
ionization (Agilent).
Tandem MS conditions were as follows: (i) direct infusion to
mobile phase; (ii) sample volume 100 ␮l, mobile phase flow rate
20 ␮l/min, mobile phase:solvent mixture A; (iii) electrospray
␤-Arrestin Controls Lrp6 Phosphorylation
1130 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
ionization in positive mode, drying nitrogen flow 6 liters/min,
fragmentor voltage and collision energy voltage optimized for
each lipid group, neutral loss scan modes (m/z 277 for PtdIns
lipid species, m/z 357 for PtdInsP lipid species, m/z 437 for
PtdInsP2 lipid species). The amounts of selected PtdInsP lipid
species, based on corresponding signal peak area, were normalized
to the total PtdInsP amount in the sample.
RESULTS
Amer1 Is a Novel Interaction Partner of ␤-Arrestin2—It
has been shown earlier that the scaffold protein ␤-arrestin is
a necessary component of the Wnt/␤-catenin signaling
pathway and a direct interactor of Dvl (13, 14). However, it is
not clear how ␤-arrestin regulates Wnt signal transduction.
To clarify this issue we have searched for high affinity physical
interactions between ␤-arrestin and the conserved components
of the Wnt signaling pathway. We have taken an
advantage of the currently published study, which employed
tandem affinity purification and mass spectrometry to map
binding partners of 20 key components of the Wnt signaling
pathway (29). Among the tested proteins only Wilms tumorassociated
protein Amer1 co-precipitated with endogenous
␤-arrestin2. We have decided to confirm this interaction
with the co-immunoprecipitation assay. As we show in Fig.
1A, overexpressed Amer1 and ␤-arrestin2 efficiently co-precipitated
with each other.
Moreover, Amer1 and ␤-arrestin2 interaction was detected
also on endogenous level in the NB4 cell line of acute promyelocytic
leukemia origin (Fig. 1B). This cell line was chosen
using the Oncomine database as a suitable candidate having
high expression levels of both Amer1 and ␤-arrestin2. First, we
checked that this cell line is Wnt3a-responsive and found that
Wnt3a conditioned medium (CM) stimulates Lrp6 phosphorylation
at Ser-1490, a hallmark of Wnt/␤-catenin signaling
(Fig. 1B, left panel). Furthermore, we detected that upon Wnt3a
stimulation Amer1 gets recruited to the cytoplasmic membrane
and/or associates more tightly with the cytoplasmic
membrane (Fig. 1B, left panel) of NB4 cells. This protein
dynamics is similar to what has been described in other cell
lines (7). Endogenous immunoprecipitation in NB4 cells
showed that Amer1 co-immunoprecipitated with two of three
anti ␤-arrestin antibodies (Fig. 1B, right panel).
To define the regions of individual proteins responsible for
the interaction we have performed co-immunoprecipitation
assays with the EGFP-tagged deletion mutants of Amer1 and
FLAG-tagged deletion mutants of ␤-arrestin2. These experiments
revealed that it is the very C-terminal part of Amer1
(amino acids 942–1135) that is required for the interaction with
␤-arrestin (Fig. 1C and supplemental Fig. 1, A and B). On the
side of ␤-arrestin, we can demonstrate that full-length Amer1
binds the central pocket of ␤-arrestin2, which is defined by
amino acids 163–300 (Fig. 1D and supplemental Fig. 1C).
Finally, the interaction of these two short regions of Amer1 and
␤-arrestin2 can be demonstrated by an efficient co-immunoprecipitation
of Amer1 (amino acids 942–1135) and ␤-arrestin
(amino acids 163–300) (Fig. 1E).
Amer1/␤-Arrestin2 Co-localization in the Plasma Membrane
Is Disrupted by Dvl—Our findings show that Amer1 and
␤-arrestin2 efficiently interact with each other. In the next step
we asked where in the cell this interaction takes place. We overexpressed
FLAG-tagged Amer1 and EGFP-tagged ␤-arrestin2
in HEK293T cells and analyzed their subcellular localization by
immunofluorescence. This analysis showed that Amer1 and
␤-arrestin2 co-localize in the proximity of the cell membrane
(Fig. 2A). Importantly, it has been shown earlier that Dvl,
another key signaling molecule in the Wnt pathway, binds, similarly
to Amer1, the central part of ␤-arrestin2 (14). This observation
opened the possibility that binding of Amer1 and Dvl to
␤-arrestin2 can be mutually exclusive, and ␤-arrestin2 is either
present in complex with Amer1 or with Dvl. To test this possibility,
we overexpressed Amer1, Dvl2, and ␤-arrestin2 and analyzed
the effect of Dvl2 on the co-localization of Amer1 and
␤-arrestin2. As we show in Fig. 2B (in contrast to Fig. 2A), Dvl2,
which is localized in the typical dots composed of Dvl2 multimers
(30, 31), efficiently prevented membrane localization of
␤-arrestin2 and recruited ␤-arrestin2 to Dvl2 dots. However,
the membrane localization of Amer1 was not affected. To support
this observation biochemically, we have analyzed the
mutual binding of Amer1 and ␤-arrestin2 in the presence of
Dvl1, Dvl2, and Dvl3 by co-immunoprecipitation. As shown in
Fig. 2C and supplemental Fig. 2, inclusion of Dvl3 completely
and inclusion of Dvl1 and Dvl2 partially abolished the binding
of Amer1 to ␤-arrestin2. These observations suggest that binding
of Amer1 and Dvl to the central region of ␤-arrestin2 is
competitive and that Dvl has the capacity to interfere with the
interaction of Amer1 to ␤-arrestin2.
␤-Arrestin Regulates Lrp6 Phosphorylation and the Activity of
Lrp6-ICD-Amer1 Fusion Protein—It has been shown recently
that Amer1 has a positive role in the Wnt3a-induced phosphorylation
of Lrp6. Amer1 links Dvl-associated PtdIns(4,5)P2
production to the formation of Axin-GSK3␤-CK1␥ complexes
required for the phosphorylation and activation of the Lrp6
receptor (7). Our next goal was to clarify whether or not ␤-arrestin
has a role in this Amer1-mediated process. Importantly,
the analysis of ␤-arr1/2 DKO MEFs demonstrates that endogenous
␤-arrestin is required for the efficient Lrp6 phosphorylation
at Ser-1490 triggered by Wnt3a (Fig. 3A). These observations
demonstrate that ␤-arrestin is required for the Lrp6 phosphorylation.
In the next step we therefore tested whether or not
␤-arrestins regulate Lrp6 phosphorylation via regulation of the
Amer1 function.
It is known that membrane targeting of Lrp6 ICD is absolutely
crucial to trigger the downstream signaling by Lrp6-ICD.
The cytoplasmic ICD of Lrp6 alone shows no activity (Fig. 3B,
first bar) in the Tcf/Lef-dependent transcription luciferase
reporter assay (TOPFLASH, (32)), which serves as a convenient
readout of the activity of Wnt/␤-catenin signaling in cultured
cells. (In contrast when Lrp6-ICD is membrane-targeted due to
the presence of the transmembrane domain (Lrp6-ICD/TM) it
becomes constitutively active (Fig. 3B, second bar). Amer1 can
mediate membrane targeting via its PtdIns(4,5)P2 binding
domains, which are responsible for both Amer1 membrane
recruitment and Amer1 activity in the Wnt/␤-catenin pathway
(7). Not surprisingly, the fusion protein of Lrp6-ICD and
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1131
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
Amer1 (Lrp6-ICD-Amer1) (7) acted as a strong activator of
TOPFLASH (but not its negative control counterpart FOPFLASH)
(Fig. 3B, third bar). The activity of Lrp6-ICD-Amer1
was dependent on PtdIns(4,5)P2 because PtdIns(4,5)P2 depletion
by ionomycin, which induced release of intracellular Ca2ϩ
stores and subsequent cleavage of PtdIns(4,5)P2 by Ca2ϩ
activated
phospholipase C, (i) resulted in the translocation of
EGFP-Amer1, but not an unrelated mCherry protein bound to
membrane via a myristoyl anchor, from the membrane to the
cytoplasm (Fig. 3C) and (ii) at the same time dose-dependently
reduced the TOPFLASH reporter activity triggered by the
Lrp6-ICD-Amer1 fusion protein (Fig. 3D), whereas the TOPFLASH
activity induced by a constitutively active form of Lef1
(Lef1-VP16) remained unchained (Fig. 3E).
Together, these experiments suggest that the activity of Lrp6ICD-Amer1
is based on PtdIns(4,5)P2-dependent membrane
recruitment of Amer1. This allowed us to use the Lrp6-ICDAmer1
fusion as the readout to analyze the role of ␤-arrestin in
PtdIns(4,5)P2-mediated Amer1 membrane recruitment in the
context of the Wnt/␤-catenin signaling. Using this system we can
FIGURE 1. Amer1 interacts with ␤-arrestin2. A, HEK293T cells were transfected with FLAG-Amer1 and HA-␤-arrestin2 individually or together as
indicated. Cell lysates were immunoprecipitated (IP) with anti-FLAG or anti-HA antibody. Immunoblotting (WB) was done with mouse M2 anti-FLAG
antibody and with mouse anti-HA antibody. TCL was used as a loading control. B, NB4 cells were stimulated for 2 h with Wnt3a (or control) CM, and
cytoplasmic and membrane fractions were harvested. Left panel, NB4 cells are Wnt3a-responsive as shown by the enhanced Lrp6 phosphorylation at
Ser-1490. Both Amer1 and ␤-arrestin2 are isolated preferentially in the cytoplasmic fraction. However, upon Wnt3a stimulation, Amer1 is recruited to the
membrane and/or associates more tightly with the membrane and is therefore isolated also in the membrane fraction of NB4 cells. Right panel, Amer1
co-immunoprecipitated with A1CT and A2CT anti ␤-arrestin antibodies, but not with anti-IgG control antibody and anti-␤-arrestin2 cs-3857 antibody,
which poorly precipitates endogenous ␤-arrestin2. C, domain mapping of the Amer1/␤-arrestin2 interaction using full-length ␤-arrestin2 and deletion
mutants of Amer1 shows schematic view of Amer1 mutants. The interaction with ␤-arrestin2 is indicated with ϩ; M1/M2 indicate regions interacting
with membrane via PtdIns(4,5)P2; A1/A2/A3 are regions required for the interaction with Apc. Full blots are shown in supplemental Fig. 1, A and B. D,
domain mapping of the Amer1/␤-arrestin2 interaction uses full-length Amer1 and deletion mutants of ␤-arrestin2. The mutual interaction is indicated
with ϩ. Full blots are shown in supplemental Fig. 1C. E, the interaction between the C-terminal region of Amer1 (amino acids 942–1135) and the central
part of ␤-arrestin2 is demonstrated by co-immunoprecipitation.
␤-Arrestin Controls Lrp6 Phosphorylation
1132 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
demonstrate that expression of ␤-arrestin2 promoted (Fig. 4A),
whereas knockdown of ␤-arrestin1/2 decreased (Fig. 4B)
TOPFLASH activation by Lrp6-ICD-Amer1. These observations
are compatible with the possibility that ␤-arrestin modulates the
PtdIns(4,5)P2-dependent membrane recruitment of Amer1. The
positive effect of ␤-arrestin2 on the Lrp6-ICD-Amer1-induced
TOPFLASH activity is not due to interference with the downstream
signaling events because ␤-arrestin2 overexpression failed
to further promote TOPFLASH activation by the constitutively
active Lrp6-ICD/TM (Fig. 4C).
␤-Arrestin Is Required for Wnt3a-induced Amer1 Membrane
Dynamics—We have shown previously that Wnt3a stimulation
leads to the increase in the immobilized, likely PtdIns(4,5)P2bound,
Amer1 fraction in the plasma membrane (7). We have
FIGURE 2. Co-localization of Amer1 and ␤-arrestin2 in the proximity of cell membrane is disrupted by Dvl2. A and B, top, confocal microscopy images of
HEK293Tcellsco-transfectedwiththeindicatedplasmids,fixed,andstainedwiththerelevantantibodies.Bottom,overlapoffluorescenceintensitypeaksalong
profiles indicated in the merged micrographs by a white line. White arrowheads indicate cell membrane position. A, FLAG-Amer1 (red) and EGFP-␤-arrestin2
(green) co-localizing (yellow) at the plasma membrane. B, MYC-Dvl2 (gray) abolishing the co-localization between Amer1 (red)/␤-arrestin2 (green) and recruiting
␤-arrestin2 to Dvl dots. C, HEK293T cells transfected with HA-␤-arrestin2, FLAG-Amer1, and EGFP-Dvl2. The interaction of individual proteins was analyzed
using co-immunoprecipitation. The efficient interaction between ␤-arrestin2 and Amer1 is partially abolished by Dvl2 protein.
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1133
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
applied FRAP to test whether Amer1 membrane stabilization
requires ␤-arrestin. Wild type (WT) and ␤-arr1/2 DKO MEFs
were transfected with Amer1-EGFP-tagged protein and subjected
to FRAP essentially as described previously (7). As we
show in Fig. 5, Amer1-EGFP is predominantly membranous in
both WT (Fig. 5A) and ␤-arr1/2 DKO (Fig. 5B) fibroblasts.
FIGURE 3. ␤-Arrestin2 mediates Lrp6 phosphorylation by the regulation of Amer1 membrane recruitment. A, wild type (WT) or ␤-arrestin-deficient (␤-arr1/2
DKO)MEFswerestimulatedwithrecombinantmouseWnt3a(ordiluentcontrol).TheanalysisofphosphorylatedLrp6(atSer-1490)inthemembranefractionsshows
that the activation of Lrp6 is attenuated in ␤-arr1/2 DKO MEFs. ␣-Catenin was used as the loading control. B, schematic represents various Lrp6 ICD-containing
constructs and their activity in the Tcf/Lef reporter assay (TOPFLASH activity). TM, transmembrane domain; LRP6-ICD-Amer1, fusion of Amer1 and Lrp6 ICD). The
Tcf/Lef-responsive(orWnt-responsive)constructpTOPFLASHencodesfireflyluciferasereportergeneunderthecontrolofaminimalpromoterandmultiplecopiesof
the optimal Tcf-binding motif CCTTTGATC. The negative control (Wnt-nonresponsive) construct pFOPFLASH harbors multiple copies of the mutant motif CCTTTGGCC.
Each transfection is accompanied with constitutively expressing Renilla luciferase construct, which serves as an internal control for normalizing transfection
efficienciesandmonitoringcellviability.GraphsrepresentaveragesϮS.E.(errorbars)of-foldchangesinrelativeluciferaseunits(luciferasecounts/Renillacounts)over
thecontrolcondition.C,timelapseimagesshowHEK293TcellstransfectedwithEGFP-Amer1ormyristolatedmCherryandtreatedwithionomycin.Top,EGFP-Amer1
is predominantly membranous (t ϭ Ϫ20 s) but within 40 s after application of ionomycin (added at t ϭ 0 s), which depletes intracellular PIP2 via PKC-dependent
pathway, it translocates to the cytoplasm. Bottom, ionomycin does not alter distribution of a mCherry protein bound to membrane via its myristoyl anchor. In both
experiments, GFP and mCherry photobleaching was software-controlled. D and E, HEK293T cells were transfected with the indicated plasmids and treated with
ionomycin.Tcf/Lef-dependenttranscriptionalactivitywasdeterminedbyTOPFLASHreportersystem.ThereporteractivityofLrp6-ICD-Amer1isdependentonPIP2 as
demonstrated by treatment with increasing doses of ionomycin (D), which depletes PIP2 via a PKC-dependent pathway. However, ionomycin does not affect Lef1VP16
(constitutively active form of Lef1)-driven TOPFLASH reporter expression (E).
␤-Arrestin Controls Lrp6 Phosphorylation
1134 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
When we performed FRAP (exampled by two small squares in
membrane regions and one control region outside the cell in
Fig. 5, A and B) we have not observed any difference between
WT and DKO fibroblast in the mobile pool of Amer1 (71.9%
in WT and 72.1% in ␤-arr1/2 DKO MEFs) in the unstimulated
conditions (Fig. 5, A and B, right panel). However, following
Wnt3a stimulation the mobile pool of Amer1 in WT fibroblasts
decreased to 58.2%, which is similar to the results, which we
observed earlier in HEK293T cells (7). Interestingly, after
Wnt3a stimulation ␤-arr1/2 DKO MEFs completely failed to
FIGURE 4. ␤-Arrestin2 promotes Tcf/Lef transcriptional activity of Lrp6-ICD-Amer1 fusion protein. A–C, top, HEK293T cells were transfected with the
indicated combinations of plasmids and siRNA. Tcf/Lef-dependent transcriptional activity was determined by TOPFLASH/FOPFLASH reporter system. Bottom,
Western blots (WB) of expression levels of the indicated proteins or effective knockdown or overexpression of ␤-arrestin are shown in each condition. Lrp6
fusion proteins are N-terminally EGFP-tagged, and ␤-arrestin2 is FLAG-tagged. A, ␤-arrestin2 promotes the TOPFLASH activity of Lrp6-ICD-Amer1. B, depletion
of ␤-arrestin1/2 by siRNA reduces the transcriptional activity of Lrp6-ICD-Amer1. C, ␤-arrestin2 does not affect TOPFLASH activity of the constitutively active
(ca) Lrp6 (Lrp6-ICD/TM). pcDNA3 was used as a control plasmid. Data are from at least five independent replicates. ***, p Ͻ 0.001 (one-way analysis of variance,
Tukey’s post test). Error bars, S.E.
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1135
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
regulate the mobile pool of Amer1, which only slightly
increased to 75% (Fig. 5B, right panel). Moreover, the
Amer1(2–838) deletion variant, which lacks the C terminus of
Amer1 responsible for the interaction with ␤-arrestin, showed
higher mobility demonstrated by a shorter recovery halftime
(approximately 5 s compared with 10 s in the full-length
Amer1) and a higher mobile fraction (approximately 80%) (Fig.
5C). Most importantly, Wnt3a stimulation was unable to
FIGURE 5. Analysis of Amer1 membrane dynamics in the presence and absence of ␤-arrestin in MEF cells reveals requirement of the interaction
between Amer1 and ␤-arrestin for Wnt3a-induced Amer1 dynamics. A–C, WT and ␤-arr1/2 DKO MEFs were transfected with EGFP-Amer1 (A and B) or
EGFP-Amer1(2–838) (C), and membrane dynamics of the constructs were analyzed by the FRAP method. Examples of cells subjected to FRAP are given on the
left, squares indicate bleached regions. On the right, statistical analysis of FRAP experiment using WT and ␤-arr1/2 DKO MEFs stimulated with PBS or Wnt3a is
shown. The graphs show mean values Ϯ S.E. (error bars), and the best fitting curve model, which was used for calculation of mobile pool of EGFP-Amer1
(percentage of fluorescence recovered) and of the recovery halftime (t1/2). N, number of analyzed cells. Wnt3a is unable to regulate Amer1 dynamics in the
absence of ␤-arrestin and in the case of Amer1(2–838) construct, which lacks the ␤-arrestin interaction domain. D, levels of PtdIns-P in WT and DKO MEFs
stimulated with Wnt3a CM were measured by mass spectrometry. The level of selected PtdInsP was increased by Wnt3a and by the absence of ␤-arr. Note the
lack of Wnt3a-induced dynamics in ␤-arr1/2 DKO MEFs. The individual lipid species from the PtdInsP pool (Total) are shown separately. n ϭ 3. ***, p Ͻ 0.05
(one-way analysis of variance, Tukey’s post test).
␤-Arrestin Controls Lrp6 Phosphorylation
1136 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
change the membrane dynamics of Amer1(2–838) (Fig. 5C,
blue line), which suggests that Wnt3a-triggered Amer1 membrane
recruitment and/or Amer1 mobility within the membrane
requires physical interaction with ␤-arrestin.
To further analyze the role of ␤-arrestin in the PtdIns phosphate
metabolism, we directly measured the levels of PtdIns,
PtdInsP, and PtdInsP2 in WT and ␤-arr1/2 DKO MEFs stimulated
with control or Wnt-3a CM. Mass spectrometry-based
analysis (for details, see “Experimental Procedures”) identified
numerous PtdIns-based lipid species. Some of these species
(containing the following combination of fatty acids: palmitic/
oleic, stearic/linoleic, stearic/oleic, stearic/arachidonic, and
stearic/h-linoleic) were detected repeatedly as PtdIns, PtdInsP,
and PtdInsP2, which suggests that they are subject of phosphorylation
by PI and PIP kinases. Interestingly, in these lipid species
we have observed (i) Wnt3a-induced increase of PtdInsP
and (ii) increase in the steady-state levels of PtdInsP in ␤-arr1/2
DKO MEFs (Fig. 5D). These data suggest that the defects in the
dynamic Wnt3a-induced phosphorylation of PtdIns are compensated
by an increase in the level of PtdInsP. Of note, lack of
Wnt3a-induced dynamics accompanied by an increased
steady-state amount, which is reminiscent with this phenotype,
has been observed in ␤-arr1/2 DKO MEFs for the levels of
TOPFLASH activity and of phosphorylated Dvl (14). In summary,
the analysis of PtdInsPs is compatible with the possibility
that the ␤-arr1/2 DKO MEFs are unable to respond dynamically
to Wnt-3a treatment by formation of PtdInsPs and compensate
for this deficit by increased steady-state levels of relevant
PtdInsPs.
PI4KII␣ and PIP5KI␤ Kinases Bind ␤-Arr2 and Promote
Amer1⅐␤-Arr2 Complex Formation—It has been shown that the
local PtdIns(4,5)P2 synthesis triggered by Wnt3a is mediated by
sequential action of two Dvl-associated kinases, PI4KII␣ and
PIP5KI␤ (6, 33). Moreover, a closely related PIP5KI␣ was found
to interact with ␤-arrestin2 (34). We thus hypothesized that
␤-arrestins, which serve as scaffold proteins, may facilitate the
signal transduction by recruiting Amer1 close to the source of
PtdIns(4,5)P2 synthesis by their interaction with PtdIns(4,5)P2FIGURE
6. PI4KII␣ and PIP5KI␤ kinases bind to ␤-arrestin2 and co-localize with ␤-arrestin2 and Amer1 in the membrane. A and B, HEK293T cells were
transfected with FLAG-␤-arrestin2 and HA-PI4KII␣ or HA-PIP5KI␤ individually or in combination. Cell lysates were immunoprecipitated (IP) with anti-FLAG
antibody and anti-HA antibodies, and the composition of immunoprecipitates was analyzed by Western blotting. C, endogenous Amer1 and PI4KII␣ were
co-immunoprecipitated with anti ␤-arrestin antibodies in the cytoplasmic fraction of NB4 cells. D and E, HEK293T cells were transfected with HA-PI4KII␣ (D) or
HA-PIP5KI␤ (E), and EGFP-␤-arrestin2 and the subcellular localization of individual proteins were analyzed by immunocytofluorescence (left panel). EGFP-␤arrestin2
and endogenous Amer1 (stained with rabbit anti-Amer1 antibody) co-localize with PI4KII␣/PIP5KI␤ in the membrane compartment. Right, panels
show the overlap of fluorescence intensity peaks of individual channels along profiles indicated in the merged micrographs by a white line. Black arrowheads
indicate cell membrane position.
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1137
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
producing kinases. As we demonstrate in Fig. 6, A and B, both
PI4KII␣ and PIP5KI␤ strongly interacted with ␤-arrestin2
physically in the co-immunoprecipitation assay. On the endogenous
level, we were able to co-immunoprecipitate not only
Amer1 but also PI4kII␣ (Fig. 6C) with anti-␤-arrestin antibodies
in the cytoplasmic fraction of NB4 cells. Furthermore, both
kinases also co-localized with ␤-arrestin2 and endogenous
Amer1 with the most prominent co-localization observed at
the membrane (Fig. 6, D and E).
Interestingly, when we blocked PtdIns(4,5)P2 production by
PI4KII␣ knockdown the interaction between Amer1 and ␤-arrestin2
significantly decreased (Fig. 7A). On the contrary, overexpression
of either PI4KII␣ or PIP5KI␤, which increases the
levels of PtdIns(4,5)P2 (35), strongly promoted the interaction
between Amer1 and ␤-arrestin (Fig. 7B). Both PI4KII␣ and
PIP5KI␤ were found in the ␤-arrestin2 pulldown together with
Amer1. In contrast, overexpression of Dvl3 almost completely
inhibited the interaction of ␤-arrestin2 with PI4KII␣ and
PIP5KI␤ (Fig. 7C), which is very reminiscent of the Dvl effect on
the ␤-arrestin2⅐Amer1 complex (see Fig. 2). Of note, this analysis
also demonstrated that ␤-arrestin2 has higher affinity for
PI4KII␣ (Fig. 7C, compare third and fourth lanes), whereas
Dvl3 binds efficiently mainly to PIP5KI␤ (Fig. 7B, compare fifth
and sixth lanes). Taken together, these protein-protein interaction
data suggest (i) that ␤-arrestin and Amer1 can physically
interact with the PtdIns(4,5)P2-producing kinases PI4KII␣ and
PIP5KI␤, (ii) that PtdIns(4,5)P2 production triggers and is
required for the efficient interaction of Amer1 and ␤-arrestin,
and (iii) that the complex of Amer1⅐␤-arr2/PI-kinase can be
disrupted by Dvl3.
DISCUSSION
In the present study we show for the first time that ␤-arrestins
regulate Wnt3a-induced Lrp6 phosphorylation by the regulation
of membrane recruitment and of the dynamics of
Amer1. We propose that ␤-arrestin2 functionally links Fzdassociated
(Fzd-Dvl-PI4KII-PIP5KI) and Lrp5/6-associated
(Amer1-Axin-GSK3␤-CK1␥) complexes, which are both
required for the efficient downstream signaling induced by
Wnt3a.
Phosphorylation of Lrp5/6 represents a key event required
for downstream signaling leading to the stabilization of
FIGURE 7. PI4KII␣ and PIP5KI␤ kinases control the interaction between ␤-arrestin2 and Amer1. A–C, HEK293T cells were transfected with the indicated
plasmids and siRNAs. Interaction of individual proteins with ␤-arrestin2 was analyzed by anti-tag immunoprecipitation. Depletion of PI4KII␣ by siRNA prevents
(A) whereas overexpression of PI4KII␣ promotes (B) efficient interaction of ␤-arrestin2 and Amer1. Numbers above blots represent the quantification of the
signal by densitometry relative to the respective control condition which was set as 1. C, the interaction of ␤-arrestin2 with PI4KII␣/PIP5KI␤ kinases is
completely abolished by the overexpression of Dvl3.
␤-Arrestin Controls Lrp6 Phosphorylation
1138 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
␤-catenin and subsequent Tcf/Lef-driven transcription (8).
The current model of Lrp5/6 phosphorylation pinpointed the
key role of PtdIns(4,5)P2 as the required signal mediators,
which transduce signal between Fzd/Dvl and Lrp6. Two Dvlassociated
kinases, PI4KII␣ and PIP5KI␤, which together in
two sequential steps produce PtdIns(4,5)P2, were found to be
crucial for Lrp5/6 phosphorylation (6). We have shown recently
that the scaffold protein Amer1 (27), also known as WTX (36),
which was first described as the negative regulator of the Wnt
signaling (36), facilitates Wnt3a-induced Lrp6 phosphorylation
(7). Amer1 is a PtdIns(4,5)P2-binding protein, which associates
with PtdIns(4,5)P2 produced locally in the membrane. As a
consequence of PtdIns(4,5)P2 production by Dvl-associated
kinases Amer1 recruits Lrp6 kinases in the proximity of ICD of
Lrp6 (7). Phosphorylation of Lrp6 receptors then takes place in
the five-times itinerated PPP(S/T)PXS motives in the Lrp6 ICD.
Several kinases including GSK3␤, CK1␥, MAPKs, cyclin-dependent
kinase, or G protein-coupled receptor kinases phosFIGURE
8. Model: role of ␤-arrestin in Lrp6 phosphorylation. A, the data presented in Figs. 1–7 support a model, where ␤-arrestin acts as a scaffold, which
brings Amer1 close to the site of PIP2 production. A Wnt ligand activates pathway via Frizzled (FZD)/Dvl, which subsequently leads to the activation of
PI4KII␣/PIP5KI␤ kinases. We propose that the activation of Dvl and the initial production of PIP2 allow translocation of ␤-arrestin and PI4KII␣/PIP5KI␤ toward
Amer1-based Lrp6 phosphorylation complex composed of Amer1, Axin, and Lrp6-phosphorylating kinases CK1 and GSK3␤. Local production of PIP2 then
stabilizes the Lrp6 phosphorylation complex and feeds the phosphorylation process. B, the FoldIndex prediction shows that Amer1 is largely an intrinsically
disordered protein (in red) where the domains required for binding of key proteins/metabolites required for Lrp6 phosphorylation do not overlap.
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1139
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
phorylating Lrp6 have been identified (37–42); however, the
relative contribution of individual kinases is still a matter of
debate.
Based on our data we propose a model of ␤-arrestin and
Amer1 function in the Wnt3a-induced phosphorylation of
Lrp6 (schematized in Fig. 8A). The model is based on our finding
that ␤-arrestin can be either present in complex with Dvl or
with Amer1. The interaction of Amer1 and ␤-arrestin takes
place near the membrane and most importantly requires
PtdIns-P2 and possibly other membrane lipids or membrane
itself.
The interaction of ␤-arrestin with Dvl seems to have higher
affinity than the interaction of ␤-arrestin with Amer1 or
PI4KII/PIP5KI kinases. As a consequence, overexpression of
Dvl is able to efficiently disrupt the binding of ␤-arrestin with
Amer1 and PI4KII/PIP5KI (see Figs. 2 and 7). It is known that
the Wnt signaling cascade is induced by binding of Wnt to Fzd.
This interaction subsequently triggers by an yet unidentified
mechanism involving Dvl the activation of PtdIns(4,5)P2-producing
kinases PI4KII and PIP5KI (6).
The production of PtdIns(4,5)P2 is required and further promotes
the interaction of Amer1 and ␤-arrestin. We speculate
that following the activation, Dvl undergoes a conformational
change (induced either by posttranslational modifications or by
recruitment of other proteins), which breaks the ␤-arrestin/Dvl
interaction and allows the formation of the ␤-arrestin⅐Amer1
and ␤-arrestin⅐PI4KII⅐PIP5KI complexes. ␤-Arrestin thus acts
as a switch, which translocates PtdIns(4,5)P2-producing
kinases from Dvl toward the Lrp6-phosphorylating complex.
This allows efficient phosphorylation of Lrp6 fed by the local
production of PtdIns(4,5)P2 associated with ␤-arrestin. Indeed,
direct measurements of PtdInsP and PtdInsP2 showed (i) a
Wnt3a-induced increase in these PtdInsPs and (ii) an increase
in the steady-state levels of PtdInsP in ␤-arrestin1/2 DKO
MEFs. These data suggest that the defects in the dynamic Wntinduced
phosphorylation of PtdIns are compensated by
increase in the level of PtdInsP. Of note, similar phenotype (lack
of Wnt-induced dynamics accompanied by increased steadystate
activation) has been observed in ␤-arrestin1/2 DKO MEFs
for the levels of TOPFLASH activity and of phosphorylated Dvl
(14).
The known properties of Amer1 make the scenario schematized
in Fig. 8A sterically possible. The individual regions of
Amer1, which interact with PtdIns(4,5)P2 (7), APC (27), Axin
(22), and ␤-arrestin (this study) do not overlap (Fig. 8B). The
N-terminal part of Amer1 recognizes PtdIns(4,5)P2 and central
regions interact with Lrp6 and Axin, whereas the very C-terminal
region is responsible for the interaction with ␤-arrestin.
Moreover, Amer1 is, based on the computer predictions, an
intrinsically disordered protein with the lack of clearly defined
secondary structure (Fig. 8B). This feature allows Amer1 to act
as scaffold and to exist in numerous conformations depending
on the individual binding partners.
Amer1 has a dual role in Wnt/␤-catenin signaling. It was first
identified as a negative regulator of Wnt/␤-catenin signaling,
which interacts with the components of the destruction complex
(Apc, Axin, GSK3␤, CK1) (7, 27, 36). Amer1 was identified
only recently also as a positive regulator of the Wnt/␤-catenin
signaling, which acts at the level of Lrp6 phosphorylation (7). It
is of interest that its positive role seems to be limited to Amer1
and does not apply to related Amer2 (43), which lacks the
C-terminal sequence (44) required for the interaction with
␤-arrestin.
In summary, in the present study we provide the so far missing
molecular mechanism utilized by ␤-arrestin to positively
regulate Wnt/␤-catenin signaling. According to our data ␤-arrestin
acts in the Wnt/␤-catenin pathway via Amer1, which is a
protein conserved only in vertebrates. This raises the possibility
that the function of ␤-arrestin in the Wnt/␤-catenin pathway
evolved in parallel and will be limited to vertebrates. This is in
agreement with the lack of Wnt/␤-catenin-related phenotypes
in the Drosophila ␤-arrestin homologue kurtz and the
Caenorhabditis elegans homologue arr-1 mutants. Phosphorylation
of Lrp6 via the ␤-arrestin/Amer1 pathway thus represents
a mechanism for the efficient and tightly controlled
activation of the Wnt/␤-catenin pathway that evolved in
vertebrates.
Acknowledgments—We thank P. De Camilli for PI4KII antibody and
PI4KII/PIP5K plasmids; R. J. Lefkowitz for A1CT/A2CT antibodies,
␤-arrestin, and Dvl2 plasmids; M. Maurice, Randall Moon, V.
Korˇínek, J. Kukkonen, and S. Yanagawa for plasmids; and K. Soucˇek
for the NB4 cell line.
REFERENCES
1. Clevers, H. (2006) Wnt/␤-catenin signaling in development and disease.
Cell 127, 469–480
2. Logan, C. Y., and Nusse, R. (2004) The Wnt signaling pathway in development
and disease. Annu. Rev. Cell Dev. Biol. 20, 781–810
3. Schulte, G., and Bryja, V. (2007) The Frizzled family of unconventional G
protein-coupled receptors. Trends Pharmacol. Sci. 28, 518–525
4. Bilic, J., Huang, Y. L., Davidson, G., Zimmermann, T., Cruciat, C. M.,
Bienz, M., and Niehrs, C. (2007) Wnt induces LRP6 signalosomes and
promotes Dishevelled-dependent LRP6 phosphorylation. Science 316,
1619–1622
5. Zeng, X., Huang, H., Tamai, K., Zhang, X., Harada, Y., Yokota, C.,
Almeida, K., Wang, J., Doble, B., Woodgett, J., Wynshaw-Boris, A., Hsieh,
J. C., and He, X. (2008) Initiation of Wnt signaling: control of Wnt coreceptor
Lrp6 phosphorylation/activation via Frizzled, Dishevelled, and
Axin functions. Development 135, 367–375
6. Pan, W., Choi, S. C., Wang, H., Qin, Y., Volpicelli-Daley, L., Swan, L.,
Lucast, L., Khoo, C., Zhang, X., Li, L., Abrams, C. S., Sokol, S. Y., and Wu,
D. (2008) Wnt3a-mediated formation of phosphatidylinositol 4,5-bisphosphate
regulates LRP6 phosphorylation. Science 321, 1350–1353
7. Tanneberger, K., Pfister, A. S., Brauburger, K., Schneikert, J., Hadjihannas,
M. V., Kriz, V., Schulte, G., Bryja, V., and Behrens, J. (2011) Amer1/WTX
couples Wnt-induced formation of PtdIns(4,5)P2 to LRP6 phosphorylation.
EMBO J. 30, 1433–1443
8. Tamai, K., Zeng, X., Liu, C., Zhang, X., Harada, Y., Chang, Z., and He, X.
(2004) A mechanism for Wnt coreceptor activation. Mol. Cell 13,
149–156
9. Behrens, J., Jerchow, B. A., Würtele, M., Grimm, J., Asbrand, C., Wirtz, R.,
Kühl, M., Wedlich, D., and Birchmeier, W. (1998) Functional interaction
of an Axin homolog, conductin, with ␤-catenin, APC, and GSK3␤. Science
280, 596–599
10. Kimelman, D., and Xu, W. (2006) ␤-Catenin destruction complex: insights
and questions from a structural perspective. Oncogene 25,
7482–7491
11. MacDonald, B. T., Tamai, K., and He, X. (2009) Wnt/␤-catenin signaling:
components, mechanisms, and diseases. Dev. Cell 17, 9–26
12. Schulte, G., Schambony, A., and Bryja, V. (2010) ␤-Arrestins: scaffolds and
␤-Arrestin Controls Lrp6 Phosphorylation
1140 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289•NUMBER 2•JANUARY 10, 2014
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
signalling elements essential for WNT/Frizzled signalling pathways? Br. J.
Pharmacol. 159, 1051–1058
13. Chen, W., Hu, L. A., Semenov, M. V., Yanagawa, S., Kikuchi, A., Lefkowitz,
R. J., and Miller, W. E. (2001) ␤-Arrestin1 modulates lymphoid enhancer
factor transcriptional activity through interaction with phosphorylated
Dishevelled proteins. Proc. Natl. Acad. Sci. U.S.A. 98, 14889–14894
14. Bryja, V., Gradl, D., Schambony, A., Arenas, E., and Schulte, G. (2007)
␤-Arrestin is a necessary component of Wnt/␤-catenin signaling in vitro
and in vivo. Proc. Natl. Acad. Sci. U.S.A. 104, 6690–6695
15. Bryja, V., Schambony, A., Cajánek, L., Dominguez, I., Arenas, E., and
Schulte, G. (2008) ␤-Arrestin and casein kinase 1/2 define distinct
branches of noncanonical WNT signalling pathways. EMBO Rep. 9,
1244–1250
16. Chen, W., ten Berge, D., Brown, J., Ahn, S., Hu, L. A., Miller, W. E., Caron,
M. G., Barak, L. S., Nusse, R., and Lefkowitz, R. J. (2003) Dishevelled 2
recruits ␤-arrestin 2 to mediate Wnt5A-stimulated endocytosis of Frizzled
4. Science 301, 1391–1394
17. Kim, G. H., Her, J. H., and Han, J. K. (2008) Ryk cooperates with Frizzled 7
to promote Wnt11-mediated endocytosis and is essential for Xenopus
laevis convergent extension movements. J. Cell Biol. 182, 1073–1082
18. Kim, G. H., and Han, J. K. (2007) Essential role for ␤-arrestin 2 in the
regulation of Xenopus convergent extension movements. EMBO J. 26,
2513–2526
19. Kikuchi, A., Yamamoto, H., and Sato, A. (2009) Selective activation mechanisms
of Wnt signaling pathways. Trends Cell Biol. 19, 119–129
20. Bernatik, O., Ganji, R. S., Dijksterhuis, J. P., Konik, P., Cervenka, I., Polonio,
T., Krejci, P., Schulte, G., and Bryja, V. (2011) Sequential activation and
inactivation of Dishevelled in the Wnt/␤-catenin pathway by casein kinases.
J. Biol. Chem. 286, 10396–10410
21. Kohout, T. A., Lin, F. S., Perry, S. J., Conner, D. A., and Lefkowitz, R. J.
(2001) ␤-Arrestin 1 and 2 differentially regulate heptahelical receptor signaling
and trafficking. Proc. Natl. Acad. Sci. U.S.A. 98, 1601–1606
22. Tanneberger, K., Pfister, A. S., Kriz, V., Bryja, V., Schambony, A., and
Behrens, J. (2011) Structural and functional characterization of the Wnt
inhibitor APC membrane recruitment 1 (Amer1). J. Biol. Chem. 286,
19204–19214
23. Angers, S., Thorpe, C. J., Biechele, T. L., Goldenberg, S. J., Zheng, N.,
MacCoss, M. J., and Moon, R. T. (2006) The KLHL12-Cullin-3 ubiquitin
ligase negatively regulates the Wnt-␤-catenin pathway by targeting Dishevelled
for degradation. Nat. Cell Biol. 8, 348–357
24. Tauriello, D. V., Haegebarth, A., Kuper, I., Edelmann, M. J., Henraat, M.,
Canninga-van Dijk, M. R., Kessler, B. M., Clevers, H., and Maurice, M. M.
(2010) Loss of the tumor suppressor CYLD enhances Wnt/␤-catenin signaling
through K63-linked ubiquitination of Dvl. Mol. Cell 37, 607–619
25. Lee, J. S., Ishimoto, A., and Yanagawa, S. (1999) Characterization of mouse
Dishevelled (Dvl) proteins in Wnt/Wingless signaling pathway. J. Biol.
Chem. 274, 21464–21470
26. Veeman, M. T., Slusarski, D. C., Kaykas, A., Louie, S. H., and Moon, R. T.
(2003) Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling,
regulates gastrulation movements. Curr. Biol. 13, 680–685
27. Grohmann, A., Tanneberger, K., Alzner, A., Schneikert, J., and Behrens, J.
(2007) Amer1 regulates the distribution of the tumor suppressor APC
between microtubules and the plasma membrane. J. Cell Sci. 120,
3738–3747
28. Bryja, V., Pacherník, J., Faldíková, L., Krejcí, P., Pogue, R., Nevrivá, I.,
Dvorák, P., and Hampl, A. (2004) The role of p27Kip1
in maintaining the
levels of D-type cyclins in vivo. Biochim. Biophys. Acta 1691, 105–116
29. Major, M. B., Roberts, B. S., Berndt, J. D., Marine, S., Anastas, J., Chung, N.,
Ferrer, M., Yi, X., Stoick-Cooper, C. L., von Haller, P. D., Kategaya, L.,
Chien, A., Angers, S., MacCoss, M., Cleary, M. A., Arthur, W. T., and
Moon, R. T. (2008) New regulators of Wnt/␤-catenin signaling revealed
by integrative molecular screening. Sci. Signal. 1, ra12
30. Smalley, M. J., Signoret, N., Robertson, D., Tilley, A., Hann, A., Ewan, K.,
Ding, Y., Paterson, H., and Dale, T. C. (2005) Dishevelled (Dvl-2) activates
canonical Wnt signalling in the absence of cytoplasmic puncta. J. Cell Sci.
118, 5279–5289
31. Schwarz-Romond, T., Merrifield, C., Nichols, B. J., and Bienz, M. (2005)
The Wnt signalling effector Dishevelled forms dynamic protein assemblies
rather than stable associations with cytoplasmic vesicles. J. Cell Sci.
118, 5269–5277
32. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler,
K. W., Vogelstein, B., and Clevers, H. (1997) Constitutive transcriptional
activation by a ␤-catenin-TCF complex in APCϪ/Ϫ
colon carcinoma. Science
275, 1784–1787
33. Qin, Y., Li, L., Pan, W., and Wu, D. (2009) Regulation of phosphatidylinositol
kinases and metabolism by Wnt3a and Dvl. J. Biol. Chem. 284,
22544–22548
34. Nelson, C. D., Kovacs, J. J., Nobles, K. N., Whalen, E. J., and Lefkowitz, R. J.
(2008) ␤-Arrestin scaffolding of phosphatidylinositol 4-phosphate 5-kinase
I␣ promotes agonist-stimulated sequestration of the ␤2-adrenergic
receptor. J. Biol. Chem. 283, 21093–21101
35. Balla, A., Tuymetova, G., Barshishat, M., Geiszt, M., and Balla, T. (2002)
Characterization of type II phosphatidylinositol 4-kinase isoforms reveals
association of the enzymes with endosomal vesicular compartments.
J. Biol. Chem. 277, 20041–20050
36. Major, M. B., Camp, N. D., Berndt, J. D., Yi, X., Goldenberg, S. J., Hubbert,
C., Biechele, T. L., Gingras, A. C., Zheng, N., Maccoss, M. J., Angers, S., and
Moon, R. T. (2007) Wilms tumor suppressor WTX negatively regulates
WNT/␤-catenin signaling. Science 316, 1043–1046
37. Chen, M., Philipp, M., Wang, J., Premont, R. T., Garrison, T. R., Caron,
M. G., Lefkowitz, R. J., and Chen, W. (2009) G protein-coupled receptor
kinases phosphorylate LRP6 in the Wnt pathway. J. Biol. Chem. 284,
35040–35048
38. Cˇervenka, I., Wolf, J., Masˇek, J., Krejci, P., Wilcox, W. R., Kozubík, A.,
Schulte, G., Gutkind, J. S., and Bryja, V. (2011) Mitogen-activated protein
kinases promote WNT/␤-catenin signaling via phosphorylation of LRP6.
Mol. Cell. Biol. 31, 179–189
39. Krejci, P., Aklian, A., Kaucka, M., Sevcikova, E., Prochazkova, J., Masek,
J. K., Mikolka, P., Pospisilova, T., Spoustova, T., Weis, M., Paznekas, W. A.,
Wolf, J. H., Gutkind, J. S., Wilcox, W. R., Kozubik, A., Jabs, E. W., Bryja, V.,
Salazar, L., Vesela, I., and Balek, L. (2012) Receptor tyrosine kinases activate
canonical WNT/␤-catenin signaling via MAP kinase/LRP6 pathway
and direct ␤-catenin phosphorylation. PLoS ONE 7, e35826
40. Davidson, G., Wu, W., Shen, J., Bilic, J., Fenger, U., Stannek, P., Glinka, A.,
and Niehrs, C. (2005) Casein kinase 1␥ couples Wnt receptor activation to
cytoplasmic signal transduction. Nature 438, 867–872
41. Davidson, G., Shen, J., Huang, Y. L., Su, Y., Karaulanov, E., Bartscherer, K.,
Hassler, C., Stannek, P., Boutros, M., and Niehrs, C. (2009) Cell cycle
control of Wnt receptor activation. Dev. Cell 17, 788–799
42. Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., Okamura, H.,
Woodgett, J., and He, X. (2005) A dual-kinase mechanism for Wnt coreceptor
phosphorylation and activation. Nature 438, 873–877
43. Pfister, A. S., Tanneberger, K., Schambony, A., and Behrens, J. (2012)
Amer2 protein is a novel negative regulator of Wnt/␤-catenin signaling
involved in neuroectodermal patterning. J. Biol. Chem. 287, 1734–1741
44. Boutet, A., Comai, G., and Schedl, A. (2010) The WTX/Amer1 gene family:
evolution, signature and function. BMC Evol. Biol. 10, 280
␤-Arrestin Controls Lrp6 Phosphorylation
JANUARY 10, 2014•VOLUME 289•NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1141
atMASARYKOVAUNIVERZITAonJanuary10,2014http://www.jbc.org/Downloadedfrom
Vítězslav Bryja, 2014    Attachments 
 
 
#17 
 
 
K. Seitz1
, V. Dürsch1
, J. Harnoš, V. Bryja, M. Gentzel, A. Schambony (2014): β‐Arrestin 
interacts with the beta/gamma subunits of trimeric G proteins and Dishevelled in the 
Wnt‐/Ca2+ pathway in Xenopus gastrulation. Plos ONE 9(1):e87132. 
1
 equal contribution 
 
 
Impact factor (2012): 3.730 
Times cited (without autocitations, WoS, Feb 21st 2014): 0 
Significance:  Identification  of  β‐arrestin  as  a  component  of  the  non‐canonical 
Wnt/Ca2+ pathway.  β‐arrestin  mediates activation of protein kinase C together 
with Dishevelled and beta/gamma subunits of trimeric G protein. 
Contibution  of  the  author/author´s  team:  Immunoprecipitation  analysis  of  the 
interaction among Dvl1/2/3‐β‐arrestin‐beta/gamma‐G proteins. 
 
 
   
 
 
 
b-Arrestin Interacts with the Beta/Gamma Subunits of
Trimeric G-Proteins and Dishevelled in the Wnt/Ca2+
Pathway in Xenopus Gastrulation
Katharina Seitz1.
, Verena Du¨ rsch1.
, Jakub Harnosˇ2
, Vitezslav Bryja2,3
, Marc Gentzel4"
,
Alexandra Schambony1,*"
1 Biology Department, Developmental Biology, Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, Germany, 2 Institute of Experimental Biology, Faculty of
Science, Masaryk University, Brno, Czech Republic, 3 Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic, 4 Max Planck Institute of
Molecular Cell Biology and Genetics, Dresden, Germany
Abstract
b-Catenin independent, non-canonical Wnt signaling pathways play a major role in the regulation of morphogenetic
movements in vertebrates. The term non-canonical Wnt signaling comprises multiple, intracellularly divergent, Wntactivated
and b-Catenin independent signaling cascades including the Wnt/Planar Cell Polarity and the Wnt/Ca2+
cascades.
Wnt/Planar Cell Polarity and Wnt/Ca2+
pathways share common effector proteins, including the Wnt ligand, Frizzled
receptors and Dishevelled, with each other and with additional branches of Wnt signaling. Along with the aforementioned
proteins, b-Arrestin has been identified as an essential effector protein in the Wnt/b-Catenin and the Wnt/Planar Cell Polarity
pathway. Our results demonstrate that b-Arrestin is required in the Wnt/Ca2+
signaling cascade upstream of Protein Kinase C
(PKC) and Ca2+
/Calmodulin-dependent Protein Kinase II (CamKII). We have further characterized the role of b-Arrestin in this
branch of non-canonical Wnt signaling by knock-down and rescue experiments in Xenopus embryo explants and analyzed
protein-protein interactions in 293T cells. Functional interaction of b-Arrestin, the b subunit of trimeric G-proteins and
Dishevelled is required to induce PKC activation and membrane translocation. In Xenopus gastrulation, b-Arrestin function
in Wnt/Ca2+
signaling is essential for convergent extension movements. We further show that b-Arrestin physically interacts
with the b subunit of trimeric G-proteins and Dishevelled, and that the interaction between b-Arrestin and Dishevelled is
promoted by the beta/gamma subunits of trimeric G-proteins, indicating the formation of a multiprotein signaling complex.
Citation: Seitz K, Du¨rsch V, Harnosˇ J, Bryja V, Gentzel M, et al. (2014) b-Arrestin Interacts with the Beta/Gamma Subunits of Trimeric G-Proteins and Dishevelled in
the Wnt/Ca2+
Pathway in Xenopus Gastrulation. PLoS ONE 9(1): e87132. doi:10.1371/journal.pone.0087132
Editor: Ali H. Brivanlou, The Rockefeller University, United States of America
Received August 7, 2013; Accepted December 18, 2013; Published January 29, 2014
Copyright: ß 2014 Seitz et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by Deutsche Forschungsgemeinschaft (SCHA965/6-1 to A.S., www.dfg.de), the Max-Planck-Society (to M.G., www.mpg.de)
and by Czech Science Foundation (204/09/0498, 204/09/J030 to V.B., www.gacr.cz) and EMBO Installation Grant, the Ministry of Education Youth and Sport of the
Czech Republic (MSM0021622430 to V.B., www.embo.org). In addition, the authors acknowledge support by Deutsche Forschungsgemeinschaft (www.dfg.de)
and Friedrich-Alexander-Universita¨t Erlangen-Nu¨rnberg (www.fau.de) within the funding programme Open Access Publishing. The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: alexandra.schambony@fau.de
. These authors contributed equally to this work.
" These authors also contributed equally to this work.
Introduction
Wnt signaling plays a crucial role in pattern formation, tissue
specification and cellular organization during embryogenesis. Wnt
signaling pathways are generally subdivided into the canonical
Wnt pathway, which leads to stabilization and nuclear translocation
of b-Catenin, and the more divergent non-canonical, bCatenin
independent pathways. Both b-Catenin dependent and
independent Wnt pathways are activated by heteromeric receptor
complexes of Frizzled family seven-pass transmembrane receptors
and LRP5/6 or PTK7/Ryk/Ror2 co-receptors, respectively. The
b-Catenin independent Wnt pathways encompass a number of
biochemically and functionally distinct signaling cascades, including
the Wnt/PCP and the Wnt/Ca2+
pathways. Wnt/PCP
signaling leads to a Dishevelled (Dvl) mediated activation of Rho
family small GTPases (RhoA, Rac1) and subsequent activation
and phosphorylation of c-Jun N-terminal Kinase (JNK [1]). The
Wnt/Ca2+
pathway is characterized by Gai/o-triggered, Pertussis
Toxin (PTX)-sensitive calcium release and activation of Ca2+
regulated
effector proteins, including Protein Kinase C alpha
(PKCa), Ca2+
/Calmodulin-dependent Protein Kinase II (CamKII)
and Nuclear Factor of Activated T-Cells (NFAT [2]).
In multiple developmental processes, including gastrulation and
cardiac development, Wnt/PCP and Wnt/Ca2+
signaling are
required simultaneously and are often activated by the same Wnt
ligand and Frizzled receptor. Wnt-11 and Frizzled 7 activated
PKC signaling is required for tissue separation of mesoderm and
ectoderm during gastrulation [3]. In the mesoderm, Wnt-11,
Frizzled 7 (Fzd7), Dvl2 and b-Arrestin2 (Arrb2) activate Wnt/PCP
signaling during convergent extension movements [4–7]. Similarly,
Wnt-11 mediates both Wnt/Ca2+
and Wnt/PCP signaling in
cardiac development [8,9]. Recent reviews have depicted Wnt
signaling cascades as a signaling network rather than as distinct
PLOS ONE | www.plosone.org 1 January 2014 | Volume 9 | Issue 1 | e87132
signaling cascades [10], however, the biochemical interaction and
integration of these different branches of non-canonical Wnt
signaling is yet unclear.
b-Arrestins were initially described as proteins involved in
desensitizing and endocytosis of G-protein coupled receptors
(GPCRs [11]). More recent studies revealed that b-Arrestins play a
role in multiple signal transduction pathways, including canonical
and non-canonical Wnt signaling (for review [11,12]). In contrast
to classical GPCR desensitizing, b-Arrestin2 acts as a positive
regulator in Wnt signaling. We have previously shown that bArrestin2
interacts with Dvl and is required for Wnt/b-Catenin
signal transduction [13]. Others and we have also described a role
for b-Arrestin2 in the activation of the PCP pathway [7,14]. Here
we show that b-Arrestin2 is required in the Wnt/Ca2+
signaling
cascade; it interacts functionally and physically with the b subunit
of trimeric G-proteins and Dishevelled, which are both known
effectors in the Wnt/Ca2+
cascade [15,16]. We show further that
Wnt/Ca2+
signaling is essential for proper convergent extension
movements in Xenopus embryos and that b-Arrestin2 functionally
links Wnt/Ca2+
and Wnt/PCP signaling in convergent extension
movements.
Materials and Methods
Xenopus laevis Embryos
Xenopus embryos were generated and cultured according to
general protocols and staged according to the normal table of
Nieuwkoop and Faber [17]. All procedures were performed
according to the German animal use and care law (Tierschutzgesetz)
and approved by the German state administration Bavaria
(Regierung von Mittelfranken).
Cell Culture and Transfection
293T human embryonic kidney cells (Leibniz Institute Collections
of Microorganisms and Cell Culture, DSMZ, Germany) were
cultured in DMEM supplemented with 10% fetal calf serum (Life
Technologies, CA, USA) at 37uC in a humidified atmosphere of
10% CO2. Plasmid transfections were performed using either
TransPassD2 (New England Biolabs, MA, USA) or Nanofectin
(GE Healthcare, Freiburg, Germany) according to the manufacturers’
protocols.
Plasmids and Morpholinos
The following plasmids and Morpholinos have been described
previously: pcDNA-flag-arrb2 [13], pCS2+ fzd7, pCS2+ rhoA V12,
pCS2+ rac1 V14 [18], pCS2+ cdc42 [19]; Arrb2 Morpholino 1
(Arrb2 MO1, [13]), Fzd7 Morpholino [3], Dvl2 MO [7], Dvl1
MO, Dvl3 MO [20].
The Arrb2 Morpholino 2 (Arrb2 MO2 59-CGCACGGTTCCAAACGCACAGTAGG-
39) and a Control Morpholino (Control
MO) were purchased from Gene Tools LLC (OR, USA). The
additional 59UTR sequence of the arrb2 mRNA has been
submitted to Genebank (accession number KF831094).
The expression plasmids pCS2+ pkca-gfp, pCS2+ dn pkca, pCS2+
camkII K42M, pCS2+ camkII T286D were generously provided by
Michael Ku¨hl (University Ulm, Germany); pcDNA HA-gb1 (HAgnb1),
pcDNA HA-gc2 (HA-gng2) and pRK5 b-ARKct were
provided by G. Schulte (Karolinska Institute, Stockholm, Sweden).
The fragment encoding b-ARKct was subcloned into pCS2+. The
open reading frames encoding Xenopus Dvl1, Dvl2 and Dvl3 were
amplified by PCR and cloned into pCS2+ myc (R. Rupp, LMU
Munich, Germany).
Preparation of Cell Lysates, Immunoprecipitation, and
Western Blotting
Cells were washed once with PBS and lysed in NP-40 buffer
(20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1%
NP-40) supplemented with complete Protease Inhibitor and
PhosStop Phosphatase Inhibitor Cocktails (Roche, Mannheim,
Germany) at 4uC. For embryo lysates, embryos were collected at
the desired stage and lysed in the same lysis buffer. Animal Cap
lysates were also prepared using the same lysis buffer. Lysates were
cleared at 16,0006 g for 10 min. For co-immunoprecipitation,
lysates were incubated for 4 h at 4uC with the appropriate
antibody and protein G-magnetic beads (Life Technologies, CA,
USA). Immunoprecipitates were collected, washed four times with
lysis buffer and eluted with SDS sample buffer. For Western
blotting, proteins were visualized colorimetrically with NBT/
BCIP.
Antibodies
Commercial antibodies were obtained from Abcam, UK (mouse
anti-Arrb2, rabbit anti-GFP; rabbit anti-HA, goat anti-myc), Cell
Signaling Technology Inc., USA (rabbit anti-Arrb2, rabbit antimyc,
rabbit anti-Flag), ProteinTech Inc., USA (rabbit anti-Arrb2)
and Santa Cruz Biotechnology Inc., USA (mouse anti-Gb, mouse
anti-b-Catenin, rabbit anti-Dvl2). The anti-tubulin b hybridoma
developed by Michael Klymkowski and the anti-actin antibody
developed by Jim Jung-Chin Lin were obtained from the
Developmental Studies Hybridoma Bank developed under the
auspices of the NICHD and maintained by The University of
Iowa, Department of Biology, Iowa City, IA 52242. Secondary
antibodies were anti-mouse-Alkaline Phosphatase and anti-rabbitAlkaline
Phosphatase (Cell Signaling Technology, Inc. USA), antimouse
Cy3 (Jackson ImmunoResearch, PA, USA), anti-rabbit
Alexa 488 and anti-mouse Alexa 647 (Life Technologies, CA,
USA).
Injection and Analysis of Xenopus laevis Embryos
RNA for microinjection was prepared using the mMessage
mMachine Kit (Life Technologies, CA, USA). Injection amounts
were 200 pg for ca camkII (camkII T286D), dn camkII (camkII K42M),
and for myc-arrb2, myc-arrb1, HA-gb1 (HA-gnb1), and HA-gc2 (HAgng2);
injection amounts were 500 pg for pkca, dn pkca, b-ARKct,
and 1 ng for pkca-gfp and fzd7. For ca rhoA 5 pg and ca rac1 10 pg
plasmid DNA were injected. Knock-down was achieved by
injection of the following antisense Morpholino oligonucleotides:
Dvl2 MO, Dvl1 MO, and Dvl3 MO (0.8 pmol each), Arrb2 MO1
(0.8 pmol), Arrb2 MO2 (0.8 pmol), Fzd7 MO (4 pmol). Pertussis
Toxin (PTX) was added to the culture medium at 100 ng/ml.
Embryos were injected at the two-cell stage for Animal Cap
explants or at the four-cell stage in both dorsal blastomeres for
Keller explants and cultured until they reached stage 10 or 10.5,
respectively.
Keller open face explants were prepared and cultured as
described in [18]. Explants were scored as ‘‘fully elongated’’ if they
showed .75% elongation, as ‘‘partially elongated’’ if elongation
was between 25% and 75% and ‘‘not elongated’’ if explants
showed less than 25% elongation when compared to fully
elongated control explants. Immunofluorescence staining of
Animal Cap explants was performed as described previously
[21]. Photographs were taken on a Zeiss Apotome imaging system
(Zeiss, Oberkochen, Germany).
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 2 January 2014 | Volume 9 | Issue 1 | e87132
Results
b-Arrestin2 is required for PKCa activation in Wnt/Ca2+
signaling
Wnt- or Frizzled-induced PKCa activation and translocation to
the plasma membrane is an indicator for the activation of Wnt/
Ca2+
signaling. We therefore investigated the role of b-Arrestin2 in
Wnt/Ca2+
signaling by monitoring PKCa translocation in
Xenopus Animal Cap explants. As expected from earlier studies
[3], overexpression of Xenopus Frizzled 7 (Fzd7) induced a robust
translocation of PKCa-GFP to the plasma membrane (Figure 1A,
B). Interestingly, overexpression of b-Arrestin2 (Arrb2, Figure 1C)
was also sufficient to induce partial membrane association of
PKCa-GFP, likely by enhancing endogenous signaling. For
further analysis knock-down of Arrb2 was achieved using two
different translation-blocking antisense Morpholinos (Arrb2 MO1
[13] and Arrb2 MO2). Both Morpholinos repressed Frizzled 7
induced PKCa-GFP association with the plasma membrane to
comparable extent (Figure 1D and Figure 1E). In contrast, a
Control MO had no effect on Fzd7-mediated PKCa-GFP
membrane localization (Figure 1F). The inhibition of Fzd7induced
PKCa-GFP translocation by Arrb2 MO1 or Arrb2
MO2 was rescued by co-injection of a Morpholino insensitive mycarrb2
RNA. Expression of myc-tagged Arrb2 restored PKCa-GFP
localization to the plasma membrane in the presence of Arrb2
MO1 (Figure 1G, G9, G") or Arrb2 MO2 (Figure 1H, H9, H"),
which confirmed the specificity of both Arrb2 Morpholino
oligonucleotides used in this study. To determine the efficiency
of protein depletion by the Morpholino oligonucleotides used
herein, lysates of stage 10 Animal Cap explants were tested with an
anti-Arrb2 antibody to detect the endogenous protein. Both Arrb2
MO1 and Arrb2 MO2 efficiently reduced endogenous Arrb2
protein levels in Animal Cap explants (Figure 1I), which confirmed
the capability and efficiency of these Morpholino oligonucleotides
to deplete endogenous Arrb2 in Animal Cap tissue.
The novel Arrb2 MO2 has been designed to bind in the 59UTR
of arrb2 mRNA, thereby targeting a non-overlapping sequence
compared to Arrb2 MO1 (Figure S1), which targets the translation
start. Although arrb2 and arrb1 mRNA sequences are only 48%
identical in the overall binding region of Arrb2 MO1, they share
12 out of 15 bases in the sequence surrounding the ATG codon
(Figure S1). Therefore, the specificity of Arrb2 MO1 to Arrb2 as
compared to Arrb1 was further confirmed using MO-sensitive
GFP fusion constructs and by co-injecting PKCa-GFP expressing
Animal Caps with Fzd7, Arrb2 Morpholinos and arrb1 RNA. We
observed that Arrb2 MO1 was not able to suppress translation of
GFP constructs fused to the arrb1 59 UTR, while it efficiently
blocked translation when the arrb2 59UTR was present (Figure
S2A). In contrast to myc-Arrb2 (Figure 1G, H), myc-Arrb1 only
partially restored Fzd7-induced PKCa-GFP translocation in
Animal Caps injected with Arrb2 MO1 or Arrb2 MO2 (Figure
S2B-S2E). These results further confirmed the specificity of the
Arrb2 Morpholino oligonucleotides used here. Moreover, we
found that mRNA levels of arrb1 were on average more than 500
fold lower than those of arrb2 in gastrula stage embryos (Figure S3).
Overall, we conclude that Arrb2 is required downstream of
Frizzled 7 for membrane translocation and activation of PKC in
the Wnt/Ca2+
pathway.
b-Arrestin2 functionally interacts with the b subunit of
trimeric G-proteins
Frizzled-induced PKCa translocation requires activation of
trimeric G-proteins and signal transduction mediated by the band
c-subunits (Gb and Gc) [16], which was recapitulated in our
experiments by treatment of Animal Cap explants with Pertussis
Toxin (PTX) for 1 hour (Figure 2A, B, C). Overexpression of HAtagged
Gb1 and Gc2 (HA-Gnb1 and HA-Gng2, respectively)
resulted in PKCa activation and translocation in the HA-positive
cells (Figure 2D, D9, D"). Interestingly, expression of the b and c
subunits of trimeric G-proteins was sufficient to revert the effect of
b-Arrestin2 knock-down on PKC localization. Co-injection of
Arrb2 MO1 blocked Fzd7-induced association of PKCa-GFP with
the plasma membrane (Figure 2E and Figure 1C). PKCa
translocation was restored by co-expression of HA-Gb and HAGc
(Figure 2F, F9, F") indicating that Gb/Gc signaling activated
PKCa independent or downstream of Arrb2. In the reverse
experiment, endogenous Gb activity was blocked by the Gbsequestering
b-ARKct that is derived from the C-terminus of bAdrenergic
receptor kinase 2 (Adrbk2, [22]). b-ARKct efficiently
inhibited Fzd7 induced PKCa-GFP translocation (Figure 2G). Coexpression
of Arrb2 was not sufficient to rescue PKCa-GFP
translocation in Animal Caps overexpressing b-ARKct
(Figure 2H), although Arrb2 localization at the plasma membrane
was not affected (Figure 2H9, H"). These results suggested that
Arrb2 depends on Gb signaling to induce PKC activation and
translocation.
b-Arrestin2 functionally interacts with Dishevelled in
Wnt/Ca2+
signaling
In our previous studies, we have found that the interaction
between b-Arrestin2 and Dvl is required for Wnt signal
transduction in the Wnt/b-Catenin [13] and in the Wnt/PCP
pathways [7]. In addition, it has been shown that overexpression of
DvlDDIX, a Dvl2 mutant that activates b-Catenin independent
Wnt pathways, is capable of activating PKC and CamKII [15]. In
Xenopus as in other vertebrates, three Dvl isoforms have been
identified, and an initial study suggested that at least Xenopus
Dvl1 and Dvl2 are functionally redundant while Dvl3 showed a
different expression pattern and differential functionality in
tadpole stage embryos [20].
To analyze the functional interaction of Dvl and Arrb2 in
Xenopus gastrulation, we first confirmed that Dishevelled was
required for Fzd7-induced PKCa-GFP translocation to the plasma
membrane in Animal Cap explants. To avoid redundancy and to
obtain sufficient depletion of Dvl proteins, which are already
present maternally [20], we simultaneously knocked-down Dvl1,
Dvl2 and Dvl3. As expected, Fzd7-induced PKCa translocation
was impaired in triple Dvl morphant embryos (Figure 3A, B).
Interestingly, overexpression of Arrb2 rescued PKCa membrane
translocation (Figure 3C), indicating that Arrb2 functionally
interacted with Dvl in Wnt/Ca2+
signaling.
Convergent extension (CE) movements of the dorsal mesoderm
are tightly regulated mass cell movements during vertebrate
gastrulation, which require the activation of b-Catenin independent
Wnt signaling pathways [23,24]. Consistently, triple Dvl
knock-down impaired elongation of Keller open face explants,
which recapitulate CE movements of the dorsal mesoderm [25].
The majority of explants from triple Dvl morphant embryos
showed either no elongation or only partial elongation (Figure 3D),
and this elongation phenotype was rescued by co-injection of
either arrb2 or pkca mRNA, confirming again the role of Dvl in
Wnt/Ca2+
signaling and the functional interaction of Dvl and
Arrb2.
To further characterize the role of b-Arrestin in Wnt/Ca2+
signaling and its function in the regulation of CE movements, we
performed additional rescue experiments in Keller open face
explants.
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 3 January 2014 | Volume 9 | Issue 1 | e87132
Explants from Frizzled 7 morphant embryos showed only mild
elongation defects. However, in the vast majority of elongating
explants, strong constriction defects were observed (Figure 4A).
The Fzd7 morphant phenotype was fully rescued by co-injection
of a mRNA encoding arrb2 as well as by pkca mRNA (Figure 4A),
confirming the requirement of Arrb2 in Fzd7-mediated Ca2+
dependent
signaling and the role of this branch of Wnt signaling in
CE movements [26,27]. In contrast to Fzd7 knock-down,
treatment of Keller explants with PTX completely abrogated
CE movements (Figure 4B). Scoring for constriction defects was
not applicable in non-elongating explants, and we did not observe
significant constriction defects under the conditions that rescue the
PTX phenotype (not shown). PTX treatment was not effective in
explants overexpressing PKCa or caCamKII, which further
emphasized the role of Ca2+
-dependent signaling in CE movements.
However, overexpression of Arrb2 was not sufficient to
restore CE movement in PTX-treated explants, which further
supported the conclusion that b-Arrestin2 signaling to PKC was
dependent on trimeric G-protein activity.
Previously, we have reported that b-Arrestin2 is required for
convergent extension movements in Xenopus embryos as an
effector in the Wnt/PCP pathway [7]. As shown in this previous
Figure 1. Arrb2 is required for membrane translocation of PKCa. Xenopus embryos were injected with 500 pg pkca-gfp RNA and co-injected
as indicated above the images. Animal Caps were prepared at stage 10 and immunostained as indicated. Nuclei were stained with Hoechst 33258
(blue). Images show representative results of at least three independent experiments with a minimum of six Animal Caps per experiment. Scale bars:
50 mm. (A) PKCa-GFP localized predominantly to the cytoplasm. (B) Co-injection of 1ng fzd7 RNA induced PKCa-GFP translocation to the plasma
membrane. (C) Overexpression of Arrb2 partially induced PKCa-GFP membrane translocation. Co-injection of fzd7 mRNA with 0.8 pmol Arrb2 MO1
(D) or 0.8 pmol Arrb2 MO2 (E) blocked PKCa-GFP localization to the plasma membrane, while a Control MO had no effect (F). (G) The inhibitory effect
of Arrb2 MO1 on PKCa-GFP membrane translocation was rescued by co-expression of myc-Arrb2 (anti-myc (red): G9, merge: G"). (H) Comparably,
inhibition of PKCa-GFP membrane translocation by Arrb2 MO2 was restored by co-expression of myc-Arrb2 (anti-myc (red): H9, merge: H"). (I) Western
Blot of Animal Cap lysates prepared from stage 10 embryos, which were either uninjected or injected with Control MO, Arrb2 MO1 or Arrb2 MO2 as
indicated. Both Morpholinos efficiently downregulated proteins levels of endogenous Arrb2; an immunoblot for b-Actin is shown as loading control.
doi:10.1371/journal.pone.0087132.g001
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 4 January 2014 | Volume 9 | Issue 1 | e87132
study, knock-down of Arrb2 strongly inhibited explant elongation
when compared to control explants (Figure 4C). Interestingly,
Arrb2 loss-of-function (LOF) was again fully rescued by coinjection
of pkca mRNA or ca camkII mRNA and surprisingly, a
partial, but not significant rescue was observed by co-injection of
dn camkII mRNA. A Morpholino-insensitive arrb2 mRNA also
rescued the CE phenotype in Arrb2 morphant explants, which
served as specificity control for the Morpholino-induced CE
phenotype (Figure 4C).
Overall, these results demonstrated that b-Arrestin2 is required
downstream of Fzd7 and upstream of PKC in Wnt/Ca2+
signaling. Moreover, we confirmed a functional interaction
between the beta and gamma subunits of trimeric G-proteins
and Dishevelled in signal transduction from Fzd7 to PKC in the
regulation of CE movements during Xenopus gastrulation.
Arrb2 forms a complex with Dvl and Gbc
Frizzled receptors belong to the GPCR superfamily and have
been shown to interact with Dishevelled [21], trimeric G-proteins
[28,29] and likely indirectly with b-Arrestin2 [30]. In addition, the
b subunit of trimeric G-proteins has been found to interact with bArrestin1
[31] and Dvl [32]; and in our previous studies, we have
found that the interaction between b-Arrestin2 and Dvl is required
for Wnt signal transduction in the Wnt/b-Catenin [13] and in the
Wnt/PCP pathways [7].
Moreover, our present results clearly demonstrated a functional
interaction between b-Arrestin2, Gbc and Dishevelled in early
Xenopus embryos. These observations prompted us to further
investigate the physical interaction among these proteins.
Co-immunoprecipitation experiments showed that all three Dvl
isoforms formed a complex with Gb1 and b-Arrestin2, and all
Figure 2. Arrb2 depends on Gbc to induce membrane translocation of PKCa. Xenopus embryos were injected with 500 pg pkca-gfp RNA
and co-injected as indicated above the images. Animal Caps were prepared at stage 10 and immunostained as indicated. Nuclei were stained with
Hoechst 33258 (blue). Images show representative results from at least two independent experiments with a minimum of six Animal Caps per
experiment. Scale bars: 50 mm. (A) PKCa-GFP control, PKCa-GFP localized predominantly to the cytoplasm. (B) Co-injection of 1ng fzd7 RNA induced
PKCa-GFP translocation to the plasma membrane. (C) Treatment with PTX for 1 hour blocked Fzd7-induced PKCa-GFP translocation. (D)
Overexpression of HA-Gb and HA-Gc subunits (indicated as HA-Gbc) induced PKCa-GFP translocation (HA-Gbc stained with anti-HA (red): D9, merge:
D"). The inhibitory effect of Arrb2 MO1 (E) on PKCa-GFP membrane translocation was rescued by (F) co-injection of HA-Gb and HA-Gc mRNA (anti-HA
(red): F9, merge: F"). (G) Overexpression of the Gb-sequestering b-ARKct also blocked Fzd7 induced PKCa-GFP translocation. (H) Co-expression of mycArrb2
in Fzd7 and b-ARKct injected Animal Caps was not sufficient to rescue PKCa-GFP membrane translocation (anti-myc (red): H9, merge: H").
doi:10.1371/journal.pone.0087132.g002
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 5 January 2014 | Volume 9 | Issue 1 | e87132
enhanced binding of Gb1 to b-Arrestin2, indicating that any Dvl is
capable to form a trimeric complex with b-Arrestin2 and Gb1
(Figure 5A). The endogenous existence of an Arrb2-Dvl-Gb
complex was confirmed by co-precipitation of Gb and Dvl2 with
Arrb2 from unstimulated and Wnt stimulated HEK293T cells
(Figure 5B), although the overall low amounts of co-precipitated
protein indicated that only a fraction of the respective proteins
present in the cell are assembled in this complex.
Subsequently, we investigated if the interaction of Gb1 with bArrestin2
or Dvl2 was affected by overexpression of the Gbbinding
C-terminal fragment of b-Adrenergic receptor kinase (bARKct).
Overexpression of b-ARKct strongly interfered with the
binding between Arrb2 and Gb1 (Figure 5C). However, we still
observed binding of Dvl2 to Arrb2 in the presence of b-ARKct,
although reduced when compared to the binding in the absence of
b-ARKct (Figure 5C). Co-expression of Dvl2 partially restored
binding of Gb1 to Arrb2, probably by enhancing the interaction
between Arrb2 and residual free Gb1 subunits (Figure 5C). We
observed a similarly strong interference of b-ARKct with the
interaction between Gb and Dvl2 (Figure 5D), which was again
Figure 3. Arrb2 functionally interacts with Dvl in Wnt/Ca2+
signaling. Xenopus embryos were injected with 500 pg pkca-gfp RNA and coinjected
as indicated above the images. Animal Caps were prepared at stage 10 and immunostained as indicated. Nuclei were stained with Hoechst
33258 (blue). Images show representative results from at least two independent experiments with a minimum of six Animal Caps per experiment.
Scale bars: 50 mm. Fzd7 induced PKCa-GFP translocation (A) was impaired by a triple knock-down of Dvl1, Dvl2 and Dvl3 (B). (C) Co-expression of
Arrb2 partially rescued PKCa-GFP translocation in the triple Dvl knock-down. (D) Triple Dvl knock-down inhibited elongation of Keller open face
explants. Co-injection of PCKa or Arrb2 mRNA rescued the CE phenotype of triple Dvl morphant explants. The average percentage of explants
showing full (75-100%, light grey), partial (25-50%, medium grey) or no elongation (,25%, dark grey) from at least three independent experiments
are shown. Asterisks indicate statistically significant deviations in the percentage of fully elongated explants (* p.0.95, t-test).
doi:10.1371/journal.pone.0087132.g003
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 6 January 2014 | Volume 9 | Issue 1 | e87132
partially restored by co-expression of Arrb2. In addition, the
amount of Arrb2 that co-precipitated with Dvl2 was clearly
reduced in the presence of b-ARKct, indicating that the
interaction of Dvl2 and b-Arrestin2 did not strictly depend on
Gb signaling, but was significantly enhanced by Gb.
Discussion
Arrb2 is required in Wnt/Ca2+
signaling
In addition to its previously described role as a mediator of
signal transduction in the Wnt/b-Catenin and the Wnt/PCP
pathway, we have demonstrated that b-Arrestin2 is also an
Figure 4. Arrb2 is required for CE movements downstream of Frizzled 7 and upstream of PKCa. Xenopus embryos were injected at 4-cell
stage in the marginal zone of both dorsal blastomeres as indicated. CE movements in the dorsal mesoderm were monitored by elongation of Keller
open face explants. The average percentage of explants showing full (75-100%, light grey), partial (25-50%, medium grey) or no elongation (,25%,
dark grey) from at least three independent experiments (exp.) are shown. Asterisks indicate statistically significant deviations in the percentage of
fully elongated explants (** p.0.99,* p.0.95, t-test). (A) Frizzled 7 knock-down had little effect on elongation (bottom graph) but impaired
constriction. Only fully elongated explants (represented by light grey columns in bottom graph) were additionally scored for constriction. The
percentage of elongated explants that showed normal constriction are shown in the upper graph as average values plus SEM. Co-injection of arrb2 or
pkca mRNA fully rescued constriction and ca camkII mRNA partially rescued constriction. (B) PTX treatment impaired elongation of Keller open face
explants. Co-injection of pkca or ca camkII mRNA fully rescued explant elongation, while dn camkII or arrb2 mRNA did not. (C) Knock-down of Arrb2
interfered with explant elongation and was rescued by co-injection of pkca, ca camkII or a MO-insensitive arrb2 RNA.
doi:10.1371/journal.pone.0087132.g004
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 7 January 2014 | Volume 9 | Issue 1 | e87132
Figure 5. Arrb2 physically interacts with Gb and Dvl. Epitope-tagged proteins were overexpressed, immunoprecipitated and detected by
Western Blotting as indicated. (A) Flag-Arrb2 was co-expressed with a combination of HA-Gb1 and HA-Gc2 to allow the formation of Gbc
heterodimers (Gbc). Co-expression of Dvl1, Dvl2 or Dvl3 enhanced the interaction between Arrb2 and Gb1 in co-immunoprecipitation experiments
from HEK 293T cells. (B) Endogenous Gb and Dvl2 were detected in immunoprecipitates of endogenous Arrb2 from unstimulated and Wnt-stimulated
HEK 293T cells. (C) Binding of Dvl2 to Arrb2 was also observed in the absence of exogenous Gb. Myc-Dvl2 co-precipitated equally well with Flag-Arrb2
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 8 January 2014 | Volume 9 | Issue 1 | e87132
essential effector in the Wnt/Ca2+
pathway that is required for the
activation and membrane translocation of PKCa downstream of
Frizzled 7. These results are in contrast to an earlier report [14],
which stated that Arrb2 had no function in Wnt/Ca2+
signaling.
Herein our results clearly show that Arrb2 knock-down achieved
by two different Morpholinos targeting non-overlapping sequences
in the arrb2 mRNA blocked Fzd7-induced PKCa translocation to
the plasma membrane and that overexpressed Arrb2 was capable
to partially induce PKC activation. We also confirmed that the
antisense Morpholinos used in this study efficiently reduced
endogenous Arrb2 protein levels. Overexpression of Arrb2 rescued
Arrb2 MO1 or Arrb2 MO2 and we have also observed a partial
rescue by overexpression of Arrb1, which indicated partial
functional redundancy. This result is consistent with a recent
report showing partial redundancy of Arrb1 and Arrb2 in CE
movements [33]. However, while Arrb2 is expressed at constantly
high levels during gastrulation, Arrb1 mRNA levels decrease
during this phase of development (Figure S3), suggesting that in
gastrulating Xenopus embryos predominantly Arrb2 is required.
In addition to regulating PKCa membrane translocation, we
have shown in this study that the convergent extension phenotype
induced by Arrb2 knock-down was rescued by overexpression of
PKCa or caCamKII and that Arrb2, PKCa or caCamKII rescued
CE movements in Fzd7 morphant explants, further emphasizing
the functional requirement of Arrb2 in Wnt/Ca2+
signaling.
Functional and physical interaction of xArrb2 and Gb
with Dvl
In addition to Frizzled receptors, overexpression of Gb and Gc
[16] induces PKCa translocation, and it has been shown that Dvl
is also able to activate Wnt/Ca2+
signaling [15]. Here, we have
investigated the functional interaction of these effector proteins in
the Wnt/Ca2+
pathway.
Overexpression of Gb and Gc was sufficient to rescue PKCa
activation in embryos injected with fzd7 mRNA and Arrb2 MO1.
In contrast, PKCa translocation blocked by inhibition of Gb
signaling was not rescued by overexpression of Arrb2, indicating
that Gb / Gc signaling is either activated downstream of Frizzled
and b-Arrestin or that b-Arrestin activity is Gb-/ Gc-dependent.
Consistently, Arrb2 only weakly rescued CE movements in
explants treated with PTX, but efficiently rescued the CE
phenotype induced by Frizzled 7 knock-down. Therefore, we
conclude that b-Arrestin2 interacts with trimeric G-proteins to
activate PKCa, which is required for CE movements in Xenopus
gastrulation.
In our own earlier studies, we have demonstrated that bArrestin
physically interacts with Dvl [13]. Here we show that bArrestin2
was able to rescue PKCa membrane translocation and
CE movements in triple Dvl morphant embryos, which is
consistent with the previous studies and further confirmed the
functional interaction of b-Arrestin2 and Dishevelled in Xenopus
gastrulation.
Interaction between Arrb1 and Gb as well as the interaction of
Dvl2 with Gb have also been reported [31,32]. In light of the
functional interactions of b-Arrestin 2, Dvl and Gbc in Wnt/Ca2+
signaling, we hypothesized that these proteins formed a heterotetrameric
complex. We have confirmed that Arrb2 binds to Gb1.
This result was expected because Gb also binds to Arrb1 [31] and
functional redundancy between Arrb1 and Arrb2 was indeed
reported in a recent study by Kim and co-workers [33]. In
addition to Arrb2, we observed that all Xenopus Dvl isoforms,
Dvl1, Dvl2 and Dvl3 physically interacted with Gb1. The
interaction of each Dvl with Gb1 was enhanced in the presence
of Arrb2; moreover, the interaction between Arrb2 and Gb1 was
increased by any Dvl isoform, although Dvl2 seemed to have the
strongest effect on Arrb2-Gb1 binding.
Notably, Arrb2 rescued the Frizzled 7 knock-down and the
triple Dvl phenotype in Xenopus gastrulation movements, but was
not sufficient to restore CE movements in PTX-treated Keller
explants or PKCa translocation to the plasma membrane in
Animal Cap explants overexpressing the Gb-sequestering Cterminus
of b-ARK. Our results further showed that co-expression
of Dvl strongly enhanced the interaction of b-Arrestin2 with Gb
while sequestering Gb interfered with binding between bArrestin2
and Dvl2. Altogether, we conclude that activation of
trimeric G-proteins downstream of Frizzled leads to the formation
of a protein complex consisting of b-Arrestin2, the b and c
subunits of trimeric G-proteins and Dishevelled. In the Wnt/Ca2+
pathway, this complex likely triggers the activation of PKC and
other Ca2+
-dependent effector proteins.
Strikingly, b-Arrestin2 and Dishevelled also interact and are
essential effectors in the Wnt/b-Catenin pathway and in Wnt/
PCP signaling to the small GTPases RhoA and Rac1
[5,7,14,34,35]. Considering that Wnt/Ca2+
and Wnt/PCP
signaling are often required simultaneously [8,9] and are activated
by the same Wnt ligand and Frizzled receptor [3–7] our findings
support a close functional interaction of Wnt/Ca2+
and Wnt/PCP
signaling in the regulation of CE movements in Xenopus embryos.
Moreover, Frizzled receptors, which belong to the superfamily of
G-protein coupled receptors, have recently been shown to interact
with different types of trimeric G-proteins [29], and there is
accumulating evidence that trimeric G-proteins play a role in
apparently all Wnt/Frizzled signaling cascades [28,29,36]. We
have shown here that the beta and gamma subunits of trimeric Gproteins,
which dissociate from the alpha subunit upon activation,
promote the interaction of b-Arrestin2 and Dishevelled, two
proteins that have been identified as essential effectors in Wnt/bCatenin
[13], Wnt/PCP [7,14] and in Wnt/Ca2+
signaling (this
study). Therefore it can be hypothesized that complex formation
involving b-Arrestin2 and Dishevelled and Gbc might be a general
mechanism of trimeric G-protein mediated activation of Wnt
signaling cascades.
Supporting Information
Figure S1 Alignment of arrb2 and arrb1 sequences.
Alignment of the novel sequence stretch of the arrb2 59UTR
including the first 132 nucleotides of arrb2 coding sequence to the
corresponding sequences of arrb2 mRNA (NCBI NM_001092112)
and arrb1 mRNA (NCBI NM_001094402) generated with
ClustalW2. Asterisks indicate nucleotides conserved in all three
sequences; morpholino binding regions are highlighted in light
grey, the start codon is shown as bold and underlined.
(PDF)
Figure S2 (A) Specificity of the Arrb2 MO1 antisense Morpholino
oligonucleotide. The 59 UTR and coding sequence encoding amino
acids 1–180 of arrb2 and the corresponding sequences of the two
arrb1 pseudoalleles identified in gastrula stage embryos and termed
when Gb1 and Gc2 were overexpressed (Gbc) as in the presence of the Gb-sequestering b-ARKct in HEK 293T cells. By contrast, binding of Gb1 to
Arrb2 was impaired by b-ARKct and partially restored by co-expression of Dvl2. (D) When myc-Dvl2 was precipitated, the amount of Flag-Arrb2 and
that of Gb1 that co-precipitated with Dvl2 was significantly reduced by the co-expression of b-ARKct.
doi:10.1371/journal.pone.0087132.g005
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 9 January 2014 | Volume 9 | Issue 1 | e87132
arrb1.a and arrb1.b were were cloned in frame with GFP. All
plasmids were co-injected with either Control MO or Arrb2 MO1
in 2-cell stage embryos and analyzed for expression of the GFP
fusion proteins. An antibody against b-Tubulin served as loading
control. (B–E) Arrb1 only weakly influences PKCa-GFP membrane
translocation. Xenopus embryos were injected with 500 pg pkca-gfp
RNA and co-injected as indicated. PKC-GFP localization was
analyzed in Animal Caps at stage 10 immunostained as indicated;
nuclei stained with Hoechst 33258 (blue). Images show representative
results from at least two independent experiments with a
minimum of six Animal Caps per experiment. Scale bars: 50 mm.
Overexpression of Arrb1 only weakly changed PKCa-GFP
localization (Figure B, C). Consistently, co-injection of myc-arrb1
RNA only partially restored PKCa-GFP membrane association in
Animal Cap explants co-injected with Fzd7 and Arrb2 MO1 (D,
D9: anti-myc, and D": merge). A comparable result was obtained
when myc-arrb1 RNA was co-injected with Fzd7 and Arrb2 MO2
(E, E9: anti-myc, E": merge).
(PDF)
Figure S3 Detection of arrb1 and arrb2 transcripts in
early Xenopus embryos. Total RNA was extracted from
Xenopus embryos of the indicated developmental stages, reverse
transcribed and arrb1, arrb2 and ornithin decarboxylase (odc) transcripts
were amplified from the resulting cDNA. The upper panel shows
the PCR fragments separated by agarose gelelectrophoresis from
one representative experiment. The lower panel shows the
corresponding real-time RT-PCR experiment using a different
set of primer pairs (Illumina Eco Real Time PCR system; primer
sequences are listed in Table S1). Transcription levels of arrb1 and
arrb2 are plotted relative to odc.
(PDF)
Table S1 RT-PCR Primer sequences.
(PDF)
Acknowledgments
The authors are grateful for helpful discussions and support by Andrej
Shevchenko. We further thank Manuel Pauling who helped with the PKC
translocation experiments and Hanh Nguyen for critical reading of the
manuscript. The expression plasmids encoding PKCalpha-GFP, dnPKC,
CamKII K42M, CamKII D286T, HA-Gbeta, HA-Ggamma and betaARKct
were kind gifts of M. Ku¨hl and G. Schulte.
Author Contributions
Conceived and designed the experiments: KS VD VB MG AS. Performed
the experiments: KS VD JH AS. Analyzed the data: KS VD JH VB MG
AS. Wrote the paper: MG AS.
References
1. Klein TJ, Mlodzik M (2005) Planar cell polarization: an emerging model points
in the right direction. Annu Rev Cell Dev Biol 21: 155–176. doi:10.1146/
annurev.cellbio.21.012704.132806.
2. Rao TP, Ku¨hl M (2010) An updated overview on Wnt signaling pathways: a
prelude for more. Circ Res 106: 1798–1806. doi:10.1161/CIRCRE-
SAHA.110.219840.
3. Winklbauer R, Medina A, Swain RK, Steinbeisser H (2001) Frizzled-7 signalling
controls tissue separation during Xenopus gastrulation. Nature 413: 856–860.
doi:10.1038/35101621.
4. Djiane A, Riou J, Umbhauer M, Boucaut J, Shi D (2000) Role of frizzled 7 in the
regulation of convergent extension movements during gastrulation in Xenopus
laevis. Development 127: 3091–3100.
5. Kim G-H, Her J-H, Han J-K (2008) Ryk cooperates with Frizzled 7 to promote
Wnt11-mediated endocytosis and is essential for Xenopus laevis convergent
extension movements. J Cell Biol 182: 1073–1082. doi:10.1083/jcb.200710188.
6. Medina A, Swain RK, Kuerner K-M, Steinbeisser H (2004) Xenopus paraxial
protocadherin has signaling functions and is involved in tissue separation.
EMBO J 23: 3249–3258. doi:10.1038/sj.emboj.7600329.
7. Bryja V, Schambony A, Caja´nek L, Dominguez I, Arenas E, et al. (2008) Betaarrestin
and casein kinase 1/2 define distinct branches of non-canonical WNT
signalling pathways. EMBO Rep 9: 1244–1250. doi:10.1038/embor.2008.193.
8. Pandur P, La¨sche M, Eisenberg LM, Ku¨hl M (2002) Wnt-11 activation of a noncanonical
Wnt signalling pathway is required for cardiogenesis. Nature 418:
636–641. doi:10.1038/nature00921.
9. Gessert S, Ku¨hl M (2010) The multiple phases and faces of wnt signaling during
cardiac differentiation and development. Circ Res 107: 186–199. doi:10.1161/
CIRCRESAHA.110.221531.
10. Kestler HA, Ku¨hl M (2008) From individual Wnt pathways towards a Wnt
signalling network. Philos Trans R Soc Lond, B, Biol Sci 363: 1333–1347.
doi:10.1098/rstb.2007.2251.
11. Kovacs JJ, Hara MR, Davenport CL, Kim J, Lefkowitz RJ (2009) Arrestin
development: emerging roles for beta-arrestins in developmental signaling
pathways. Dev Cell 17: 443–458. doi:10.1016/j.devcel.2009.09.011.
12. Schulte G, Schambony A, Bryja V (2010) beta-Arrestins - scaffolds and signalling
elements essential for WNT/Frizzled signalling pathways? Br J Pharmacol 159:
1051–1058. doi:10.1111/j.1476-5381.2009.00466.x.
13. Bryja V, Gradl D, Schambony A, Arenas E, Schulte G (2007) Beta-arrestin is a
necessary component of Wnt/beta-catenin signaling in vitro and in vivo. Proc
Natl Acad Sci USA 104: 6690–6695. doi:10.1073/pnas.0611356104.
14. Kim G-H, Han J-K (2007) Essential role for aˆ-arrestin 2 in the regulation of
Xenopus convergent extension movements. EMBO J 26: 2513–2526.
doi:10.1038/sj.emboj.7601688.
15. Sheldahl LC, Slusarski DC, Pandur P, Miller JR, Ku¨hl M, et al. (2003)
Dishevelled activates Ca2+ flux, PKC, and CamKII in vertebrate embryos. J Cell
Biol 161: 769–777. doi:10.1083/jcb.200211094.
16. Sheldahl LC, Park M, Malbon CC, Moon RT (1999) Protein kinase C is
differentially stimulated by Wnt and Frizzled homologs in a G-proteindependent
manner. Curr Biol 9: 695–698.
17. Nieuwkoop PD, Faber J (1975) External and internal stage criteria in the
development of Xenopus laevis. Normal Tables of Xenopus laevis: 162–188.
18. Unterseher F, Hefele JA, Giehl K, De Robertis EM, Wedlich D, et al. (2004)
Paraxial protocadherin coordinates cell polarity during convergent extension via
Rho A and JNK. EMBO J 23: 3259–3269. doi:10.1038/sj.emboj.7600332.
19. Schambony A, Wedlich D (2007) Wnt-5A/Ror2 regulate expression of XPAPC
through an alternative noncanonical signaling pathway. Dev Cell 12: 779–792.
doi:10.1016/j.devcel.2007.02.016.
20. Gray RS, Bayly RD, Green SA, Agarwala S, Lowe CJ, et al. (2009)
Diversification of the expression patterns and developmental functions of the
dishevelled gene family during chordate evolution. Dev Dyn 238: 2044–2057.
doi:10.1002/dvdy.22028.
21. Tauriello DVF, Jordens I, Kirchner K, Slootstra JW, Kruitwagen T, et al. (2012)
Wnt/b-catenin signaling requires interaction of the Dishevelled DEP domain
and C terminus with a discontinuous motif in Frizzled. Proc Natl Acad Sci USA
109: E812–E820. doi:10.1073/pnas.1114802109.
22. Koch WJ, Inglese J, Stone WC, Lefkowitz RJ (1993) The binding site for the
beta gamma subunits of heterotrimeric G proteins on the beta-adrenergic
receptor kinase. J Biol Chem 268: 8256–8260.
23. Tada M, Concha ML, Heisenberg CP (2002) Non-canonical Wnt signalling and
regulation of gastrulation movements. Semin Cell Dev Biol 13: 251–260.
24. Keller R (2005) Cell migration during gastrulation. Curr Opin Cell Biol 17:
533–541. doi:10.1016/j.ceb.2005.08.006.
25. Shih J, Keller R (1992) Cell motility driving mediolateral intercalation in
explants of Xenopus laevis. Development 116: 901–914.
26. Ku¨hl M, Geis K, Sheldahl LC, Pukrop T, Moon RT, et al. (2001) Antagonistic
regulation of convergent extension movements in Xenopus by Wnt/beta-catenin
and Wnt/Ca2+ signaling. Mech Dev 106: 61–76.
27. Penzo-Mende`z A, Umbhauer M, Djiane A, Boucaut J-C, Riou J-F (2003)
Activation of Gbetagamma signaling downstream of Wnt-11/Xfz7 regulates
Cdc42 activity during Xenopus gastrulation. Dev Biol 257: 302–314.
28. Koval A, Katanaev VL (2011) Wnt3a stimulation elicits G-protein-coupled
receptor properties of mammalian Frizzled proteins. Biochem J 433: 435–440.
doi:10.1042/BJ20101878.
29. Nichols AS, Floyd DH, Bruinsma SP, Narzinski K, Baranski TJ (2013) Frizzled
receptors signal through G proteins. Cell Signal 25: 1468–1475. doi:10.1016/
j.cellsig.2013.03.009.
30. Chen W, Berge ten D, Brown J, Ahn S, Hu LA, et al. (2003) Dishevelled 2
recruits beta-arrestin 2 to mediate Wnt5A-stimulated endocytosis of Frizzled 4.
Science 301: 1391–1394. doi:10.1126/science.1082808.
31. Yang M, He RL, Benovic JL, Ye RD (2009) beta-Arrestin1 interacts with the Gprotein
subunits beta1gamma2 and promotes beta1gamma2-dependent Akt
signalling for NF-kappaB activation. Biochem J 417: 287–296. doi:10.1042/
BJ20081561.
32. Angers S, Thorpe CJ, Biechele TL, Goldenberg SJ, Zheng N, et al. (2006) The
KLHL12–Cullin-3 ubiquitin ligase negatively regulates the Wnt–b-catenin
pathway by targeting Dishevelled for degradation. Nat Cell Biol 8: 348–357.
doi:10.1038/ncb1381.
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 10 January 2014 | Volume 9 | Issue 1 | e87132
33. Kim G-H, Park EC, Lee H, Na H-J, Choi S-C, et al. (2013) aˆ-Arrestin 1
mediates non-canonical Wnt pathway to regulate convergent extension
movements. Biochem Biophys Res Commun. doi:10.1016/j.bbrc.2013.04.088.
34. Habas R, Dawid IB, He X (2003) Coactivation of Rac and Rho by Wnt/
Frizzled signaling is required for vertebrate gastrulation. Genes Dev 17: 295–
309. doi:10.1101/gad.1022203.
35. Habas R, Kato Y, He X (2001) Wnt/Frizzled activation of Rho regulates
vertebrate gastrulation and requires a novel Formin homology protein Daam1.
Cell 107: 843–854.
36. Katanaev VL, Ponzielli R, Se´me´riva M, Tomlinson A (2005) Trimeric G
protein-dependent frizzled signaling in Drosophila. Cell 120: 111–122.
doi:10.1016/j.cell.2004.11.014.
b-Arrestin Interactions in the Wnt/Ca2+
-Pathway
PLOS ONE | www.plosone.org 11 January 2014 | Volume 9 | Issue 1 | e87132
Figure S1
arrb2 5’UTR+CDS ----------------------------------------GGCTTCCTACTGTGCGTTTGGAACCGTGCGCGACTCCGCGGAGGTGGGAT 50
NM_001092112 arrb2 ------------------------------------------------------------------------------------------
NM_001094402 arrb1 AGCAGCAGCAGCACATTAATCCCGTCCCCTCCTCTCCCTAATCTCCCCGGGATCTGCACAAAAGCACTCGCCTCTCTCGACCCCTGGCAC 90
arrb2 5’UTR+CDS TGGAGCGCGTGAACCCAGAGCAAGCGGAGGAGCTG--------GGAAGATGGGGGAGAGGGCGGGGACCCGGGTTTTCAAGAAATCCAGC 132
NM_001092112 arrb2 -----------------------GAGGAGGAGCTG--------GGAAGATGGGGGAGAGGGCGGGGACCCGGGTTTTCAAGAAATCCAGC 59
NM_001094402 arrb1 TCCTGCACCTCCTGCCTGTCCTCCTGCACCTCCTGCCCCTCCTGCATGATGGGGGACAAAG---GAACCAGAGTATTTAAGAAGGCGAGT 177
* * *** * * ********* * * * *** * ** ** ***** * **
arrb2 5’UTR+CDS CCTAACTGCAAGCTCACCGTGTACCTTGGAAAGCGAGATTTTGTCGATCACCTGGATCGGGTTGATCCTGTGGATGGCGTCGTCCTTGTG 222
NM_001092112 arrb2 CCTAACTGCAAGCTCACCGTGTACCTTGGAAAGCGAGATTTTGTCGATCACCTGGATCGGGTTGATCCTGTGGATGGCGTCGTCCTTGTG 149
NM_001094402 arrb1 CCAAATGGAAAGCTGACTGTTTACTTGGGCAAGAGGGACTTTGTTGATCACGTAGACGTGGTGGATCCTGTGGATGGGGTGGTGTTGGTG 267
** ** * ***** ** ** *** * ** *** * ** ***** ****** * ** *** ************** ** ** * ***
A
xFz7+Arrb2 MO1
+ myc-Arrb1
D PKC-GFP D’ myc-Arrb1 D’’ merge
Arrb1
C PKC-GFPPKC-GFPB
Figure S2
xFz7+Arrb2 MO2
+ myc-Arrb1
E PKC-GFP E’ myc-Arrb1 E’’ merge
Arrb2 (UTR-180)-GFP
Arrb1.a (UTR-181)-GFP
Arrb1.b (UTR-181)-GFP
Control MO
Arrb2 MO 1
+
+ + +
++
++
++
++
50 kDa
50 kDa
unspecific band
Arrb-(1-180/181)-GFP
WB
anti-GFP
WB
anti-Tubulin
4
(8 cell)
8 10 10.5 11 12 -RT
odc
arrb2
arrb1
500 bp
500 bp
500 bp
NF stage
arrb2
arrb1
relativetranscription
1
0.01
0.1
0.001
0.0001
4
(8 cell)
8 10 10.5 11 12 NF stage
Figure S3
Table S1
forward Primer reverse Primer
arrb1_1 tggaaagctgactgtttacttgg atctcaaaggtgaatggataggc
arrb2_1 ctgacaggtctctgcacctagaa caaaggtcgtgagatgttctctg
odc_1 gatgggctggatcgtatcgt tggcagcagtacagacagca
arrb1_2 aggaattcagtgcgtttggtaat caaatatcagcatactggcgaac
arrb2_2 ctatgaaattcgtgccttctgtg attgcctctccgtggtaatagag
odc_2 cattgcagagcctgggagata tccactttgctcattcaccataac
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#18 
 
 
R. de Groot1
; R. Sri Ganji1
; O. Bernatik; B. Lloyd‐Lewis; K. Seipel; K. Šedová; Z. Zdráhal; 
V.M. Dhople; T. Dale; H. Korswagen*, V. Bryja*. Huwe1‐mediated ubiquitylation of Dvl 
defines a novel negative feedback loop in the Wnt signaling pathway. Sci. Signal. (in 
press,  appears  in  March  18,  2014  issue).  Selected  article  highlighted  by  an  online 
podcast interviewing H. Korswagen and V. Bryja. 
1
 equal contribution, *corresponding authors 
 
 
Impact factor (2012): 7.648 
Times cited (without autocitations, WoS, Feb 21st 2014): 0 
Significance: This study identifies a novel negative feedback loop in the Wnt signaling 
pathway.  It  establishes  that  following  activation  and  phosphorylation  by  casein 
kinase 1 epsilon Dvl is ubiquitylated by E3 ligase Huwe1. The ubiquitylation takes 
place in the  DIX domain, sterically prevents Dvl multimerization  and inhibits its 
function. 
Contibution  of  the  author/author´s  team:  We  have  discovered  the  interaction  of 
Huwe1  and  Dishevelled,  and  performed  most  experiments  in  the  mammalian 
experimental system. 
 
 
   
 
 
 
D E V E L O P M E N T A L B I O L O G Y
Huwe1-Mediated Ubiquitylation of Dishevelled
Defines a Negative Feedback Loop in the
Wnt Signaling Pathway
Reinoud E. A. de Groot,1
* Ranjani S. Ganji,2
* Ondrej Bernatik,2,3
Bethan Lloyd-Lewis,4†
Katja Seipel,4‡
Kateřina Šedová,5,6
Zbyněk Zdráhal,5,6
Vishnu M. Dhople,7
Trevor Dale,4
Hendrik C. Korswagen,1§
Vitezslav BryjaAQ1
2,3§
Wnt signaling plays a central role in development, adult tissue homeostasis, and cancer. Several steps
in the canonical Wnt/b-catenin signaling cascade are regulated by ubiquitylation, a protein modification
that influences the stability, subcellular localization, or interactions of target proteins. To identify regulators
of the Wnt/b-catenin pathway, we performed an RNA interference screen in Caenorhabditis elegans and
identified the HECT domain–containing ubiquitin ligase EEL-1 as an inhibitor of Wnt signaling. In human
embryonic kidney 293T cells, knockdown of the EEL-1 homolog Huwe1 enhanced the activity of a Wnt
reporter in cells stimulated with Wnt3a or in cells that overexpressed casein kinase 1 (CK1) or a constitutively
active mutant of the Wnt co-receptor low-density lipoprotein receptor–related protein 6 (LRP6). However,
knockdown of Huwe1 had no effect on reporter gene expression in cells expressing constitutively active
b-catenin, suggesting that Huwe1 inhibited Wnt signaling upstream of b-catenin and downstream of CK1
and LRP6. Huwe1 bound to and ubiquitylated the cytoplasmic Wnt pathway component Dishevelled (Dvl)
in a Wnt3a- and CK1e-dependent manner. Mass spectrometric analysis showed that Huwe1 promoted
K63-linked, but not K48-linked, polyubiquitination of Dvl. Instead of targeting Dvl for degradation, ubiquitylation
of the DIX domain of Dvl by Huwe1 inhibited Dvl multimerization, which is necessary for its function.
Our findings indicate that Huwe1 is part of an evolutionarily conserved negative feedback loop in the Wnt/bcatenin
pathway.
INTRODUCTION
In the canonical Wnt signaling pathway, the stability of the Wnt pathway
effector b-catenin is regulated by a destruction complex, composed of the
adenomatous polyposis coli protein (APC), Axin, casein kinase 1 (CK1),
and glycogen synthase kinase 3b (GSK3b), which phosphorylates b-catenin
and targets it for b-transducin repeat–containing protein (b-TrCP)–dependent
ubiquitylation and proteasomal degradation. Binding of Wnt to the receptors
Frizzled (Fz) and low-density lipoprotein receptor–related protein 6 (LRP6)
leads to inhibition of destruction complex function and accumulation of
b-catenin. b-Catenin can translocate to the nucleus and interact with members
of the T cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription
factors to induce target gene expression (1).
The binding of Wnt to Fz and LRP6 induces clustering of the two receptors
with the cytoplasmic protein Dishevelled (Dvl) into signalosomes
at the plasma membrane (2). Dvl plays a key role during these upstream
events in Wnt pathway activation. Upon Wnt stimulation, Dvl is phosphorylated
by CK1e (3, 4) and Axin is recruited into the Dvl complex.
Subsequent phosphorylation of LRP6 by CK1 and GSK3ß induces binding
of Axin to LRP6 and inhibition of destruction complex function. An important
property of Dvl is that it can multimerize through an N-terminal
DIX domain (5, 6). The formation of such dynamic aggregates is thought
to increase the overall avidity of Dvl for its interaction partners, and mutations
in the DIX domain that interfere with multimerization show strongly
reduced signaling activity (5).
In addition to phosphorylation, Dvl is also regulated by ubiquitylation
(7–9). Ubiquitylation is a versatile posttranslational modification in which
specific E3 ubiquitin ligases mediate the addition of ubiquitin molecules—
either as single ubiquitin proteins or as ubiquitin polymers—to substrate proteins.
Moreover, ubiquitin chains can be linked through different lysines
within the ubiquitin sequence, which further increases the functional diversity
of this modification. Depending on the type of ubiquitylation, the modified
protein is targeted for proteasomal degradation, endocytosed, and
routed into the lysosomal degradation pathway, or is affected in its ability
to interact with other proteins (10). In the case of Dvl, K48-linked polyubiquitylation
by kelch-like family member 12 (KLHL12) controls Dvl stability
(7), but additional ubiquitin modifications may control other aspects of Dvl
function (8, 11).
Here, we identified the E3 ubiquitin ligase Huwe1 as an evolutionarily
conserved inhibitor of the Wnt/b-catenin signaling pathway. We demonstrate
that Huwe1 binds and ubiquitylates Dvl as part of a negative feedback
loop in the Wnt signaling pathway.
1
Hubrecht Institute, Royal Netherlands Academy of Arts and Sciences and University
Medical Center Utrecht, Uppsalalaan 8, 3584CT Utrecht, the Netherlands.
2
Institute of Experimental Biology, Faculty of Science, Masaryk University,
Brno, Czech RepublicAQ2 . 3
Institute of Biophysics, Academy of Sciences of the Czech
Republic, Brno, Czech Republic. 4
Cardiff School of Biosciences, Biomedical
Sciences Building, Museum Avenue, Cardiff CF10 3AX, UK. 5
Central European
Institute of Technology, Masaryk University, Brno, Czech Republic. 6
National
Centre for Biomolecular Research, Faculty of Science, Masaryk University, Brno,
Czech Republic. 7
Department of Functional Genomics, Interfaculty Institute for
Genetics and Functional Genomics, Ernst Moritz Arndt University of Greifswald,
Friedrich-Ludwig-Jahn-Str. 15, 17487 Greifswald, Germany.
*These authors contributed equally to this work.
†Present address: Department of Pathology, University of Cambridge, Tennis
Court Road, Cambridge CB2 1QP, UK.
‡Present address: Department of Clinical Research Medical Oncology, University
of Bern, Bern, Switzerland.
§Corresponding author. E-mail: r.korswagen@hubrecht.eu (H.C.K.); bryja@sci.
muni.cz (V.B.)
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 1
MS no: RA2004985/S/CELL BIOL
RESULTS
Huwe1/EEL-1 is a negative
regulator of Wnt/b-catenin
signaling in Caenorhabditis
elegans and mammalian cells
During larval development in Caenorhabditis
elegans, EGL-20 (a C. elegans Wnt homo-
log)activatesaBAR-1(aC.elegansb-catenin
homolog)–dependent Wnt pathway in the
QL neuroblasts. Activation of this Wnt pathwayinducesexpressionof
thehomeoboxgene
mab-5 in QL and migration of the QL descendant
(QL.d) cells toward the posterior
(12). In the absence of EGL-20 signaling,
mab-5isnotexpressedand,asaconsequence,
the QL.d migrate in the opposite direction,
toward the anterior (F1 Fig. 1A). Using the final
position of the QL.d as a sensitive measure of
b-catenin–dependent Wnt signaling, we performed
an RNA interference (RNAi) screen
inC.elegansthattargeted22predictedE2ubiquitin
ligases, 173 RING domain E3 ubiquitin
ligases, 9 HECT domain E3 ubiquitin ligases,
and 34 deubiquitylating enzymes (DUBs)
(tableS1andfig.S1A).Toscreenforbothpositive
and negative regulators of Wnt signaling,
we used a vps-29(tm1320) mutant background,
in which EGL-20 secretion is reduced, resulting
in a partially penetrant defect in mab-5
expressionandQL.dmigration(13).Interfering
with positive regulators of EGL-20 signaling
enhances this phenotype, whereas knockdown
of negative regulators restores posterior QL.d
migration in this mutant background (14).
We found that knockdown of the HECT
domain–containingubiquitinligaseeel-1suppressed
the QL.d migration phenotype of
vps-29(tm1320) mutants (Fig. 1B). Furthermore,
using a quantitative single-molecule
mRNA fluorescence in situ hybridization
(FISH) approach (15), we found that loss of
eel-1 significantly increased the expression
of the EGL-20 target gene mab-5 in Q neuro-
blasts(Fig.1C),indicatingthatEEL-1functions
as a negative regulator of EGL-20 signaling.
To investigate the function of EEL-1 in
another Wnt-dependent process, we examined
vulva formation, in which Wnt/b-catenin signaling
plays a permissive role in preventing
fusion of the vulva precursor cells (VPCs) with
the surrounding hypodermal syncytium (16).
In hypomorphic mutants of the Wnt secretion
factor mig-14 (the C. elegans Wntless homolog),
a decrease in Wnt signaling leads to a
partially penetrant defect in vulva induction
(17). RNAi against eel-1 significantly rescued
this defect (Fig. 1D), supporting the notion
that EEL-1 functions as a general regulator
of Wnt/b-catenin signaling in C. elegans.
Fig. 1. eel-1isanegativeregulatorofWnt
signaling that acts upstream of b-catenin
in the Wnt pathway in C. elegans. (A)
Dorsal view schematic of the migration
of Q neuroblast descendants in wildtype
L1 larvae and in animals with impaired
or increased EGL-20 signaling.
Schematic of the Wnt pathway regulating
mab-5 expression in Q neuroblasts.
Slashes denote mammalian homologs.
(B) Migration of QL.d cells in vps-
29(tm1320) with either systemic or Q
neuroblast lineage–specific eel-1 knockdown.
Data are means ± SD from three
independent experiments with more
than 30 worms each; *P = 0.0063, **P = 0.0037, Student’s t test. (C) Quantitative single-molecule mRNA
FISH showing the expression of the Wnt target gene mab-5 in QL and QR neuroblasts from wild-type and
eel-1(ok1575) null mutants. Data are amalgamated from two experiments; *P = 4.9 × 10−5
, **P = 9.6 × 10−4
,
Student’s t test. Representative QL and QR neuroblasts are from wild-type animals: nuclei (blue), mab-5
mRNA (red), and Q cells (outlined). Scale bar, 5 µm. (D) Effect of eel-1 RNAi on the vulva defect, indicated
by an arrow. Data are means ± SD from four independent experiments with more than 10 animals each; *P =
0.015. (E and F) Effect of eel-1 RNAi on the response to overexpression of EGL-20 (E) or DN-BAR-1 (F). Data are
means±SDfromfourexperimentswithmorethan30animalseach;*P=0.015,Student’sttest.n.s.,notsignificant AQ9.
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 2
MS no: RA2004985/S/CELL BIOL
To address whether EEL-1 is required in Wnt-responsiveAQ3 cells, we used
a tissue-specific RNAi approach to knock down eel-1 in the Q neuroblast
lineage. Similar to systemic RNAi, knockdown of eel-1 in the Q neuroblasts
significantly rescued QL.d migration in the vps-29 mutant background (Fig.
1B). In contrast, knockdown of eel-1 in EGL-20–producing
cells had no effect (fig. S1B). These results are consistent with a
cell-autonomous function of EEL-1 in Wnt-responsive cells.
To determine the position of EEL-1 in the Wnt/b-catenin
pathway that regulates mab-5 expression in the Q neuroblasts,
we performed epistasis analysis with loss-of-function
mutations in different Wnt pathway components. RNAi against
eel-1 suppressed the QL.d migration phenotype of vps-29
and mig-14 mutants, but had no effect in bar-1 or pop-1/TCF
mutants (table S2). Together with the cell-autonomous function
of EEL-1 in the Q neuroblast lineage, these results place
EEL-1 between the Wnt pathway ligand EGL-20 and bar-1.
This conclusion is further supported by experiments in which
we overexpressed EGL-20 or constitutively active BAR-1
(DN-BAR-1) (17) to induce ectopic expression of mab-5 in
QR and posterior migration of the QR.d. Thus, eel-1 RNAi
strongly enhanced the EGL-20–induced posterior migration
of the QR.d (Fig. 1E), whereas no effect was observed when
DN-BAR-1 was overexpressed (Fig. 1F), consistent with a
function of EEL-1 downstream of EGL-20 but upstream of
BAR-1. eel-1 RNAi did not restore QL.d migration in egl-20
null mutants (table S2), indicating that loss of EEL-1 is not
sufficient to activate the EGL-20 pathway in the absence of
Wnt ligand.
In parallel to the screen in C. elegans, we knocked down
Huwe1, the mammalian ortholog of eel-1, in human embryonic
kidney (HEK) 293T cells stably transfected with a
Dvl–estrogen receptor fusion protein and a TOP-luciferase
TCF reporter (7DF3 cells) (18). We found that knockdown
of Huwe1 (F2 Fig. 2B) enhanced the estradiol-dependent activation
of the TCF reporter (fig. S2A). This effect was confirmed
with nonoverlapping small interfering RNAs (siRNAs)
in 7DF3 and U2OS cells (fig. S2, B and C).
Next, we activated the Wnt pathway in HEK293T cells
with recombinant Wnt3a by expression of constitutively
active N-terminally truncated LRP6 (LRP6DN) (19), coexpression
of Dvl3 and CK1e (3), or expression of constitutively
active b-catenin (20). Knockdown of Huwe1 (Fig. 2B)
increased Wnt reporter activity when the pathway was activated
by Wnt3a, LRP6DN, or Dvl3 and CK1e, but not when
the pathway was activated by expression of constitutively active
b-catenin (Fig. 2, C to F). When we overexpressed a Huwe1
fragment containing the HECT domain [hemagglutinin (HA)–
tagged DN-Huwe1, encompassing the C-terminal half of the
protein from amino acids 2473 to 4374] (21), Wnt reporter
activity induced by Dvl1 or LRP6DN was significantly inhibited,
whereas reporter activity induced by b-catenin was
not changed (Fig. 2, G to I). As an independent readout for
Wnt pathway activity, we assessed the mRNA expression
of the Wnt target gene Axin2 in cells that expressed constitutively
active mutants of b-catenin. Huwe1 overexpression
didnotaffect Axin2expressioninthesecells (Fig.2J).Together
with the C. elegans data discussed above, these results suggest
that Huwe1 functions as an evolutionarily conserved negative
regulator of Wnt signaling that acts upstream of b-catenin in
the Wnt pathway.
Huwe1 binds Dvl
We obtained further mechanistic insight into the role of Huwe1 in Wnt signaling
when we immunoprecipitated endogenous Dvl2 and Dvl3 from
mouse embryonic fibroblasts (MEFs) and analyzed the associated proteins
Fig. 2. Huwe1 is a negative regulator of Wnt signaling that acts upstream of b-catenin in
the Wnt pathway in mammalian cells. (A) Schematic representation of EEL-1 and the
human ortholog Huwe1. (B) Representative Western blot of Huwe1 knockdown efficiency
in HEK293T cells. (C to E) TopFlash reporter activity in Huwe1 knockdown HEK293T cells
that (C) were treated with recombinant Wnt3a, (D) expressed LRP6DN, or (E) expressed
Dvl3 and CK1e. Data are means ± SD from three independent experiments; **P = 0.009,
*P = 0.04, ***P = 0.0062 against controls, Student’s t test. (F) TopFlash reporter activity in
Huwe1 knockdown cells that expressed constitutively active b-catenin mutants. Data are
means ± SEM from seven experiments. (G to I) Effect of HA-DN-Huwe1 overexpression
on TopFlash activity in HEK293T cells expressing (G) Dvl1 (*P = 0.0022), (H) LRP6DN
(*P = 0.015), or (I) b-catenin. Data are means ± SD from at least three independent
experiments. (J) Effect of Huwe1 overexpression on Axin2 mRNA abundance in cells
expressing constitutively active b-catenin mutants. Data are means ± SEM from at least
three independent experiments.
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 3
MS no: RA2004985/S/CELL BIOL
by mass spectrometry (MS) (table S3). We
discovered that Huwe1 formed a complex
with endogenous Dvl2 and Dvl3. To confirm
this result, we performed coimmunoprecipitation
experiments with antibodies
directed against endogenous Huwe1, Dvl2,
and Dvl3 and found that Huwe1 can interact
with Dvl2 as well as Dvl3 (F3 Fig. 3A). Treatment
of cells with Wnt3a conditioned medium
(Wnt3a CM) promoted the interaction
of endogenous Huwe1 with endogenous
Dvl2 and Dvl3 (Fig. 3A). Similar results
were obtained with epitope-tagged versions
of Dvl1 and DN-Huwe1 (fig. S3D). This result
indicates that Wnt signaling promotes
the interaction between Dvl and Huwe1,
but that this interaction does not require
the N terminus of Huwe1.
Dvl proteins form dynamic protein assemblies
that are visible as distinct punctae
within the cytoplasm (6). Consistent with
the interaction between Huwe1 and Dvl,
immunofluorescence experiments using
epitope-tagged or fluorescently tagged versions
of Huwe1 and Dvl2 or Dvl3 showed
that Huwe1, which was diffusely localized
throughout the cytoplasm when expressed
alone, was recruited to Dvl punctae and colocalized
with Dvl2 or Dvl3 when Dvl was
coexpressed (Fig. 3B and fig. S3E). An E3
ligase–deficient Huwe1(CA) mutant also
colocalized with Dvl in cytoplasmic punctae
(Fig. 3B), indicating that the interaction
between Huwe1 and Dvl is independent of
Huwe1 ligase activity.
To further characterize the interaction
between Dvl and Huwe1, we used truncated
forms of Dvl1 and Dvl3 to map the domain
of Dvl that is required for binding to HAtagged
DN-Huwe1. In both cases, we found
that a proline-rich region between the PDZ
and DEP domains of Dvl appeared to be
necessary and sufficient for the interaction
between Huwe1 and Dvl1 and Dvl3 (Fig.
3, C and D, and fig. S3, A to C).
One of the earliest events in Wnt pathway
activation is the CK1e-mediated phosphorylation
of Dvl (22). To address the role
of CK1e in the regulation of the Huwe1Dvl
interaction, we performed coimmunoprecipitation
experiments with FLAG-tagged
Dvl3 and HA-tagged DN-Huwe1 in cells
overexpressing CK1e. CK1e promoted the
Huwe1-Dvl3 interaction, whereas expression
of a dominant-negative CK1e or treatment
with the chemical CK1e inhibitor D4476
(CK1 inhibitor I) or PF-670462 (CK1 inhibitor
II) appeared to reduce this interaction
(Fig. 3E). Together, these results indicate
that Wnt signaling and phosphorylation
Fig. 3. Huwe1 interacts with Dvl.
(A) Western blot detecting interaction
between endogenous Huwe1,
Dvl3,andDvl2inMEFstreatedwith
control or Wnt3aCM.TCL,total cell
lysate. (B) Localization of FLAGHuwe1
and FLAG-Huwe1(CA)
(top row) and colocalization of
FLAG-Huwe1 or FLAG-Huwe1
(CA) with Dvl3-eYFP in cytoplasmic
Dvl punctae. Data are from
three experiments. Scale bars,
20 µm. (C and D) Schematic representation
of coimmunoprecipitation
(co-IP) of HA-DN-Huwe1
with truncated versions of Dvl1
and Dvl3 presented in fig. S2, A
to C. + and − indicate the binding
efficiency of the proteins with
HA-DN-Huwe1. (E) Coimmunoprecipitation of HA-DN-Huwe1 with FLAG-Dvl3 in HEK293T cells expressing
wild-type (wt) or dominant-negative (DN) CK1e or treated with the chemical CK1e inhibitor D4476 (I) or
PF-670462 (II). The efficiency of CK1-mediated phosphorylation was monitored using a phospho-Ser643
Dvl3
antibody. Blot is representative of three experiments.
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 4
MS no: RA2004985/S/CELL BIOL
of Dvl by CK1e promote the interaction between Dvl
and Huwe1.
Huwe1 promotes the ubiquitylation of Dvl
Huwe1 is a HECT domain E3 ubiquitin ligase that ubiquitylates
various substrates and is involved in regulating processes
ranging from apoptosis and neuronal differentiation
to DNA repair (21, 23–27). To investigate whether Huwe1
ubiquitylates Dvl, we coexpressed FLAG-tagged Dvl1 and
His-tagged ubiquitin with DN-Huwe1 or a catalytically inactive
DN-Huwe1(CA) mutant (26). Western blotting for
FLAG-Dvl1 among His-ubiquitin–modified proteins showed
that DN-Huwe1 promoted the ubiquitylation of Dvl1, whereas
DN-Huwe1(CA) didnot (F4 Fig.4A). Expressionoffull-length
Huwe1 (but not catalytically inactive full-length Huwe1) appeared
to induce the ubiquitylation of Dvl3 as well (fig. S4A).
Furthermore, deletion of the proline-rich region of Dvl1 appeared
to prevent its Huwe1-dependent ubiquitylation (fig.
S4B), indicating that binding of Huwe1 to Dvl is required
for its ubiquitylation.
Toinvestigatewhether Wnt signaling regulates the Huwe1mediated
ubiquitylation of Dvl, we treated cells with Wnt3a
CM before the ubiquitylation assay. Wnt3a CM induced a
clear increase in Huwe1-mediated ubiquitylation of FLAGDvl1
(Fig. 4B), indicating that the Huwe1-dependent ubiquitylation
of Dvl is stimulated by Wnt signaling. Because
CK1e activity promoted the interaction between Dvl and
Huwe1 (Fig. 3E), we investigated the effect of CK1e in the
Huwe1-mediated ubiquitylation of Dvl. We found that inhibition
of CK1e reduced FLAG-Dvl1 ubiquitylation in cells
expressing DN-Huwe1 (Fig. 4C), indicating that CK1e activity
promotes the Huwe1-dependent ubiquitylation of Dvl.
To gain further insight into the functional consequences
of Huwe1-mediated ubiquitylation of Dvl, we used an MSbased
approach to identify the lysines of Dvl1 that are ubiquitylated
by Huwe1. We expressed His-tagged ubiquitin
and FLAG-tagged Dvl1, or His-ubiquitin, FLAG-Dvl1,
and DN-Huwe1, in HEK293T cells. We lysed the cells under
denaturing conditions, isolated Dvl by immunoprecipitation,
and prepared the samples for MS analysis. The detection of
ubiquitylated residues in Dvl1 was based on the characteristic
ubiquitin-derived diglycine mass increment of ubiquitylated
peptides (114.1 daltons per modified lysine residue)
after tryptic digestion. In addition to five lysine residues
that were ubiquitylated in the control condition, we found
five additional lysine residues that were ubiquitylated when
DN-Huwe1 was coexpressed (Lys34
, Lys46
, Lys60
, Lys69
, and
Lys412
) (table S4). Most of these lysines were located within
the DIX domain of Dvl (Fig. 4D), suggesting that this
region is preferentially ubiquitylated by Huwe1. In agreement
with this hypothesis, we found that a Dvl1 mutant
(DIX7KR, in which the seven lysines in the DIX domain
were mutated into arginines) was ubiquitylated with a much
lower efficiency by DN-Huwe1 than wild-type Dvl1 or a Dvl1
mutant in which the lysines in the PDZ domain (PDZ3KR)
were mutated (Fig. 4E). Mutation of the lysines within the
DEP domain (DEP6KR) also decreased the amount of
Huwe1-dependent ubiquitylation (Fig. 4E). However, given
that the DEP domain is dispensable for Wnt/b-catenin signaling
(28, 29), the ubiquitylation of the DIX domain is
Fig. 4. Huwe1 promotes Dvl ubiquitylation. (A) Western blotting for FLAG-Dvl1 after pulldown
of His-ubiquitin–modified proteins in HEK293T cells transfected with FLAG-Dvl1,
His-ubiquitin, and DN-Huwe1 or DN-Huwe1(CA). (B) Western blotting of lysates from
cells transfected as in (A), minus the CA Huwe1 mutant, and treated with control medium
or Wnt3a CM for 30 or 60 min before lysis. (C) Western blotting of lysates from the cells
described in (B) treated with vehicle or PF-670462 (CK1 inhibitor II). (D) Schematic representation
of ubiquitylated lysine (K) residues of Dvl1 isolated from controls or cells
expressing HA-DN-Huwe1. (E) Western blotting for FLAG-Dvl1 after pull-down of Hisubiquitin–modified
proteins in HEK293T cells transfected with HA-DN-Huwe1 and FLAGDvl1
mutants containing lysine-to-arginine mutants in the PDZ (PDZ3KR), DEP (DEP6KR),
or DIX (DIX7KR) domains. (F) Schematic representation of ubiquitylated lysine residues of
Dvl conjugated to ubiquitin isolated from cells expressing HA-DN-Huwe1 or control cells.
(G) Abundance of ubiquitylation (by HA tag) in endogenous Dvl3 immunoprecipitates
from HEK293T cells transfected with wild-type HA-ubiquitin or a HA-ubiquitin mutant that
only enables the formation of K63-linked or K48-linked polyubiquitin chains (K63 only
and K48 only) and treated with Wnt3a or control CM. Western blotting data are from three
independent experiments.
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 5
MS no: RA2004985/S/CELL BIOL
likely to be most relevant for the function of Huwe1 in the Wnt/b-catenin
pathway.
The formation of high–molecular weight Dvl species after Huwe1
expression indicates that Huwe1 may promote polyubiquitylation of
Dvl. To characterize the ubiquitin chains that are ligated to Dvl, we
again used an MS-based approach. This time, we analyzed ubiquitinderived
peptides and determined which lysine residues were ubiquitylated
(table S5). In His-ubiquitin– andFLAG-Dvl1–transfected samples, we only
detected peptides with the diglycine signature corresponding to Lys48
(K48)
linkages (Fig. 4F). However, when we expressed DNHuwe1,
there were also peptides for K63 and K11 ubiquitin
linkages (Fig. 4F), indicating that Huwe1 promotes K63and
K11-linked polyubiquitylation of Dvl. To investigate
whether Wnt3a induces the formation of K63-linked polyubiquitin
chains on Dvl, we performed a ubiquitylation assay
with ubiquitin mutants that only enable the formation
of K48- or K63-linked polyubiquitin chains, respectively
(30). Stimulation with Wnt3a increased the amount of Dvl3
decorated with K63-linked polyubiquitin chains, whereas
there was no change in the amount of K48-modified
Dvl3 (Fig. 4G). Given the similarity in the ubiquitin modifications
induced by Wnt3a and Huwe1, we propose that
Huwe1 mediates the Wnt3a-induced K63-linked polyubiquitylation
of Dvl.
Huwe1 does not target Dvl for degradation
but influences Dvl multimerization
We set out to elucidate the mechanism by which the Huwe1dependent
ubiquitylation of Dvl inhibits Wnt signaling.
First, we investigated whether Huwe1 targets Dvl for degradation.
We expressed FLAG-Dvl1 in HEK293T cells together
with HA-DN-Huwe1 or KLHL12, a protein that
recruits the Cullin-3 ubiquitin ligase toward Dvl and targets
Dvl for proteasomal degradation (7). We inhibited protein
translation by incubating the cells with cycloheximide and
determined FLAG-Dvl1 protein expression and stability by
Western blotting. We found no reduction in the amount and
stability of FLAG-Dvl1 when HA-DN-Huwe1 was expressed
(F5 Fig. 5A), but we observed a clear reduction in the amount
and stability of FLAG-Dvl when KLHL12 was coexpressed.
Additionally, we did not observe increased abundance of endogenous
Dvl when we knocked down Huwe1 (Fig. 2B).
These observations agree with our finding that DN-Huwe1
promotes the formation of K63-linked polyubiquitin chains
on Dvl, a modification that in general does not target the
substrate protein for proteasomal degradation (10).
The formation of DIX domain–dependent multimeric
aggregates is essential for Dvl signaling activity (5, 31). Because
Huwe1 promoted the ubiquitylation of the DIX domain
(Fig. 4, D and E), we investigated whether Huwe1
influences the ability of Dvl to multimerize. To this end,
we examined the interaction between different Dvl isoforms
by coimmunoprecipitation. Knockdown of Huwe1 increased
the coimmunoprecipitation between endogenous Dvl2 and
Dvl3 (Fig. 5B), whereas overexpression of HA-tagged DNHuwe1
decreased the coimmunoprecipitation between FLAGtagged
Dvl1 and HA-tagged Dvl2 (Fig. 5D, lanes 1 and 2).
Together, these results indicate that Huwe1 inhibited Dvl
multimerization. This was supported by the observation that
overexpression of HA-tagged DN-Huwe1 reduced the interaction
between cyan fluorescent protein (CFP)–conjugated Dvl3 and yellow
fluorescent protein (YFP)–conjugated Dvl3 in a fluorescence resonance
energy transfer (FRET)–based assay (Fig. 5C and fig. S5A).
To investigate whether Huwe1 inhibited Dvl multimerization through
ubiquitylation of the DIX domain, we tested the coimmunoprecipitation between
HA-tagged Dvl2 and the FLAG-tagged Dvl1-DIX7KR mutant (8).
This mutant activated the Wnt pathway (assessed by a TopFlash reporter)
and localized to punctae in the cytoplasm (fig. S5, B and C), but was only
weakly ubiquitylated by Huwe1 (Fig. 4E). We found that overexpression of
Fig. 5. Huwe1 does not target Dvl for degradation
but inhibits Dvl polymerization.(A) HEK293T cells
transfected with FLAG-Dvl1 and control vector,
KLHL12, or HA-DN-Huwe1 expression constructs
were treated with cycloheximide (CHX) for the
indicated time before lysis and FLAG-Dvl1 detection. (B) Knockdown of Huwe1 increases
coimmunoprecipitation between endogenous Dvl2 and Dvl3. OVCAR-5 cells were transfected
with control or Huwe1 siRNA, and endogenous Dvl2 was immunoprecipitated.
Dvl3present inthecomplex was visualized by Westernblotting. (C) FRETefficiency between
Dvl3-YFP and Dvl3-CFP in HEK293T cells transfected with control or HA-DN-Huwe1 expression
constructs. For typical FRET images, see fig. S4A. (D) Dvl1 was immunoprecipitated
with anti-FLAG antibody, and complex composition was determined by Western blotting.
(E) Structural model of two dimerized DIX domains of Dvl1. Ubiquitylated lysine (K) residues
are indicated in yellow. Mutations known to prevent DIX domain polymerization (M1, M2, and
M4) are indicated in red; b sheets involved in the head (b2)–tail (b4) interaction are labeled.
(F) Model of Huwe1 function in Wnt/b-catenin signaling, described in the text. Yellow circles,
phosphate; orange circles, ubiquitin; blue hexagons, Wnt.
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 6
MS no: RA2004985/S/CELL BIOL
HA-DN-Huwe1 appeared not to decrease the coimmunoprecipitation between
FLAG-tagged Dvl1-DIX7KR and HA-tagged Dvl2 (Fig. 5D, lanes
6 and 7), demonstrating that the inhibitory effect of Huwe1 on Dvl multimerization
is mediated through ubiquitylation of the DIX domain. Templatebased
homology modeling of the human Dvl3 DIX domain showed that
a number of lysines in the DIX domain that are ubiquitylated by Huwe1
are structurally close, or identical to, residues that have previously been
identified as being essential for DIX domain–dependent polymerization
(Fig. 5E). Specifically, Lys34
(corresponding to Lys44
in Dvl2) neighbors
a fully conserved phenylalanine, which is mutated in the M1 aggregation
mutant (Dvl2-F43S) (5). The M1 mutation directly disrupts the “head”
side of the polymerization interface. Second, Lys60
(corresponding to
Lys68
in Dvl2) is part of the b4 sheet forming the tail side of the DIXDIX
polymerization interface. Moreover, mutation in a corresponding residue
in Dvl2 (K68A, corresponding to the aggregation mutant M2) (5)
leads to a clear multimerization defect of Dvl2. We therefore propose that
ubiquitylation of these residues inhibits DIX domain polymerization
through steric effects.
DISCUSSION
Here, we identified the HECT domain–containing E3 ubiquitin ligase
Huwe1 as an evolutionarily conserved inhibitor of the Wnt/b-catenin
pathway. Our results from epistasis experiments in C. elegans and biochemical
studies in mammalian cells suggest that Huwe1 acts by inhibiting
Dvl signaling activity.
The cytoplasmic protein Dvl functions at a key position in the Wnt/bcatenin
pathway, interacting with Fz and Axin to facilitate the formation of
signalosomes at the plasma membrane (32). The signaling activity of Dvl
is promoted by the kinase CK1e, which in response to Wnt signaling
phosphorylates Dvl to induce binding of Dvl to Axin (3, 4, 21, 31). We
have previously shown that in addition to this activating function, CK1e
also triggers a negative feedback loop that inhibits Wnt signaling, but the
mechanism of this inhibition was not determined (3). Our results demonstrate
that CK1e induces the binding of Huwe1 to Dvl and provides a
molecular mechanism for this inhibition (Fig. 5F).
We found that Huwe1 polyubiquitylated lysine residues within the DIX
domain of Dvl. Consistent with our finding that Huwe1 mainly promoted
K63- and K11-linked polyubiquitylation of Dvl, Huwe1 did not target Dvl
for proteasomal degradation. Instead, we found that Huwe1 inhibited the
multimerization of Dvl. As the formation of multimeric complexes is essential
for Dvl activity (5, 31), our results are consistent with a model in
which Huwe1 inhibits Wnt/b-catenin signaling by preventing Dvl multimerization
(Fig. 5F).
Two DUBs—Cyld and USP14—were recently identified that remove
K63-linked polyubiquitin chains from Dvl. Cyld removes polyubiquitin
(including K63-linked polyubiquitin) chains from the DIX domain of
Dvl (8). Inhibition of Cyld function and the resulting hyperubiquitylation
of Dvl activate Wnt/b-catenin signaling in mammalian cells (8). These
results support the notion that K63-linked polyubiquitylation is an important
regulatory mechanism of Dvl activity, but do not explain why Huwe1
and Cyld both act as inhibitors of Wnt/b-catenin signaling. Cyld and Huwe1
may control the ubiquitylation of different lysine residues within the DIX
domain to either promote signaling activity or inhibit signaling by preventing
Dvl multimerization. Alternatively, a tight balance in the dynamic addition
and removal of K63-linked polyubiquitin chains may be required
for the regulation of Dvl activity.
USP14, which also removes K63-linked polyubiquitin chains from Dvl
(34), was identified as a positive regulator of the Wnt pathway. This observation
indicates that it could act as a counterpart to the Huwe1-dependent
negative regulation of Wnt signaling. Whether USP14 removes the polyubiquitin
chains that are generated by Huwe1, however, remains to be
established.
Our study, as well as the work of others, illustrates the importance
of ubiquitin-mediated regulation of Dvl signaling in the Wnt pathway.
Several E3 ubiquitin ligase systems modify Dvl. Thus, Dvl is targeted for
proteasomal degradation by NEDL1, an E3 ligase associated with amyotrophic
lateral sclerosis (35), by KLHL12, an adaptor protein linking
Dvl to the Cullin-3 E3 ubiquitin ligase (7), and by Itch, which is a HECT
domain E3 ligase (9). Thus far, eel-1 in worms or Huwe1 in mammals represents
the only Dvl ubiquitin ligase or DUB with a role in Wnt signaling
that is evolutionarily conserved in both vertebrates and invertebrates. This indicates
that Huwe1 may represent an ancestral mechanism of Dvl regulation.
Last but not least, Huwe1 was recently identified as an important
mediator of Wnt pathway–dependent intestinal tumorigenesis in a mouse
transposon insertional mutagenesis screen (36). Furthermore, sequence information
in the COSMIC database (37) shows that Huwe1 is frequently
mutated in colon cancer. Our results on the function of Huwe1 as an inhibitor
of Wnt/b-catenin signaling—the deregulation of which is the primary
cause of intestinal tumorigenesis (20)—may provide an important
mechanistic explanation for a role of Huwe1 in intestinal cancer.
MATERIALS AND METHODS
C. elegans strains and culture
C. elegans strains were cultured at 20°C under standard conditions as described
(38). The mutants and transgenes used were vps-29(tm1320),
egl-20(hu105), mig-14(ga62), mig-14(mu71), mig-5(rh147), bar-1(ga80),
pop-1(hu9), eel-1(ok1575), muIs32[Pmec-7::gfp], muIs35[Pmec-
7::gfp], huIs7[Phs::DNbar-1], muIs53[Phs::egl-20], heIs63[Pwrt-2::H2b::gfp;
Pwrt2::PH::gfp], huEx273[Pegl-17::eel-1(RNAi)], and huEx274[Pegl-
20::eel-1(RNAi)].
C. elegans RNAi screen
A list of E2 ubiquitin–conjugating genes, DUBs, RING domain–containing
genes, and HECT domain–containing genes was obtained from Kipreos
(39) (table S1). We isolated RNAi clones targeting these genes from the
Vidal or Ahringer RNAi libraries (40, 41). RNAi clones were grown overnight
in LB supplemented with ampicillin (50 mg/ml). Bacterial cultures
were grown for 3 days on NGM plates supplemented with ampicillin,
tetracycline, fungizone, and isopropyl-b-D-thiogalactopyranoside. Two
vps-29(tm1320);muIs32 L4 larvae were placed on the bacterial lawn
and allowed to give rise to progeny. The position of the QL.d cells relative
to the vulva was scored when the progeny reached the young adult stage
(42). If RNAi clones modulated the vps-29 QL.d migration phenotype to
>80% or <11%, the RNAi experiment was repeated twice. RNAi clones
that consistently enhanced or suppressed the vps-29 phenotype were considered
a hit. The RNAi clones were confirmed by sequencing.
C. elegans tissue-specific RNAi and heat
shock experiments
Tissue-specific RNAi was performed as described (43). egl-17 and egl-20
promoter sequences and a 1.1-kb fragment spanning exon 13 of eel-1 were
amplified from C. elegans genomic DNA. The eel-1 fragment was fused
to the promoter fragments in sense and antisense orientations using a polymerase
chain reaction (PCR) approach. The PCR products were injected
in vps-29(tm1320); muIs32 at 2.5 ng/µl with Pmyo2:mCherry injection
marker (7 ng/µl) and pBluescript DNA (200 ng/µl), resulting in transgenic
lines huEx273[Pegl-17::eel-1(RNAi)] and huEx274[Pegl-20::eel-1(RNAi)].
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 7
MS no: RA2004985/S/CELL BIOL
Embryos isolated by bleaching from huIs7 or muIs53 animals grown
on eel-1 or control double-stranded RNA–expressing bacteria were allowed
to hatch overnight in M9 buffer. About 100 L1 larvae were heatshocked
in 100 µl of M9 at 33°C for 5 min, and the position of the Q cell
descendants AVM and PVM was determined when the animals reached the
young adult stage.
Single-molecule mRNA FISH
Single-molecule mRNA FISH was performed as described (15). Imaging
was performed with a Leica DM6000 microscope equipped with a Leica
DFC360FX camera, 100× objective, and Tx2 filter cube. Images were acquired
at 1024 × 1024 resolution and 2 × 2 binned before analysis using
ImageJ. mab-5 mRNA spots were manually counted in the Q neuroblasts
using heIs63 as a marker to outline the cells.
Cell culture, plasmids, and transfections
MEFs and HEK293T cells were propagated in Dulbecco’s modified Eagle’s
medium with 10% fetal bovine serum (FBS), 5% L-glutamine, and 5%
penicillin/streptomycin. OVCAR-5 cells were grown in RPMI medium
with 10% FBS, 5% L-glutamine, and 5%penicillin/streptomycin.Cellswere
seeded in 24-well plates on coverslips for FRETand immunocytochemistry
and 10-cm dishes for immunoprecipitation. Cells were transfected with 2 µl
of polyethylenimine per microgram of DNA. Forty-eight hours after transfection,
cells were harvested and processed. The following previously described
expression constructs were used: Dvl2-Myc (44), FLAG-hDvl3 and
deletions (7), hCK1e (wild-type and P3 dominant-negativeAQ4 ) (45), FLAGmDvl1
deletions and His-ubiquitin lysine mutants (8), HA-ubiquitin mutants
(30), HA-Dvl2(31), HA-DN-Huwe1(21),FLAG-Huwe1 andFLAG-Huwe1
(CA)(27),b-catenin,S33b-catenin,D43b-catenin(20),Lrp6DN(46),Super8X
TopFlash (47), and VSV-KLHL12 (7). Dvl3-EYFP, Dvl3-ECFP, and
FLAG-Dvl1/Dvl3 Pro-rich were generated by Gateway cloning. Cells were
stimulated with mouse rWnt3a (R&D Systems) for 3 hours if not stated
otherwise. Control stimulationswere donewith0.1% bovineserumalbumin
(BSA) in phosphate-buffered saline (PBS). CK1e inhibition was performed
with D4476 (Calbiochem) and/or PF-670462 (Tocris) dissolved in dimethyl
sulfoxide or with 1 ml of Lipofectamine 2000 (Invitrogen) per well to increase
cell penetration.
RNA interference
HEK 293T cells were transfected with Huwe1 endoribonuclease-prepared
siRNA (esiRNA) using Lipofectamine 2000. Huwe1 esiRNA (300 ng per
well) was mixed with Opti-MEM (Gibco) and 0.5 µl of Lipofectamine 2000
and incubated at room temperature for 30 min, after which the mixture was
added to trypsinized cells in 24-well plates. The medium was changed after
12 hours.
Dual luciferase assay
HEK293T cells were seeded in 24-well plates. After 24 hours, cells were
transfected with 0.2 µg of Super8X TopFlash construct and 0.2 mg of
Renilla luciferase construct per well and the indicated expression plasmids.
Cells were lysed 24 hours later, and luciferase activity was measured
with the Dual-Luciferase Reporter Assay System (Promega) on an MLX
luminometer (Dynex Technologies) and normalized by Renilla luciferase
measurements. Data are shown as means ± SD of at least three independent
experiments.
Quantitative reverse transcription PCR
RNA was isolated using TRIzol (Ambion 15596-026) according to the
manufacturer’s instructions. Reverse transcription was performed with
M-MuLV Reverse Transcriptase (Thermo Fisher Scientific), oligo(dT)18
primers (Thermo Fisher Scientific), and 1 µg of RNA for first-strand comple-
mentaryDNAsynthesis.SampleswererunastriplicatesonaLightCycler480
II (Roche). b-Actin was used as an internal control. Primers used were hu-
manACTB(b-actin;forward:5′-GATTCCTATGTGGTCGACGAG-3′,reverse:
AGGGCTGGGGTGTTGAAGGTCTC) and human AXIN2 (forward: 5′TCCATACCGGAGGATGCTGA-3′,
reverse: 5′-TTCATACATCGG-
GAGCACCG-3′).
Antibodies, immunoprecipitation, and Western blotting
Cells were lysed 24 to 48 hours after transfection in NP-40 lysis buffer containing
50 mM tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, and
protease inhibitors (Roche) for 20 min at 4°C and centrifuged at 13,000 rpm
for 30 min at 4°C. Supernatant was incubated with the antibodies against
mouse monoclonal Dvl3 (Santa Cruz Biotechnology), mouse monoclonal
Dvl2 (Santa Cruz Biotechnology), mouse monoclonal FLAG M2 (Sigma),
rabbit polyclonal HA (Abcam), or rabbit polyclonal Huwe1 (Bethyl Laboratories)
for 30 min on ice followed by incubation with protein G–Sepharose
beads AQ5(GE Healthcare) overnight at 4°C. Samples were washed five times in
NP-40 lysis buffer and analyzed by Western blot with antibodies against
mouse monoclonal Myc, goat polyclonal actin, or goat polyclonal Ck1e
(all from Santa Cruz Biotechnology), rabbit polyclonal phospho-Ser643
Dvl3
(Moravian Biotechnology), or mouse monoclonal a-tubulin (Sigma),
followed by horseradish peroxidase–conjugated antibodies against mouse
(GE Healthcare) or rabbit (Sigma) immunoglobulin G (IgG).
Immunocytochemistry
HEK293 cells were seeded onto gelatin-coated coverslips in 24-well plates,
and transfection was carried out after 24 hours. Transfected cells were fixed
after 24 hours in 4% paraformaldehyde for 15 min and blocked with PBTA
(3% BSA, 0.25% Triton, 0.01% NaN3) for 1 hour at room temperature, followed
by incubation in primary antibodies overnight at 4°C. Then, cells were
washed in PBS; incubated with secondary antibodies conjugated to Alexa
488, Alexa 568, or Alexa 594 (Invitrogen) for 1 hour at room temperature;
washed twice with PBS; and mounted in 4′,6-diamidino-2-phenylindole.
Ubiquitylation assay
HEK293T cells were transfected with expression constructs for FLAGDvl1,
His-ubiquitin, and HA-DN-Huwe1; washed 48 hours later in PBS
supplemented with 10 mM N-ethylmaleimide (NEM); lysed in denaturing
guanidium buffer [10 mM tris (pH 8), 0.1 M Na2HPO4, 0.1 M NaH2PO4,
20 mM imidazole, 6 M guanidium-HCl, and 10 mM b-mercaptoethanol];
and sonicated. Ubiquitylation assays were performed as described using
His pull-down (8) or a denaturing immunoprecipitation protocol. Samples
for denaturing immunoprecipitation were lysed in 0.5% SDS, boiled for
8 min, and sonicated. Then, 1 ml of NP-40 lysis buffer supplemented with
protease inhibitors, phosphatase inhibitors, and NEM was added to each
sample. Samples were centrifuged at 16.1g for 30 min. Sixty microliters of
supernatant was reserved for total cell lysate assays, and the rest was used
for incubation with the corresponding antibody. Samples were processed
and analyzed as in standard immunoprecipitation assays. For His pulldown,
the lysate was centrifuged (10 min at 14,000 rpm), and His-tagged
proteins were isolated from the supernatant with Ni-NTA beads (Qiagen)
for 4 hours at room temperature. The beads were washed in guanidium
buffer and three times in ureum buffer before elution of His-tagged proteins
in 1× Laemmli sample buffer supplemented with 10 mM tris (pH 7),
0.1 M Na2HPO4, 0.1 M NaH2PO4, 8 M urea, and 200 mM imidazole.
MS analysis
Samples from the ubiquitylation assays were run on SDS–polyacrylamide
gel electrophoresis to separate the ubiquitylated complexes. Gels were
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 8
MS no: RA2004985/S/CELL BIOL
stained with 0.25% Coomassie blue stain (R250). Corresponding onedimensional
(1D) bands were excised and destained, followed by reduction
and alkylation. Gel pieces were then subjected to digestion by trypsin
for 2 hours at 40°C. Immunoprecipitated Dvl was digested directly in
solution.
Liquid chromatography (LC)–MS/MS analyses of peptide mixtures
were done using the RSLCnano system connected to an Orbitrap Elite mass
spectrometer (Thermo Fisher Scientific). Before LC separation, tryptic digests
were concentrated and desalted using a trapping column (100 mm ×
30 mm) filled with 3.5-mm X-Bridge BEH 130 C18 sorbent (Waters). After
washing with 0.1% formic acid (FA)AQ6 , the peptides were eluted (flow
300 nl/min) from the trapping column onto a Acclaim Pepmap100 C18
analytical column (2-µm particles, 75 mm × 250 mm; Thermo Fisher Scientific)
by the following gradient program: mobile phase A—0.1% FA in
water; mobile phase B—ACN/methanol/2,2,2-trifluoroethanol (6:3:1, v/v/v)
containing 0.1% FA; the gradient elution started at 2% of mobile phase
B and increased from 2 to 45% during the first 90 min (11% in the 30th,
25% in the 60th, and 45% in the 90th min), then increased linearly to
95% of mobile phase B in the next 5 min and remained at this state for
the next 15 min.
MS data were acquired in a data-dependent strategy with dynamic precursor
exclusion selecting up to the top 20 of precursors on the basis of
precursor abundance in the survey scan [350 to 1700 mass/charge ratio
(m/z), resolution 120,000]. Low-resolution collision-induced dissociation
(CID) MS/MS spectra were acquired in rapid CID scan mode.
FRET analysis
Cells were seeded on gelatin-coated coverslips in 24-well plates and
transfected after 24 hours with 0.1 µg of Dvl3-ECFP, 0.1 µg of Dvl3EYFP,
and 0.3 µg of HA-DN-Huwe1 using polyethylenimine. Plasmids
containing fused EYFP and ECFP together were used as additional controls.
The next day, cells were fixed in 4% paraformaldehyde for 15 min
and blocked with PBTA (3% BSA, 0.25% Triton, 0.01% NaN3) for
1 hour at room temperature, followed by incubation in antibodies against
HA overnight at 4°C. Cells were then washed in 0.1 M Pipes (pH 6.9)
and incubated with Alexa 594–conjugated antibody against rabbit IgG
(Invitrogen) at room temperature for 1 hour. Cells were then washed twice
with Pipes solution, once with 2 mM MgCl2, and once with EGTA, followed
by mounting. FRET between Dvl3-ECFP (donor) and Dvl3-EYFP
(acceptor) was measured with a Leica confocal microscope. CFP, YFP,
and Alexa 594 were excited using 455-, 514-, and 590-nm lasers, respectively.
Region of interest was set on Dvl punctae. Dvl3-YFP punctae were
irreversibly bleached for 15 to 30 s. Ratios of donor intensities before and
after photobleaching were calculated to obtain FRETefficiencies. To avoid
heterogeneity in donor and acceptor expression amounts, we performed
experiments three times measuring FRET from 15 to 20 punctae per cell
from 4 to 5 cells.
Image quantification
Western blots from three independent experiments were scanned with
an Epson perfection 4990 photo scanner. Images were digitally inverted,
and band intensities were measured using ImageJ software. Intensities are
represented as arbitrary units in each experiment.
3D structure modeling
The 3D model of hDvl3 DIX domain was generated by template-based
homology modeling using the program PHYRE2 (48), and identified
ubiquitin-modified residues and residues corresponding to M1, M2, and
M4 DIX mutants (5) were mapped and visualized to this 3D model using
the CHIMERA program (49).
SUPPLEMENTARY MATERIALS
www.sciencesignaling.org/cgi/content/full/7/317/ra26/DC1
Fig. S1. eel-1 is a negative regulator of Wnt signaling in C. elegans.
Fig. S2. eel-1/Huwe1 is a negative regulator of Wnt signaling that acts upstream of b-catenin
in the Wnt pathway.
Fig. S3. Huwe1 interacts with Dvl and promotes Dvl ubiquitylation.
Fig. S4. Huwe1 promotes Dvl ubiquitylation.
Fig. S5. Huwe1 inhibits Dvl multimerization.
Table S1. List of DUBs, E2 enzymes, and E3 ubiquitin ligases that were screened for
enhancement or suppression of the vps-29(tm1320)–induced QL.d migration phenotype.
Table S2. Effect of eel-1(RNAi) on the EGL-20/Wnt–dependent migration of the QL.d in
various Wnt pathway mutants.
Table S3. MS analysis of binding partners of Dvl immunoprecipitated from MEFs.
Table S4. MS analysis of ubiquitylated lysine residues of Dvl1.
Table S5. MS analysis of ubiquitin chain linkage ligated to Dvl1.
REFERENCES AND NOTES
1. B. T. MacDonald, K. Tamai, X. He, Wnt/b-catenin signaling: Components, mechanisms,
and diseases. Dev. Cell 17, 9–26 (2009).
2. J. Bilic, Y. L. Huang, G. Davidson, T. Zimmermann, C. M. Cruciat, M. Bienz, C. Niehrs,
Wnt induces LRP6 signalosomes and promotes Dishevelled-dependent LRP6 phosphorylation.
Science 316, 1619–1622 (2007) AQ7.
3. O. Bernatik, R. S. Ganji, J. P. Dijksterhuis, P. Konik, I. Cervenka, T. Polonio, P. Krejci,
G. Schulte, V. Bryja, Sequential activation and inactivation of Dishevelled in the Wnt/bcatenin
pathway by casein kinases. J. Biol. Chem. 286, 10396–10410 (2011).
4. C. M. Cruciat, C. Dolde, R. E. de Groot, B. Ohkawara, C. Reinhard, H. C. Korswagen,
C. Niehrs, RNA helicase DDX3 is a regulatory subunit of casein kinase 1 in Wnt–bcatenin
signaling. Science 339, 1436–1441 (2013).
5. T. Schwarz-Romond, M. Fiedler, N. Shibata, P. J. Butler, A. Kikuchi, Y. Higuchi, M. Bienz,
The DIX domain of Dishevelled confers Wnt signaling by dynamic polymerization.
Nat. Struct. Mol. Biol. 14, 484–492 (2007).
6. T. Schwarz-Romond, C. Merrifield, B. J. Nichols, M. Bienz, The Wnt signalling effector
Dishevelled forms dynamic protein assemblies rather than stable associations with
cytoplasmic vesicles. J. Cell Sci. 118, 5269–5277 (2005).
7. S. Angers, C. J. Thorpe, T. L. Biechele, S. J. Goldenberg, N. Zheng, M. J. MacCoss,
R. T. Moon, The KLHL12–Cullin-3 ubiquitin ligase negatively regulates the Wnt–b-catenin
pathway by targeting Dishevelled for degradation. Nat. Cell Biol. 8, 348–357 (2006).
8. D. V. F. Tauriello, A. Haegebarth, I. Kuper, M. J. Edelmann, M. Henraat, M. R. Canninga-van
Dijk, B. M. Kessler, H. Clevers, M. M. Maurice, Loss of the tumor suppressor CYLD enhances
Wnt/b-catenin signaling through K63-linked ubiquitination of Dvl. Mol. Cell
37, 607–619 (2010).
9. W. Wei, M. Li, J. Wang, F. Nie, L. Li, The E3 ubiquitin ligase ITCH negatively regulates
canonical Wnt signaling by targeting Dishevelled protein. Mol. Cell. Biol. 32,
3903–3912 (2012).
10. Z. J. Chen, L. J. Sun, Nonproteolytic functions of ubiquitin in cell signaling. Mol. Cell
33, 275–286 (2009).
11. C. Gao, Y. G. Chen, Dishevelled: The hub of Wnt signaling. Cell. Signal. 22, 717–727
(2010).
12. M. Silhankova, H. C. Korswagen, Migration of neuronal cells along the anterior–
posterior body axis of C. elegans: Wnts are in control. Curr. Opin. Genet. Dev. 17,
320–325 (2007).
13. M. J. Lorenowicz, M. Macurkova, M. Harterink, T. C. Middelkoop, R. de Groot, M. C. Betist,
H. C. Korswagen, Inhibition of late endosomal maturation restores Wnt secretion in
Caenorhabditis elegans vps-29 retromer mutants. Cell. Signal. 26, 19–31 (2014).
14. M. Harterink, F. Port, M. J. Lorenowicz, I. J. McGough, M. Silhankova, M. C. Betist,
J. R. T. van Weering, R. G. H. P. van Heesbeen, T. C. Middelkoop, K. Basler, P. J. Cullen,
H. C. Korswagen, A SNX3-dependent retromer pathway mediates retrograde
transport of the Wnt sorting receptor Wntless and is required for Wnt secretion.
Nat. Cell Biol. 13, 914–923 (2011).
15. A. Raj, P. Van Den Bogaard, S. A. Rifkin, A. Van Oudenaarden, S. Tyagi, Imaging
individual mRNA molecules using multiple singly labeled probes. Nat. Methods 5,
877–879 (2008).
16. T. R. Myers, I. Greenwald, Wnt signal from multiple tissues and lin-3/EGF signal from
the gonad maintain vulval precursor cell competence in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 104, 20368–20373 (2007).
17. J. E. Gleason, H. C. Korswagen, D. M. Eisenmann, Activation of Wnt signaling
bypasses the requirement for RTK/Ras signaling during C. elegans vulval induction.
Genes Dev. 16, 1281–1290 (2002).
18. K. Ewan, B. Pajak, M. Stubbs, H. Todd, O. Barbeau, C. Quevedo, H. Botfield,
R. Young, R. Ruddle, L. Samuel, A. Battersby, F. Raynaud, N. Allen, S. Wilson,
B. Latinkic, P. Workman, E. McDonald, J. Blagg, W. Aherne, T. Dale, A useful approach
to identify novel small-molecule inhibitors of Wnt-dependent transcription.
Cancer Res. 70, 5963–5973 (2010).
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 9
MS no: RA2004985/S/CELL BIOL
19. K. Brennan, J. M. Gonzalez-Sancho, L. A. Castelo-Soccio, L. R. Howe, A. M. C. Brown,
Truncated mutants of the putative Wnt receptor LRP6/Arrow can stabilize b-catenin
independently of Frizzled proteins. Oncogene 23, 4873–4884 (2004).
20. P. J. Morin, A. B. Sparks, V. Korinek, N. Barker, H. Clevers, B. Vogelstein, K. W. Kinzler,
Activation of b-catenin-Tcf signaling in colon cancer by mutations in b-catenin or APC.
Science 275, 1787–1790 (1997).
21. S. Adhikary, F. Marinoni, A. Hock, E. Hulleman, N. Popov, R. Beier, S. Bernard,
M. Quarto, M. Capra, S. Goettig, U. Kogel, M. Scheffner, K. Helin, M. Eilers, The
ubiquitin ligase HectH9 regulates transcriptional activation by Myc and is essential
for tumor cell proliferation. Cell 123, 409–421 (2005).
22. W. Swiatek, I. C. Tsai, L. Klimowski, A. Pepler, J. Barnette, H. J. Yost, D. M. Virshup,
Regulation of casein kinase Ie activity by Wnt signaling. J. Biol. Chem. 279, 13011–13017
(2004).
23. D. Chen, N. Kon, M. Li, W. Zhang, J. Qin, W. Gu, ARF-BP1/Mule is a critical mediator
of the ARF tumor suppressor. Cell 121, 1071–1083 (2005).
24. A. J. Ross, M. Li, B. Yu, M. X. Gao, W. B. Derry, The EEL-1 ubiquitin ligase promotes
DNA damage-induced germ cell apoptosis in C. elegans. Cell Death Differ. 18,
1140–1149 (2011).
25. X. Zhao, D. D’ Arca, W. K. Lim, M. Brahmachary, M. S. Carro, T. Ludwig, C. C. Cardo,
F. Guillemot, K. Aldape, A. Califano, A. Iavarone, A. Lasorella, The N-Myc-DLL3 cascade
is suppressed by the ubiquitin ligase Huwe1 to inhibit proliferation and promote neurogenesis
in the developing brain. Dev. Cell 17, 210–221 (2009).
26. X. Zhao, J. I. T. Heng, D. Guardavaccaro, R. Jiang, M. Pagano, F. Guillemot, A. Iavarone,
A. Lasorella, The HECT-domain ubiquitin ligase Huwe1 controls neural differentiation
and proliferation by destabilizing the N-Myc oncoprotein. Nat. Cell Biol. 10, 643–653
(2008).
27. Q. Zhong, W. Gao, F. Du, X. Wang, Mule/ARF-BP1, a BH3-only E3 ubiquitin ligase,
catalyzes the polyubiquitination of Mcl-1 and regulates apoptosis. Cell 121, 1085–1095
(2005).
28. J. D. Axelrod, J. R. Miller, J. M. Shulman, R. T. Moon, N. Perrimon, Differential recruitment
of Dishevelled provides signaling specificity in the planar cell polarity and Wingless
signaling pathways. Genes Dev. 12, 2610–2622 (1998).
29. M. Boutros, N. Paricio, D. I. Strutt, M. Mlodzik, Dishevelled activates JNK and discriminates
between JNK pathways in planar polarity and wingless signaling. Cell 94, 109–118
(1998).
30. K. L. Lim, K. C. M. Chew, J. M. M. Tan, C. Wang, K. K. K. Chung, Y. Zhang, Y. Tanaka,
W. Smith, S. Engelender, C. a Ross, V. L. Dawson, T. M. Dawson, Parkin mediates
nonclassical, proteasomal-independent ubiquitination of synphilin-1: Implications for
Lewy body formation. J. Neurosci. 25, 2002–2009 (2005).
31. T. Schwarz-Romond, C. Metcalfe, M. Bienz, Dynamic recruitment of axin by Dishevelled
protein assemblies. J. Cell Sci. 120, 2402–2412 (2007).
32. J. Bilic, Y. L. Huang, G. Davidson, T. Zimmermann, C. M. Cruciat, M. Bienz, C. Niehrs,
Wnt induces LRP6 signalosomes and promotes Dishevelled-dependent LRP6 phosphorylation.
Science 316, 1619–1622 (2007).
33. V. Bryja, G. Schulte, N. Rawal, A. Grahn, E. Arenas, Wnt-5a induces Dishevelled
phosphorylation and dopaminergic differentiation via a CK1-dependent mechanism.
J. Cell Sci. 120, 586–595 (2007).
34. H. Jung, B. G. Kim, W. H. Han, J. H. Lee, J. Y. Cho, W. S. Park, M. M. Maurice,
J. K. Han, M. J. Lee, D. Finley, E. H. Jho, Deubiquitination of Dishevelled by Usp14
is required for Wnt signaling. Oncogenesis 2, e64 (2013).
35. K. Miyazaki, T. Fujita, T. Ozaki, C. Kato, Y. Kurose, M. Sakamoto, S. Kato, T. Goto,
Y. Itoyama, M. Aoki, A. Nakagawara, NEDL1, a novel ubiquitin-protein isopeptide
ligase for Dishevelled-1, targets mutant superoxide dismutase-1. J. Biol. Chem. 279,
11327–11335 (2004).
36. H.N.March,A.G.Rust,N.A.Wright,J.Hoeve,J.DeRidder,M.Eldridge,L.VanDerWeyden,
A. Berns, J. Gadiot, A. Uren, R. Kemp, M. J. Arends, L. F. A. Wessels, D. J. Winton,
D. J. Adams, Insertional mutagenesis identifies multiple networks of cooperating
genes driving intestinal tumorigenesis. Nat. Genet. 43, 1202–1209 (2011).
37. S. A. Forbes, N. Bindal, S. Bamford, C. Cole, C. Y. Kok, D. Beare, M. Jia, R. Shepherd,
K. Leung, A. Menzies, J. W. Teague, P. J. Campbell, M. R. Stratton, P. A. Futreal,
COSMIC: Mining complete cancer genomes in the Catalogue of Somatic Mutations
in Cancer. Nucleic Acids Res. 39, D945–D950 (2011).
38. J. Lewis, J. Fleming, Basic culture methods. Methods Cell Biol. 48, 3–29 (1995).
39. E. T. Kipreos, Ubiquitin-mediated pathways in C. elegans. WormBook 1–24 (2005).
40. J. F. Rual, J. Ceron, J. Koreth, T. Hao, A. S. Nicot, T. Hirozane-Kishikawa, J. Vandenhaute,
S. H. Orkin, D. E. Hill, S. van den Heuvel, M. Vidal, Toward improving Caenorhabditis
elegans phenome mapping with an ORFeome-based RNAi library. Genome Res. 14,
2162–2168 (2004).
41. R. S. Kamath, A. G. Fraser, Y. Dong, G. Poulin, R. Durbin, M. Gotta, A. Kanapin,
N. Le Bot, S. Moreno, M. Sohrmann, D. P. Welchman, P. Zipperlen, J. Ahringer,
Systematic functional analysis of the Caenorhabditis elegans genome using RNAi.
Nature 421, 231–237 (2003).
42. Q. Ch’ng, L. Williams, Y. S. Lie, M. Sym, J. Whangbo, C. Kenyon, Identification of
genes that regulate a left-right asymmetric neuronal migration in Caenorhabditis
elegans. Genetics 164, 1355–1367 (2003).
43. G. Esposito, E. Di Schiavi, C. Bergamasco, P. Bazzicalupo, Efficient and cell specific knockdown
of gene function in targeted C. elegans neurons. Gene 395, 170–176 (2007).
44. J. S. Lee, A. Ishimoto, S. Yanagawa, Characterization of mouse Dishevelled (Dvl) proteins
in Wnt/Wingless signaling pathway. J. Biol. Chem. 274, 21464–21470 (1999).
45. S. Foldynová-Trantírková, P. Sekyrová, K. Tmejová, E. Brumovská, O. Bernatík,
W. Blankenfeldt, P. Krejcí, A. Kozubík, T. Dolezal, L. Trantírek, V. Bryja, Breast cancerspecific
mutations in CK1e inhibit Wnt/b-catenin and activate the Wnt/Rac1/JNK
and NFAT pathways to decrease cell adhesion and promote cell migration. Breast
Cancer Res. 12, R30 (2010).
46. K. Tamai, X. Zeng, C. Liu, X. Zhang, Y. Harada, Z. Chang, X. He, A mechanism for
Wnt coreceptor activation. Mol. Cell 13, 149–156 (2004).
47. M. T. Veeman, D. C. Slusarski, A. Kaykas, S. H. Louie, R. T. Moon, Zebrafish prickle,
a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements.
Curr. Biol. 13, 680–685 (2003).
48. L. A. Kelley, M. J. E. Sternberg, Protein structure prediction on the Web: A case study
using the Phyre server. Nat. Protoc. 4, 363–371 (2009).
49. E. F. Pettersen, T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C. Meng,
T. E. Ferrin, UCSF Chimera—A visualization system for exploratory research and
analysis. J. Comput. Chem. 25, 1605–1612 (2004).
Acknowledgments: We thank X. Wang, R. Moon, M. Maurice, A. Fire, S. Yanagawa,
M. Bienz, X. He, and M. Eilers for expression vectors, and the Caenorhabditis Genetic
Center (University of Minnesota, Minneapolis) for strains. Funding: This work was funded
by the Dutch Cancer Society (HUBR 2008-4114) (R.E.A.G. and H.C.K.), Ministry of Education,
Youth, and Sports of the Czech Republic (MSM0021622430), Czech Science Foundation
(204/09/H058, 204/09/0498, 13-31488P), EMBO (Installation Grant) (V.B. and O.B.),
by the “CEITEC—Central European Institute of Technology” project (CZ.1.05/1.1.00/
02.0068) from the European Regional Development Fund, by CEITEC open access project
(LM2011020), funded by the Ministry of Education, Youth, and Sports of the Czech Republic
under the activity “Projects of major infrastructures for research, development and
innovations” (K.Š. and Z.Z.), and by Cancer Research UK, Merck Serono, Breast Cancer
Campaign, and Tenovus (T.D.). Author contributions: R.E.A.d.G. and H.C.K. designed and
carried out the C. elegans experiments. K.Š., B.L.-L., and T.D. performed functional characterization
of Huwe1. R.S.G., O.B., R.E.A.d.G., and V.B. designed and carried out cell-based
experiments. K.S., Z.Z., and V.M.D. performed MS analysis. R.E.A.d.G., R.S.G., H.C.K.,
and V.B. wrote the manuscript. Competing interests: The authors declare that they have
no competing financial interests. Data and materials availability: C. elegans RNAi data
have been submitted to Wormbase (http://www.wormbase.org) and are also available at
http://www.sci.muni.cz/ofiz/wp-content/uploads/2012/11/De-Groot-2014-Sci-SignalSuppl.Table-1.pdf.
MS data (tables S4 and S5) have been submitted to the PRIDE archive
(http://www.ebi.ac.uk/pride/archive/), accession number XXXXXX AQ8. Data from table S3 are
available at http://www.sci.muni.cz/ofiz/wp-content/uploads/2012/11/De-Groot-2014-SciSignal-Suppl.Table-3.pdf.
Requests for materials should be addressed to H.C.K. and V.B.
Submitted 6 December 2013
Accepted 27 February 2014
Final Publication 18 March 2014
10.1126/scisignal.2004985
Citation: R. E. A. de Groot, R. S. Ganji, O. Bernatik, B. Lloyd-Lewis, K. Seipel, K. Šedová,
Z. Zdráhal, V. M. Dhople, T. Dale, H. C. Korswagen, V. Bryja, Huwe1-mediated ubiquitylation of
dishevelled defines a negative feedback loop in the Wnt signaling pathway. Sci. Signal. 7, ra26
(2014).
R E S E A R C H A R T I C L E
www.SCIENCESIGNALING.org 18 March 2014 Vol 7 Issue 317 ra26 10
MS no: RA2004985/S/CELL BIOL
Supplementary materials
Huwe1-mediated ubiquitylation of Dishevelled defines a negative feedback loop
in the Wnt signaling pathway
Reinoud E.A. de Groot1,8
, Ranjani Sri Ganji2,8
, Ondrej Bernatik2,3
, Bethan Lloyd-
Lewis4#
, Katja Seipel4
, Kateřina Šedová5,6
, Zbyněk Zdráhal5,6
, Vishnu M. Dhople7
,
Trevor Dale4
, Hendrik C. Korswagen1
*, Vitezslav Bryja2,4
*
Figure S1: eel-1 is a negative regulator of Wnt signaling in C. elegans
(A) Hits from the screen for genes with a role in ubiquitylation that enhance or
suppress the QL.d phenotype of vps-29(tm1320) mutants (data are presented mean +/SD
and include results from 3 experiments, n>50 per experiment, * indicates p<0.05
(Student’s t-test)). (B) Migration of QL.d cells in vps-29(tm1320) with eel-1
knockdown by egl-20 promoter-directed expression of eel-1 double-stranded RNA
(dsRNA). Data are mean +/- SD from 3 independent experiments with more than 30
worms in each.
Figure S2 eel-1/Huwe1 is a negative regulator of Wnt signaling that acts
upstream of -catenin in the Wnt pathway. (A) Huwe1 knockdown increases TCF
reporter activity in 7DF3 (Dvl2-ER) cells after estradiol treatment. (B) Huwe1
knockdown using an independent siRNA increases TCF reporter activity in 7DF3
(Dvl2-ER) cells after estradiol treatment. (C) Knock-down of Huwe1 increases
Topflash activity in U2OS cells *p=0.044 **p=0.00034 (Students t-test).
Figure S3. Huwe1 interacts with Dvl and promotes Dvl ubiquitylation. (A-C)
HEK293T cells were transfected with FLAG-Dvl truncation constructs and HA-∆NHuwe1
as indicated. Co-IP efficiency between FLAG-Dvl3 and HA-∆N-Huwe1 was
determined by anti-FLAG immunoprecipitation and subsequent Western blotting.
(A.U.: arbitrary units) (D) HEK293T cells were transfected with a FLAG-Dvl1 and
HA-∆N-Huwe1 and treated with control or Wnt3a conditioned medium. Cells were
lysed and the interaction between FLAG-Dvl1 and HA-∆N-Huwe1 was assayed by
co-immunoprecipitation. (E) Co-localization of FLAG-Huwe1 or FLAG-Huwe1(CA)
and HA-Dvl2 in the cytoplasmic Dvl punctae. Scale bar, 20 μM
Figure S4. Huwe1 promotes Dvl ubiquitylation. (A) Full length Huwe1 or
Huwe1(CA) were transfected with HA-Dvl3 and His-ubiquitin After
immunoprecipitation of His-ubiquitin modified proteins, HA-Dvl3 was detected by
Western blotting. (B) HEK293T cells were transfected with FLAG-Dvl1 truncation
constructs, His-ubiquitin and HA-∆N-Huwe1. After pull-down of His-ubiquitin
modified proteins, FLAG-Dvl1 was detected by Western blotting.
Figure S5. Huwe1 inhibits Dvl multimerization. (A) Example of measurement of
FRET efficiency between Dvl proteins. (B) Punctate subcellular localization of wildtype
FLAG-Dvl1 and the FLAG-Dvl1DIX7KR mutant. (C) Topflash reporter activity
in HEK293T cells expressing wild type Dvl1 or the Dvl1-DIX7KR mutant with or
without CK1ε.
Table S1. List DUBs, E2 enzymes and E3 ubiquitin ligases that were screened for
enhancers or suppressors of the vps-29(tm1320) QL.d migration phenotype.	
_____________________________________________________________________________________
DUB C04E6.5
DUB C08B11.7
DUB C34F6.9
DUB E01B7.1
DUB F07A11.4
DUB F14D2.7
DUB F21D5.2
DUB F28F8.6
DUB F29C4.5
DUB F30A10.10
DUB F35B3.1
DUB F38B7.5
DUB F46E10.8
DUB F59E12.6
DUB H19N07.2
DUB H34C03.2
DUB K02C4.3
DUB K08B4.5
DUB K09A9.4
DUB R10E11.3
DUB T05H10.1
DUB T22F3.2
DUB T24B8.7
DUB T27A3.2
DUB Y106G6H.12
DUB Y40G12A.1
DUB Y50C1A.1
DUB Y71A12B.9
DUB ZK328.1
E2 B0403.2
E2 C06E2.3
E2 C28G1.1
E2 D1022.1
E2 F25H2.8
E2 F29B9.6
E2 F40G9.3
E2 F49E12.4
E2 F58A4.10
E2 M7.1
E2 R01H2.6
E2 R09B3.4
E2 Y110A2AR.2
E2 Y54E5B.4
E2 Y54G2A.31
E2 Y69H2.6
E2 Y71G12B.15
E2 Y87G2A.9
E2 Y94H6A.6
HECT C34D4.14
HECT D2085.4
HECT F36A2.13
HECT F45H7.6
HECT Y39A1C.2
HECT Y48G8AL.1
HECT Y65B4BR.4
HECT Y67D8C.5
Ubox F59E10.2
Ubox T05H10.5
Ubox T09B4.10
RING B0281.3
RING B0281.8
RING B0393.6
RING B0416.4
RING C01B7.6
RING C01G6.4
RING C02B8.6
RING C06A5.8
RING C06A5.9
RING C11H1.3
RING C12C8.3
RING C15F1.5
RING C16C10.5
RING C16C10.7
RING C17E4.3
RING C17H11.6
RING C18B12.4
RING C18H9.7
RING C26B9.6
RING C30F2.2
RING C32D5.10
RING C32D5.11
RING C32E8.1
RING C34E10.4
RING C36A4.8
RING C45G7.4
RING C49H3.5
RING C52E12.1
RING C53A5.6
RING C53D5.2
RING C55A6.1
RING C56A3.4
RING D2089.2
RING F08B12.2
RING F08G12.5
RING F10D7.5
RING F10G7.10
RING F11A10.3
RING F16A11.1
RING F19G12.1
RING F23B2.10
RING F26F4.7
RING F26G5.9
RING F32A6.3
RING F35G12.9
RING F36F2.3
RING F40G9.12
RING F40G9.14
RING F42C5.4
RING F42G2.5
RING F43C11.7
RING F43G6.8
RING F45G2.6
RING F46F2.1
RING F47G9.4
RING F53F8.3
RING F53G2.7
RING F54B11.5
RING F55A11.7
RING F55A3.1
RING F56D2.2
RING F58B6.3
RING F58E6.1
RING H05L14.2
RING H10E21.5
RING K01G5.1
RING K02B12.8
RING K04C2.4
RING K09F6.7
RING K11D12.9
RING K12B6.8
RING M02A10.3
RING M110.3
RING M142.6
RING M88.3
RING R02E12.4
RING R05D3.4
RING R06F6.2
RING R10A10.2
RING T01C3.3
RING T01G5.7
RING T02C1.1
RING T05A12.4
RING T08D2.4
RING T13A10.2
RING T20F5.6
RING T20F5.7
RING T22B2.1
RING T23F6.3
RING T24D1.2
RING T26C12.3
RING W02A11.3
RING W04H10.3
RING Y105C5B.11
RING Y105E8A.14
RING Y38H8A.2
RING Y45F10B.8
RING Y45F10B.9
RING Y47D3B.11
RING Y47G6A.14
RING Y52E8A.2
RING Y53G8AM.4
RING Y55F3AM.6
RING Y57A10B.1
RING Y71F9AL.10
RING Y73C8C.7
RING Y73C8C.8
RING Y75B8A.10
RING Y7A9C.1
RING ZC13.1
RING ZK1240.1
RING ZK1240.2
RING ZK1240.3
RING ZK1240.6
RING ZK287.5
RING ZK637.14
RING ZK809.7
SKR C06A8.4
SKR C42D4.6
SKR C52D10.6
SKR C52D10.7
SKR C52D10.8
SKR C52D10.9
SKR F13A7.9
SKR F44G3.6
SKR F46A9.4
SKR F46A9.5
SKR F47H4.10
SKR F54D10.1
SKR K08H2.1
SKR R12H7.3
SKR R12H7.5
SKR Y105C5B.13
SKR Y37H2C.2
SKR Y47D7A.1
SKR Y47D7A.8
	 	
Table S2. Effect of eel-1(RNAi) on the EGL-20/Wnt dependent migration of the
QL.d in various Wnt pathway mutants	
Control RNAi eel-1 RNAi
% QL.d anterior
Wild type 0 0
mig-14(mu71)/Wls 100 86
vps-29(tm1320)/retromer 33 8
egl-20(hu105)/Wnt 100 100
mig-5(rh147)/Dvl 100 100
bar-1(ga80)/-catenin 100 100
pop1(hu9)/TCF 29 26
The final position of QL.paa (PVM) was scored as anterior or posterior to the vulva in young adult
hermaphrodites using a mec-7::gfp (muIs32) reporter transgene or using Nomarski optics. In each case,
n>50.
	
Table S3. Mass-spectrometric analysis of binding partners of Dvl
immunopresipitated from mouse embryonic fibroblasts
Table S4. Mass-spectrometric analysis of ubiquitylated lysine residues of Dvl1
Table S5. Mass-spectrometric analysis of ubiquitin chain linkage ligated to Dvl1
Sample: Dvl1 +  N-Huwe1
Mass: 8560 Score: 475 Sequences: 9 pI = 6.5 88%
Ubiquitin (gi2627129 polyubiquitin)
Observed Mr(calc) ppm Score Peptide
730.8968 1459.7783 0.50 72 R.LIFAGKQLEDGR.T + UBI_dT K 48
Di-Gly enrichment
Observed Mr(calc) ppm Score Peptide
690.3895 1378.7643 0.19 32 -.MQIFVKTLTGK.T + UBI_dT K 6
698.3866 1394.7592 -0.37 21 -.MQIFVKTLTGK.T + Oxidation (M); UBI_dT K 6
730.8967 1459.7783 0.33 87 R.LIFAGKQLEDGR.T + UBI_dT K 48
459.9943 1835.9489 -0.48 24 K.AKIQDKEGIPPDQQR.L + UBI_dT K 29 or K 33
701.0389 2100.0950 -0.09 22 K.TITLEVEPSDTIENVKAK.I + UBI_dT K 27 or K 29
1122.6013 2243.1910 -1.28 47 R.TLSDYNIQKESTLHLVLR.L + UBI_dT K 63
1201.6381 2401.2588 1.16 58 K.TLTGKTITLEVEPSDTIENVK.A + UBI_dT K 11
841.7784 2522.3129 0.25 24 R.LIFAGKQLEDGRTLSDYNIQK.E + UBI_dT K 48
Sample: Dvl1
Mass: 8560 Score: 243 Sequences: 6 pI = 6.6 85%
Ubiquitin (gi2627129 polyubiquitin)
Observed Mr(calc) ppm Score Peptide
730.8967 1459.7783 0.33 72 R.LIFAGKQLEDGR.T + UBI_dT K 48
Di-Gly enrichment
Observed PTM Mr(calc) ppm Score Peptide
730.8967 1459.7783 0.33 73 R.LIFAGKQLEDGR.T + UBI_dT K 48	
Vítězslav Bryja, 2014    Attachments 
 
 
#19 
 
 
M.B.C Kilander1
, J. Petersen1
, J. Dahlström, R. Sri Ganji, J. Schuster, N. Dahl, V. Bryja, G. 
Schulte.  Preassembly  of  human  Frizzled  6  with  heterotrimeric  Gαi2  is  selectively 
impaired  by  the  pathogenic  Frizzled  6  Arg511Cys  mutation  and  is  regulated  by 
Disheveled. FASEB J. (fj.13‐246363. Published online February 7, 2014). 
1
 equal contribution 
 
 
Impact factor (2012): 5.704 
Times cited (without autocitations, WoS, Feb 21st 2014): 0 
Significance:  Using  life  imaging  this  study  shows  that  alpha  subunits  of  trimeric  G 
proteins are precoupled to Fzd6, a Wnt receptor. This complex rapidly dissociates 
following  Wnt5a  treatment  and  is  tightly  controlled  by  Dishevelled.  The  first 
mechanistic explanation of the role Galpha in Fzd signaling. 
Contibution of the author/author´s team: Biochemical analysis of Dvl‐Frizzled‐Galpha 
interaction. 
   
 
 
 
The FASEB Journal • Research Communication
Disheveled regulates precoupling of heterotrimeric G
proteins to Frizzled 6
Michaela B. C. Kilander,*,1
Julian Petersen,*,1
Kjetil Wessel Andressen,†,‡,§
Ranjani Sri Ganji,ʈ
Finn Olav Levy,†,‡,§
Jens Schuster,¶
Niklas Dahl,¶
Vitezslav Bryja,ʈ,#
and Gunnar Schulte*,ʈ,2
*Section of Receptor Biology and Signaling, Department of Physiology and Pharmacology,
Karolinska Institutet, Stockholm, Sweden; †
Department of Pharmacology, Institute of Clinical
Medicine, University of Oslo and Oslo University Hospital, Oslo, Norway; ‡
K. G. Jebsen Cardiac
Research Centre and §
Center for Heart Failure Research, Faculty of Medicine, University of Oslo,
Oslo, Norway; ʈ
Faculty of Science, Institute of Experimental Biology, Masaryk University, Brno, Czech
Republic; ¶
Department of Immunology, Genetics, and Pathology, Science for Life Laboratory,
Biomedicinskt Centrum (BMC), Uppsala University, Uppsala, Sweden; and #
Department of
Cytokinetics, Institute of Biophysics, Academy of Sciences, Prague, Czech Republic
ABSTRACT Frizzleds (FZDs) are classified as G-protein-coupling
receptors, but how signals are initiated
and specified through heterotrimeric G proteins is
unknown. FZD6 regulates convergent extension movements,
and its C-terminal Arg511Cys mutation causes
nail dysplasia in humans. We investigated the functional
relationship between FZD6, Disheveled (DVL), and heterotrimeric
G proteins. Live cell imaging combined with
fluorescence recovery after photobleaching (FRAP) revealed
that inactive human FZD6 precouples to G␣i1 and
G␣q but not to G␣oA,G␣s, and G␣12 proteins. G-protein
coupling is measured as a 10–20% reduction in the
mobile fraction of fluorescently tagged G proteins on
chemical receptor surface cross-linking. The FZD6
Arg511Cys mutation is incapable of G-protein precoupling,
even though it still binds DVL. Using both FRAP
and Förster resonance energy transfer (FRET) technology,
we showed that the FZD6-G␣i1 and FZD-G␣q
complexes dissociate on WNT-5A stimulation. Most
important, G-protein precoupling of FZD6 and WNT-
5A-induced signaling to extracellular signal-regulated
kinase1/2 were impaired by DVL knockdown or overexpression,
arguing for a strict dependence of FZD6–
G-protein coupling on DVL levels and identifying DVL
as a master regulator of FZD/G-protein signaling. In
summary, we propose a mechanistic connection between
DVL and G proteins integrating WNT, FZD,
G-protein, and DVL function.—Kilander, M. B. C.,
Petersen, J., Andressen, K. W., Ganji, R. S. Levy,
F. O., Schuster, J., Dahl N., Bryja, V., Schulte, G.
Disheveled regulates precoupling of heterotrimeric
G proteins to Frizzled 6. FASEB J. 28, 000–000 (2014).
www.fasebj.org
Key Words: GPCR ⅐ WNT-5A ⅐ GNAI1 ⅐ GNAQ
Wingless/Int-1 (WNT) family lipoglycoproteins, which
activate class Frizzled (FZD1–10) receptors (1–4), are of
central importance in embryonic development and
human disease (5). The mechanisms of signal initiation
from WNT binding to FZD and its interaction with
intracellular signaling compounds and subsequent signaling
specification are as yet poorly understood (2, 4,
6). Two central players, which act directly downstream
of FZDs to initiate several signaling branches, are the
phosphoprotein Disheveled (DVL; ref. 7) and heterotrimeric
G proteins (8).
Ever since the discovery of FZDs and their 7-transmembrane-spanning
architecture, it has been surmised that
they, at least under certain circumstances, can act as
G-protein-coupled receptors (GPCRs; 9, 10). Furthermore,
gain- and loss-of-function approaches in diverse
experimental systems have indicated a functional role of
heterotrimeric G proteins in WNT/FZD signaling (11–
17). More recently, experiments in mammalian cells and
tissue preparations have confirmed that WNTs can evoke
GDP/GTP exchange at heterotrimeric G proteins at
physiological stoichiometry of the involved signaling components,
to mediate responses (e.g., proinflammatory
1
These authors contributed equally to this work.
2
Correspondence: Section of Receptor Biology and Signaling,
Department of Physiology and Pharmacology, Karolinska
Institutet, Nanna Svartz väg 2, S-171 77 Stockholm, Sweden.
E-mail: gunnar.schulte@ki.se
doi: 10.1096/fj.13-246363
This article includes supplemental data. Please visit http://
www.fasebj.org to obtain this information.
Abbreviations: CB1R, cannabinoid 1 receptor; CL, crosslinking;
dcFRAP, dual-color fluorescence recovery after photobleaching;
DIX, Disheveled axin; DVL, Disheveled; ERK1/2,
extracellular signal-regulated kinase 1/2; FRAP, fluorescence
recovery after photobleaching; FRET, Förster resonance energy
transfer; FZD, Frizzled; GFP, green fluorescent protein;
GPCR, G-protein-coupled receptor; i3, third intercellular
loop; MYR, myristoylated; P-ERK1/2, phosphorylated extracellular
signal-regulated kinase 1/2; PTX, pertussis toxin;
ROI, region of interest; SFRP1, secreted Frizzled-related
protein 1; WNT, Wingless/Int-1
10892-6638/14/0028-0001 © FASEB
The FASEB Journal article fj.13-246363. Published online February 7, 2014.
transformation of microglia cells (17–21). However, underlying,
mechanistic details of FZD–G-protein coupling
and subsequent signaling specification remain unclear.
The interface for G-protein interaction on GPCRs lies
mainly within the third intracellular loop (i3) and the C
terminus (22), and thus it overlaps substantially with regions
in FZDs important for DVL interaction (23, 24). FZDmediated
recruitment of DVL is based on at least 3 different
mechanisms: interaction between the unconventional PDZ
ligand domain KTXXXW in the FZD C terminus with the
PDZ domain in DVL (23); protein–protein interaction between
a discontinuous FZD motif in i3 with the DEP (DVL,
EGL-10, and Pleckstrin) domain and the C-terminal domains
of DVL (24); and pH-dependent electrochemical
interaction of the DEP domain of DVL with acidic membrane
lipids (25). The complex regulation of FZD–DVL
interaction and the topological overlap of putative FZD–Gprotein
and FZD–DVL binding sites raise the question of
whether steric hindrance or close cooperation plays a role in
FZD–DVL and FZD–G-protein interaction, signal integration,
and signal specification.
There is some controversy concerning whether
GPCRs are precoupled to heterotrimeric G proteins or
the GPCR–G-protein interaction is based on random
collision (8, 26–28); there is experimental evidence for
both scenarios (28–32). Collision coupling postulates
receptor–G-protein interaction only on receptor activation.
Precoupling of GPCRs with G proteins, however,
more readily explains receptor–G-protein selectivity
and the rapid responses observed in cells (8).
We set out to characterize the FZD6–G-protein coupling
mode and a putative regulatory role of DVL
therein. Our cellular imaging data show that FZD6 is
precoupled to G␣i1 and G␣q and that the receptor–Gprotein
complexes are dissociated by agonist stimulation.
Furthermore, with gain- and loss-of-function experiments,
we found that DVL is required, on the one
hand, for FZD6–G-protein precoupling but that, on the
other hand, high expression levels of DVL are inhibitory.
On the basis of our results, we propose a bimodal
regulatory role of DVL to modulate FZD6-mediated
G-protein precoupling and signaling.
MATERIALS AND METHODS
Cell culture and transfections
HEK293 cells (American Type Culture Collection, Manassas,
VA, USA) were cultured in DMEM supplemented with 10%
FBS, 1% penicillin/streptomycin, 1% l-glutamine (all from
Invitrogen, Carlsbad, CA, USA) in a humidified CO2 incubator
at 37°C. All cell culture plastics were from Sarstedt
(Nümbrecht, Germany) unless otherwise specified. For live
cell imaging and immunochemical and immunoblot analyses,
the cells were seeded on ECM gel-coated (1:300; SigmaAldrich,
Stockholm, Sweden) glass-bottomed dishes (MatTek,
Ashland MA, USA, or Greiner Bio One, Frickenhausen,
Germany; 4-chamber 35-mm glass-bottomed dishes). The
cells were transfected with either Lipofectamine 2000:DNA/
RNA 2:1 (Life Technologies, Gaithersburg, MD, USA), 24–48
h before analysis, or CaPO4, 48–72 h before analysis.
FZD6-green fluorescent protein (GFP) and FZD6-R511CGFP
were constructed as described previously (33). GFPtagged
human FZD6 and FZD6-R511C were recloned into the
pmCherry-N1 vector by using the restriction enzymes BglII
and AgeI. G␣s/␣i1-GFP were provided by Mark Rasenick
(University of Chicago, Chicago, IL, USA; ref. 34); G␣q/oAVenus,
␥-Venus were from Nevin A. Lambert (Georgia Health
Sciences University, Augusta, GA, USA; refs. 29, 35, 36);
G␣12-mCherry was cloned as an N-terminal fusion to the G
protein, according to G␣13-GFP10 (37). DVL1-FLAG was
from Madelon M. Maurice (University Medical Center,
Utrecht, The Netherlands); DVL2-GFP was from Robert J.
Lefkowitz (Duke University Medical Center, Durham, NC,
USA); DVL2-MYC was from S. A. Yanagawa (Kyoto University,
Kyoto, Japan); DVL3-FLAG and deletion mutants were from
Randall T. Moon (University of Washington School of Medicine,
Seattle, WA, USA); DVL2-CFP was from C. Niehrs
(German Cancer Research Center, Heidelberg, Germany);
cannabinoid 1 receptor (CB1R)-mCherry was from Zsolt
Lenkei (Ecole Supérieure de Physique et Chimie Industrielle–
Paristech, Paris, France); and MYR-mCherry was from Jyrki
Kukkonen (Turku University Hospital, Turku, Finland). All
constructs were confirmed by sequencing.
For human DVL silencing, pan-DVL siRNA (AAGUCAACAAGAUCACCUUCU)
targeting position 1450–1468 of human
DVL1, isoform 1; position 1375–1393 of human DVL1,
isoform 2; position 1474–1492 of DVL2; and position 1441–
1459 of DVL3) or Xeragon (Qiagen, Sollentuna, Sweden)
control nonsilencing siRNA (AAUUCUCCGAACGUGUCACGU)
were added simultaneously with DNA plasmids (38).
For all experiments, the cells were transfected at a 3:1:1:1
ratio of receptor:G␣:␤:␥ plasmids or receptor:DVL plasmids
at a ratio of 3:1. For human DVL silencing, pan-DVL siRNA
was added simultaneously with DNA plasmids (38). For
detection of phosphorylated extracellular signal-regulated
kinase 1/2 (P-ERK1/2), cells were seeded in 48-well plates.
siRNA was transfected for 72 h and DVL overexpression for
24 h. The cells were serum-deprived overnight before stimulation
with WNT-5A. Pertussis toxin (PTX) was applied together
with starvation medium. Cell lysates were analyzed by
polyacrylamide gel electrophoresis and immunoblot analysis.
Fluorescence recovery after photobleaching (FRAP),
surface cross-linking (CL), and cellular imaging
Cells on 35-mm glass-bottomed dishes were placed in a
heated (37°C) CO2 (5%) chamber on the stage of a 710
laser-scanning microscope (Zeiss, Jena, Germany). Images
were acquired with ϫ40, 1.2 NA C-Apochromat (Zeiss) objective,
and 488- and 561-nm laser lines were used to excite the
GFP/Venus and mCherry fluorophores, respectively. Photobleaching
was performed by 100% laser illumination of a
2.08- ϫ 2.08-␮m area placed over the cell plasma membrane.
Fluorescence was monitored pre- and postbleach with lowintensity
illumination for 160 s. Average pixel intensity was
measured with ZEN2009/2012 software (Zenwaves Software
Technologies, Tokyo, Japan), corrected for background fluctuations
and bleaching artifacts, and normalized to prebleached
intensity (39). For details, see below.
For dual-color FRAP (dcFRAP) experiments, cell plasma
membrane proteins were immobilized using avidin-biotin CL
(35). Briefly, the cells were incubated in 0.5 mg/ml NHSsulfo-LC-LC-biotin
and 0.1 mg/ml avidin (both from ThermoFisher
Scientific, Kungens Kurva, Sweden) for 15 min each
at room temperature and rinsed 3 times each, before, between,
and after incubations. Washing and incubation were
performed in CL buffer (150 mM NaCl, 2.5 mM KCl, 10 mM
HEPES, 12 mM glucose, 0.5 mM CaCl2, and 0.5 mM MgCl2,
adjusted to pH 8.0).
2 Vol. 28 May 2014 KILANDER ET AL.The FASEB Journal ⅐ www.fasebj.org
To visualize the subcellular localization of the receptor, G
protein, and DVL, alone or in combination (Supplemental
Figs. S1 and S3), living HEK293 cells expressing FZD6mCherry,
G␣i1-GFP, and/or DVL2-CFP were documented
with a confocal microscope (LSM710; Zeiss).
Calculations for FRAP experiments
The recovered mobile fraction (Fm) was calculated as follows:
Fm ϭ (IP Ϫ I0)/(II Ϫ I0), where II is the initial intensity
measured before bleaching, I0 is the immediate postbleaching
fluorescence intensity, and IP is the postbleaching intensity.
The mobile fraction was determined by taking the
average of the fractions obtained between 85 and 105 s.
Acceptor photobleaching Förster resonance energy
transfer (FRET)
HEK293 cells were seeded on Matrigel (BD Biosciences,
Stockholm, Sweden)-coated coverslips in a 24-well plate,
transfected with FZD6-mCherry, ␥-Venus, and untagged ␤ and
G␣ subunits. The cells were left untreated or stimulated with
WNT-5A or PTX before fixation in 4% paraformaldehyde.
FRET between FZD6-mCherry and ␥-Venus was performed on
an LSM710 (Zeiss), with a ϫ63 oil-immersion objective (PlanApochromat,
1.4 NA; Zeiss) by acceptor photobleaching with
100% laser power of a 561-nm diode laser for 20 s. Signal
intensity was routinely reduced by 80–90%. Images were
acquired before and after photobleaching with excitation/
emission ranges of 488/493–545 nm (Venus) and 561/562–
681 nm (mCherry). Quantification of pre- and postbleaching
Venus emission was determined with region of interest (ROI)
analysis in Ն10 individual cells per experiment and condition,
with the ZEN2009/2012 software. Data were background
corrected and adjusted for fluctuations in intensity
with an unbleached ROI as reference. FRET efficiency was
calculated as E ϭ [1 Ϫ (Ipre/Ipost)] ϫ 100%.
Immunoblot analysis
Cells were lysed in 1ϫ loading buffer (10% glycerol; 1% SDS;
100 mM Tris/HCl, pH 7.4; and bromphenol blue) and
electrophoretically separated on 8% SDS-polyacrylamide gels.
Proteins were electrotransferred to PVDF membranes by
using wet blotting. The membranes were blocked in 3%
nonfat milk; the primary antibodies used were mouse antiDVL1
(1:500; sc-133525; Santa Cruz Biotechnology, Santa
Cruz, CA, USA), rabbit anti-DVL2 (1:1000; 3216; Cell Signaling
Technologies, Danvers, MA, USA), mouse anti-DVL3
(1:500; sc-8027; Santa Cruz Biotechnology), mouse anti-FLAG
(1:500; F1804, Sigma-Aldrich), mouse anti-MYC (1:500; sc-40,
Santa Cruz Biotechnology), rabbit anti-P-ERK1/2 (1:2000;
9101L; Cell Signaling Technology), and mouse anti-␤-actin
(1:40 000, A5441; Sigma-Aldrich). The Western Lightning
ECL detection kit (PerkinElmer, Wellesley, MA, USA) was
used for detection of HRP-conjugated secondary antibodies
(Pierce Biotechnology, Rockford, IL, USA, and Sigma-Aldrich).
Immunoblots were quantified by densitometry using
ImageJ software (U.S. National Institutes of Health, Bethesda,
MD, USA). P-ERK1/2 was normalized to ␤-actin signals.
Statistical analysis
Statistical and graphic analyses were performed with Prism 5
software (GraphPad, San Diego, CA, USA). Data were analyzed
by 1-way analysis of variance (ANOVA), with Bonferroni’s post
hoc adjustment for multiple comparisons, or Student’s t test.
Curve fitting of FRAP data was performed with a 2-phase
association nonlinear function according to the least-square
fit. All experiments were repeated Ն3 times; FRAP and FRET
data are based on 20–70 ROIs/data point from Ն3 independent
experiments. Values of P Ͻ 0.05 were considered
significant. Data in FRAP curves and bar graphs (FRAP/
FRET) are presented as means Ϯ sem. Protein sequence
alignment of the C termini of human FZD1–10 was performed
with the STRAP interactive structure-based sequence
alignment program (http://www.bioinformatics.org/strap/)
according to online instructions.
RESULTS
FZD6, G proteins, and DVL colocalize in the
plasma membrane
When the scaffold protein DVL is overexpressed in cells,
the predominant distribution pattern is punctate (Supplemental
Fig. S1). The protein accumulates in membranefree
aggregates on DVL axin (DIX) domain-mediated
multimerization (40). This pattern is disrupted on coexpression
of class Frizzled cell surface receptors, which
results in a distinct membrane association of DVL, as
shown for FZD6 in Fig. 1 and Supplemental Fig. S1.
Coexpression of G␣i1-GFP, FZD6-mCherry, and DVL2CFP
in HEK293 cells resulted in membrane localization of
all 3 molecules (Fig. 1A). In this study, we addressed
whether this colocalization is the basis for functional
interaction by asking whether FZD6 can indeed couple to
heterotrimeric G proteins and what role the DVL protein
plays in FZD–G-protein coupling.
FZD6 is precoupled to heterotrimeric G␣i1 proteins
First, to assess FZD6–G-protein interaction, we implemented
a dcFRAP approach that allows simultaneous
assessment of lateral mobility of 2 fluorescently tagged
proteins (refs. 29, 35 and Fig. 1B–E). The experiments
are based on immobilization of transmembrane proteins
by chemical surface CL. Intracellular proteins,
such as the heterotrimeric G proteins or DVL, are not
directly affected by surface CL in the dcFRAP assay
(Supplemental Fig. S2A–H); their mobility is retarded
only when they interact with immobilized transmembrane
proteins (35). Indeed, CL with sulfo-NHS-LC-LCbiotin
and avidin strongly reduced FZD6 lateral diffusion,
whereas the effects on G␣i1-GFP protein mobility
were weaker but distinct (Fig. 1B–D). Data quantification
revealed an almost complete immobilization of
FZD6-mCherry compared with approximately a onefifth
decrease in G␣i1-GFP mobile fraction (Fig. 1E). To
assure that the observed effects were FZD6-dependent,
to exclude general effects of surface CL on G-protein
mobility, and to control for the possibility that endogenously
expressed and immobilized proteins (e.g.,
other GPCRs) compromise the interpretation of G␣i1GFP
retardation, we combined the expression of myristoylated
mCherry (MYR-mCherry) and G␣i1-GFP as a
no-receptor control. The mobility of neither MYRmCherry
nor G␣i1-GFP was affected by surface immo-
3DVL AS MASTER REGULATOR OF FZD–G-PROTEIN COUPLING
bilization, excluding CL and cross-coupling artifacts. In
addition, we excluded that receptor internalization
distorts the dcFRAP measurements in the time frame of
0–15 min (Supplemental Fig. S2I).
To determine whether FZD6-G␣i1 precoupling can
be disrupted by agonist treatment, as would be predicted
by the ternary complex model (41), we stimulated
HEK293 cells expressing FZD6-mCherry and G␣i1GFP
with WNT-5A, both before and after surface CL
(Fig. 1F). The lack of CL-induced reduction of the
mobile fraction of G␣i1-GFP shows that WNT-5A (300
ng/ml; 15 min) led to dissociation of the FZD6-G␣i1
complex. Similarly, pretreatment with PTX (100 ng/ml
overnight), which ADP ribosylates G␣i/o proteins, impeded
FZD–G-protein precoupling (Fig. 1G). To exclude
that endogenously expressed WNT proteins provide
FZD6-mCherry with a constitutive activating input,
we pretreated the cells with secreted Frizzled-related
protein 1 (SFRP1), which acts through sequestration of
WNTs (Fig. 1H). Recombinant SFRP1 at 10 ␮g/ml, a
dose that efficiently blocks WNT-induced signaling
through heterotrimeric G proteins (17, 19, 42), did not
affect FZD6-G␣i1 precoupling, arguing against WNTinduced
receptor–G-protein complex formation.
Figure 1. dcFRAP in combination with cell surface CL reveals FZD6-G␣i precoupling. A) Confocal imaging revealed that
FZD6-mCherry, G␣i1-GFP, and DVL2-CFP in HEK293 cells colocalized in the cell membrane. HEK293 cells expressing the
individual vectors and FZD6-G␣i and FZD6-DVL2 combinations are shown in Supplemental Fig. S1. Scale bar ϭ 10 ␮m. B)
Photomicrographs of HEK293 cells cotransfected with FZD6-mCherry and G␣i-GFP after surface CL are shown before
(prebleach), directly after (bleach), and 100 s after photobleaching (postbleach). Arrows mark the bleached stretch of the cell
membrane. Scale bar ϭ 2 ␮m. Receptor model clarifies the experimental setup: FZD6-mCherry coexpression with G␣i-GFP. C,
D) FRAP curves for fluorescence recovery of FZD6-mCherry (C) and G␣i-GFP (D), before (gray) and after (red) surface CL. E)
Summary of C, D. For the CL experiments, open bars show quantitation of the mobile fraction of the receptor protein. Solid bars
provide information on the intracellular protein (i.e., G␣i1-GFP). Hatched bars (red) indicate surface CL. Color coding is consistent
throughout the figures. The same experimental approach was used in combination with WNT-5A, PTX and SFRP1: F, G) Acute
stimulation with WNT-5A (300 ng/ml; 15 min; F) and pretreatment with PTX (100 ng/ml overnight; G) dissociated the FZD6-G␣i1
complex in living cells, visualized by lack of retardation of G␣i1-GFP mobility on surface CL of FZD6-GFP. H) SFRP1, acting by
sequestering WNTs, did not affect FZD6-G␣i1 precoupling. Error bars ϭ sem. ns, not significant. ***P Ͻ 0.001 (nϭ3).
4 Vol. 28 May 2014 KILANDER ET AL.The FASEB Journal ⅐ www.fasebj.org
FZD6 is precoupled to G␣i1 and G␣q, but not to
G␣oA, G␣s, and G␣12 proteins
Because the structural basis of receptor–G-protein selectivity
is only poorly understood, we also investigated
the possibility that FZD6 can precouple to other representatives
of the 4 families of heterotrimeric G proteins:
G␣i/o, G␣s, G␣q/11, and G␣12/13 (Supplemental Fig.
S3). Systematic analysis of FZD6-G␣oA, -G␣s, -G␣q, and
-G␣12 mobility by dcFRAP in cotransfection with untagged
␤␥ subunits revealed that FZD6 preferentially
precouples to G␣i1 and G␣q rather than to G␣s, G␣oA,
or G␣12 (Fig. 2A–D). The question arose of whether
E
Figure 2. FZD6 differentially couples to members of the heterotrimeric G-protein
family. A–D) Analogous to the data in Fig. 1C–E, we investigated the effect of
surface CL on mobility of G␣oA-Venus (A), G␣s-GFP (B), G␣q-Venus (C), and
G␣12-mCherry (D). FRAP curves and summarizing bar graphs representative of
Ն3 independent experiments are shown. Receptor models show the experimental
setup. E) dcFRAP methodology was used to analyze FZD6-G␣q coupling in
unstimulated and WNT-stimulated (WNT-5A, 300 ng/ml for 5, 10, and 15 min)
cells, indicating that receptor–G-protein dissociation was rapid and reversible.
Error bars ϭ sem. ns, not significant. **P Ͻ 0.01, ***P Ͻ 0.001 (nϭ3).
5DVL AS MASTER REGULATOR OF FZD–G-PROTEIN COUPLING
FZD6-G␣q complexes also dissociate on WNT-5A treatment.
Therefore, we first analyzed the lateral mobility
of FZD6-mCherry and G␣q-Venus in the presence of
untagged ␤␥ subunits, in the absence and presence of
300 ng/ml WNT-5A for 15 min, as we did for G␣i1. No
difference in precoupling was observed compared with
that in unstimulated cells. However, on kinetic analysis
(5, 10, and 15 min after treatment with WNT-5A) we
observed a rapid and reversible dissociation, which
argues that FZD6-G␣q precoupling was disrupted by
agonist treatment and that the precoupled state was
reestablished after 15 min (Fig. 2E).
Analysis of the FZD6–G-protein complex and its
agonist-induced dissociation by FRET
To support the idea of FZD–G-protein interaction, we
used FRET methodology. Acceptor photobleaching
FRET experiments in fixed HEK293 cells expressing
FZD6-mCherry, ␥-Venus, and untagged G␣i1 and ␤
subunits showed substantial FRET between FZD6mCherry
and ␥-Venus (Fig. 3A), which decreased significantly
on WNT-5A (300 ng/ml; 15 min) or PTX
treatment (100 ng/ml; overnight) (Fig. 3B) indicating
that both agonist treatment and PTX uncoupled the G
protein from the receptor. Similar data were obtained
when the ␣ subunit was replaced with G␣q, and FRET
efficiency was compared in unstimulated and WNT-5Atreated
(300 ng/ml; 5 min) cells (Fig. 3C).
The FZD6 R511C mutation is selectively impaired in
G-protein precoupling
A pathogenic Arg511Cys mutation in human FZD6
(FZD6-R511C), which causes nail dysplasia, is dysfunctional
in WNT-5A signaling (33, 43). Arg511 is highly
conserved among FZD isoforms (Fig. 4A and Supplemental
Fig. S4), and it is close to the DVL-binding
sequence (KTXXXW; aa 498–503 in human FZD6).
Further, Arg511 is located in a basic region (Fig. 4A)
reminiscent of the C-terminal regions present in several
class A GPCRs and is necessary for GPCR–G-protein
interaction (29). To address the role of the FZD6R511C
mutation on G-protein precoupling, we used
dcFRAP with FZD6-R511C-mCherry and either G␣i1GFP
(Fig. 4B, C) or G␣q-Venus (Fig. 4D, E). The mobile
fraction of G␣i1-GFP and G␣q-Venus was unaffected by
CL, indicating that the mutation disturbs FZD6-R511CmCherry’s
precoupling with the G proteins.
After establishing that FZD6 R511C is dysfunctional
regarding precoupling to G␣i1 and G␣q, we investigated
its interaction with DVL. Quantification of FZD–DVL
interactions is notoriously difficult, because cell lysis
disrupts the electrochemical DVL–membrane lipid interactions
necessary for FZD–DVL recruitment. To
circumvent cell lysis and to establish a quantitative assay
to measure FZD–DVL interactions, we used dcFRAP
with cells expressing either FZD6-mCherry or FZD6R511C-mCherry,
together with DVL2-GFP. These experiments
revealed substantial FZD–DVL interaction,
regardless of the Arg511Cys mutation (Fig. 4F–I). In
both wild-type and mutated FZD6, CL reduced the
mobile fraction of both the membrane-expressed receptor
and the pool of membrane-associated DVL2GFP,
thus arguing for strong interaction of FZD6 and
FZD6-R511C with DVL2-GFP. To confirm that reduction
of DVL2-GFP mobility on CL was specific for FZD6,
we combined MYR-mCherry and DVL2-GFP as a noreceptor
control (Supplemental Fig. S2E–H).
DVL is a master regulator of FZD6–G-protein
precoupling
To further investigate the role of DVL for G␣i1 and
G␣q coupling to FZD6, we used loss- and gain-offunction
approaches. First, we downregulated DVL1–3
in HEK293 cells expressing FZD6-mCherry by using a
pan-DVL siRNA designed to target all 3 human isoforms
of DVL (Fig. 5). To investigate the effects of
modified DVL levels on G-protein precoupling to FZD6mCherry
we used the dcFRAP approach combined with
pan-DVL siRNA or DVL1–3 overexpression, creating a
cellular system with low (pan-DVL siRNA), intermediate
(endogenous), and high (overexpression) DVL
levels. In these experiments, reduced DVL1–3 levels
disrupted FZD6-G␣i1 (Fig. 5A) and FZD6-G␣q (Fig. 5F)
protein precoupling. Moreover, irrespective of the DVL
isoform transfected, excess DVL1–3 counteracted
FZD6-G␣i1 (Fig. 5B–D) and FZD6-G␣q (Fig. 5G, H)
precoupling. When visualizing this complex data set in
Figure 3. Analysis of FZD6–G-protein precoupling
and complex dissociation by FRET. A) Receptor
model indicates the FRET occurring between
FZD6-mCherry and ␥-Venus. B, C) Acceptor photobleaching
FRET between FZD6-mCherry and
␥-Venus in the presence of untagged ␤ and G␣i1
(B) or G␣q (C) indicates proximity of receptor
and ␣ subunit supportive of direct physical interaction.
FRET efficiency is strongly reduced on
WNT-5A (300 ng/ml; 15 min, B; 5 min, C) or PTX
(B) treatment, proving complex dissociation/rearrangement
on agonist treatment and PTX-mediated
receptor–G␣i1 protein uncoupling. Data
are from Ն20 cells/condition from 3 independent
experiments. Error bars ϭ sem. ns, not
significant. ***P Ͻ 0.001.
6 Vol. 28 May 2014 KILANDER ET AL.The FASEB Journal ⅐ www.fasebj.org
a single graph correlating G␣i1 and G␣q coupling with
the expression levels of DVL3, it becomes obvious that
DVL levels dramatically influenced coupling efficiency
of heterotrimeric G proteins to FZD6 (Fig. 6). Most
important, we controlled for the FZD selectivity of the
inhibitory effects of high DVL levels by assessing G␣i1
precoupling of a non-FZD GPCR, such as CB1R (44), in
cells with normal DVL levels and in cells overexpressing
DVL3. Even though we could detect a clear CB1R-G␣i1
precoupling comparable to that observed with FZD6,
altered DVL levels did not affect CB1R-G␣i1 precoupling
(Fig. 7).
To identify the structural domains of DVL involved in
the negative regulation of FZD–G-protein precoupling,
we measured FZD–G-protein dcFRAP in cells coexpressing
a set of FLAG-tagged DVL3 deletion mutants
(Fig. 8A). Strikingly, only constructs containing the DIX
domain interfered with G-protein precoupling. The DIX
domain of DVL is known to mediate the DVL–DVL
oligomerization essential in forming high-molecularweight
DVL complexes and signalosomes (45, 46).
WNT-5A-induced G-protein signaling to extracellular
signal-regulated kinase1/2 is tightly regulated by
DVL levels
So far, we know that FZD–G-protein precoupling relies
on balanced levels of DVL (Figs. 5 and 6). Since
FZD6–G-protein coupling was measured with overexpressed
proteins, we asked whether deregulation of
DVL levels also affects WNT-induced signaling through
heterotrimeric G proteins at endogenous receptor expression
levels. Similar to observations in primary microglia
cells, where WNT-5A induced a PTX-sensitive,
Figure 4. Naturally occurring, pathogenic Arg511Cys FZD6 (FZD6-R511C) mutation is not precoupled to G␣i1 or G␣q. A) Protein
sequence alignment of the C termini of human FZD1–10. Red highlights the conserved KTXXXW DVL-binding sequence. Basic
amino acids are blue. Green highlights the conserved residue resembling Arg511 in FZD6. B–E) Analysis of FZD6-R511CmCherry
in a dcFRAP setting shows that the mutated FZD6 did not precouple to G␣i1-GFP (B, C) or G␣q-Venus (D, E). Lack of
FZD6-R511C-mCherry and G␣i1-GFP and G␣q-Venus interaction is visualized by reduced G-protein retardation after CL. F, G)
Quantitative analysis of the mobile fractions of FZD6-mCherry and DVL2-GFP in dcFRAP experiments before and after surface
CL indicates interaction between the 2 proteins in living cells visualized by the retardation of DVL2 mobility after CL. H, I)
dcFRAP analysis of FZD6-R511C-mCherry and DVL2-GFP shows that the receptor mutation did not affect the FZD–DVL
interaction in living cells. For color coding, see Fig. 1. Error bars ϭ sem. ns, not significant (nՆ3). ***P Ͻ 0.001.
7DVL AS MASTER REGULATOR OF FZD–G-PROTEIN COUPLING
G␣i/o-dependent phosphorylation of extracellular signal-regulated
kinases 1/2 (P-ERK1/2; ref. 17), we detected
a time-dependent and PTX-sensitive increase in
P-ERK1/2 in HEK293 cells stimulated with 300 ng/ml
WNT-5A (Fig. 9A, B). Basal P-ERK1/2 levels were
normalized to 100%, and the maximum WNT-5Ainduced
response was 164.5 Ϯ 18.3% (meanϮsem) at
10 min of exposure to WNT-5A. Whereas PTX reduced
the WNT-5A-induced response to 113.8 Ϯ 4.5%, overexpression
of DVL1-FLAG resulted in only a 102.3 Ϯ
7.9% P-ERK1/2 response. Maximum ERK1/2 phosphorylation
is observed at 10 min, returning toward
baseline 20 min after WNT-5A exposure. When overexpressing
FLAG-DVL1 and on pan-DVL siRNA treatment
(100.4Ϯ11.8%), the WNT-5A-induced P-ERK1/2 response
was completely abrogated (Fig. 9A, B), thus
arguing that a balance in DVL levels is essential, not
only for receptor–G-protein precoupling, but also for
the initiation of downstream signaling. Transfection
with control siRNA did not affect the WNT-5A-induced
P-ERK1/2 response (154.6Ϯ12.5%).
DISCUSSION
We used cellular imaging to define the mechanisms of
FZD–G-protein coupling in unprecedented detail and
resolution. We identified FZD6 as a GPCR that is
precoupled to the G␣i and G␣q proteins and pinFigure
5. Perturbation of cellular DVL levels abrogates
FZD6-G␣i1 and FZD6-G␣q precoupling. A–J) FZD6-G␣i1
(A) and FZD6-G␣q (F) precoupling was disrupted by
down-regulation of all DVL isoforms with pan-DVL siRNA,
suggesting that DVL is essential for FZD6-G␣i1 protein
precoupling. Overexpression of DVL1 (B, G), DVL2 (C,
H), and DVL3 (D, I) prevented the CL-induced retardation
of G␣i1-GFP (B–D) and G␣q-GFP (F–I), suggesting
that high local concentration of DVL disrupts FZD6-G␣
precoupling. Receptor schemes (E, J) clarify the experimental
approach used in B–D and F–I, respectively: dcFRAP with FZD6-mCherry and G␣i1-GFP (B–D) or G␣q-Venus (F–I).
K, L) Immunoblot analysis confirms knockdown (K) and overexpression (L) of DVL isoforms. Endogenous DVL was
detected with isoform-selective antibodies. Overexpressed DVL was detected with antibodies against the epitope tag
(FLAG/MYC) fused to DVL isoforms. ␤-Actin was the loading control. For color coding, see Fig. 1. Error bars ϭ sem. ns,
not significant (nՆ3). ***P Ͻ 0.001.
Figure 6. DVL as a master regulator of FZD–G-protein coupling.
A) Data sets from Figs. 1A, 2G, and 5A, D, F, I are
compiled in a single bar graph relating FZD–G-protein coupling
efficiency (left y axis) to cellular DVL levels (right y axis;
red). Error bars ϭ sem. B) Representative blot used for the
assessment of DVL3 expression from A in cells with low
(pan-DVL siRNA), intermediate (endogenous) and high
(DVL3-FLAG overexpression) DVL levels. ␤-Actin was the
loading control. Each red dot in A represents DVL3 levels
from 1 experiment; DVL levels are relative, with endogenous
DVL3 levels set to 1.
8 Vol. 28 May 2014 KILANDER ET AL.The FASEB Journal ⅐ www.fasebj.org
pointed DVL as a master regulator of functional FZD–
G-protein coupling. Based on our data, we suggest a
higher-order complex model, integrating WNT, FZD,
heterotrimeric G proteins, and DVL as essential components
for WNT/FZD signaling (Fig. 9C), where a
delicate balance between heterotrimeric G proteins
and DVL levels determines signaling outcome. DVL, on
the one hand, is required for FZD–G-protein coupling,
but, on the other hand, it has a negative regulatory
function. So far, the mechanistic details of this bimodal,
somewhat paradoxical action of DVL on FZD6–G-protein
precoupling remain obscure; further studies are
needed to determine how DVL can be required for
GPCR–G-protein precoupling and also act as a negative
regulator.
Even though the underlying mechanisms of FZD’s
interaction with the membrane-tethered heterotrimeric
G proteins are still a matter of debate (2, 4, 47),
functional data obtained over the years strongly argue
that FZDs can signal as GPCRs (2, 4, 9, 11, 13, 14, 16,
19, 20, 43, 48–51). In addition, a bioinformatic analysis
suggested that FZD6 couples to the G␣i/o family of
heterotrimeric G proteins (52), predictions that were
later experimentally confirmed (21). The dcFRAP assay,
which has been used to investigate GPCR–G-protein
interactions (29, 35), presents a powerful tool to
assay dynamic protein–protein interactions. To further
support FZD–G-protein interaction, we complemented
our dcFRAP analysis with FRET measurements (Fig. 3),
which provided evidence for close interaction between
Figure 8. DIX domain of DVL is responsible for the
negative regulation of FZD6–G-protein precoupling.
A) dcFRAP analysis in FZD6-mCherry–G␣i1-GFP, and
FZD6-mCherry–G␣q-Venus–transfected cells coexpressing
DVL3-FLAG deletion mutants revealed a
selective, negative effect of the DVL DIX domain on
FZD6–G-protein coupling. Error bars ϭ sem. ns, not
significant. *P Ͻ 0.05, **P Ͻ 0.01, ***P Ͻ 0.001. B)
Summary of the data shown in the bar graphs. For
color coding, see Fig. 1.
Figure 7. CB1R-G␣i1 protein precoupling is not
disturbed by DVL overexpression. A, B) To control
for the FZD selectivity of the DVL-mediated
block of GPCR–G-protein precoupling, we used
dcFRAP to assess CB1R precoupling to G␣i1 in the
absence (A) and presence (B) of DVL3 overexpression.
C) Scheme clarifies the experimental
approach of CB1R-mCherry–G␣i1-GFP dcFRAP.
For color coding, see Fig. 1. Error bars ϭ sem
(nϭ3). ***P Ͻ 0.001.
9DVL AS MASTER REGULATOR OF FZD–G-PROTEIN COUPLING
receptor and G protein, FZD6-G␣i1/FZD6-G␣q precoupling,
and the agonist-/PTX-induced disruption of the
receptor–G-protein complex. In contrast to the dcFRAP
assay, FRET analysis argues for proximity and
therefore in favor of conventional FZD-␤␥–G␣i1 and
FZD-␤␥–G␣q interaction in a precoupled state, since
the required distance for resonance energy transfer to
occur is Ͻ10 nm (53); thus, the complementary FRET
experiments validate our conclusions from the dcFRAP
experiments. The other way around, a decrease in
FRET does not necessarily support physical dissociation
of two interacting G proteins but could also monitor
structural rearrangement. The dcFRAP assay in combination
with agonist stimulation, on the other hand,
strongly supports dissociation of the precoupled receptor–G-protein
complex, since the CL-based retardation
of the intracellular partner originates from interaction
with the immobilized transmembrane receptor (35). In
addition, the inhibitory effect of PTX on FZD6-G␣i1
precoupling strongly argues for direct GPCR–G-protein
interaction, since ADP ribosylation of the far C terminus
of the G protein interferes with complex formation.
WNT-induced dissociation of an FZD–G-protein-DVL
complex has been detected biochemically in L929 cells
(54), however, without providing any mechanistic information
on either the role of DVL or the FZD isoform
involved.
Further, the differential coupling of FZD6 to some,
but not all, heterotrimeric G proteins expressed at
comparable levels serves as an internal control for the
specificity of the dcFRAP assay, which apparently is not
compromised by forced coexpression. Interestingly, the
mutant FZD6-R511C selectively interacts with DVL but
not heterotrimeric G proteins. This phenomenon
could, in addition to the localization phenotype of the
mutant, explain the dysfunction of this receptor in nail
development (33). On the other hand, this phenotype
may allow some speculation on the receptor’s structure.
Introduction of a Cys at position 511 could very well
induce an additional lipid anchor, which might distort
helix 8. This cytoplasmic domain on the FZD terminus
is located in the amino acid stretch of the KTXXXW
sequence, as concluded from the recently published
crystal structure of Smoothened, a closely related class
Frizzled receptor (55), as well as from structural analysis
of the FZD1 C-terminal peptide in detergent micelles
(56). This hypothetical distortion induced by the additional
Cys could affect G-protein precoupling, in agreement
with the role of helix 8 for G-protein coupling
and selectivity in other GPCRs (57). However, this
mutation and the putative distortion of helix 8 apparently
do not lead to a substantial decrease in FZD–DVL
affinity, which may be explained by the multimodal
interaction between DVL and FZD.
Classic GPCRs, such as CB1Rs, are known to exist in
a precoupled state (8, 30, 45, 58–60). Based on the
strong FZD–G-protein association, as measured by dcFRAP,
and the PTX sensitivity of FZD6-G␣i1 interaction,
we conclude that we measure FZD–G-protein precoupling
as a mode of receptor interaction with the
GDP-bound, inactive G protein. This precoupling between
FZD6 and G␣i1/G␣q appears rather stable, since
it can be resolved by dcFRAP measurements, indicating
a low degree of dynamics in the absence of receptor
activation. The sensitivity to PTX argues either that the
C terminus of the G protein is not permanently buried
Figure 9. WNT-5A-induced ERK1/2 phosphorylation is G protein dependent and subject to regulation by DVL. A) WNT-5A (300
ng/ml) induced a time-dependent increase in P-ERK1/2 in native HEK293 cells. PTX completely blocked WNT-5A-induced
P-ERK1/2, whereas overexpression of DVL1-FLAG completely abrogated WNT-5A-induced P-ERK1/2. Bar graph summarizes
optical density data (P-ERK1/2 normalized to ␤-actin; nՆ3). *P Ͻ 0.05, **P Ͻ 0.01. B) Representative immunoblots. C) We
propose a higher-order complex model, where DVL levels dictate FZD6–G-protein coupling and thereby functionally integrate
G-protein signaling (e.g., to ERK1/2). Stoichiometry of the receptor–G-protein–DVL complex remains unclear.
10 Vol. 28 May 2014 KILANDER ET AL.The FASEB Journal ⅐ www.fasebj.org
in the receptor (since PTX would not be able to access
it there) or that the interaction shows slow dynamics
over time, allowing PTX to access the C terminus
during the overnight exposure. We further suggest for
FZD6 that agonist (WNT-5A) stimulation promotes an
open and active receptor conformation similar to that
described for the ␤-adrenergic receptor coupled to G␣s
(61). In this state, the affinity between receptor and G
protein is transiently increased. The high-affinity complex
then promotes GDP release, and subsequent GTP
binding leads to complex dissociation, which we monitor
by dcFRAP. That ADP ribosylation of the G␣i1 C
terminus by PTX prevents FZD–G-protein precoupling
argues for a role of the C terminus in this precoupling
mode, even in the absence of a fully open, activated,
agonist-bound receptor structure.
The selective, inhibitory effect of DVL overexpression
on FZD–G-protein, but not CB1R–G-protein, precoupling
(Fig. 7) indicates that the FZD–G-protein
complex is structurally and functionally different from
the GPCR (CB1R)–G-protein complex. In addition,
dysfunction of WNT-5A-induced ERK1/2 signaling in
cells with altered DVL expression levels emphasizes that
not only is the FZD–G-protein precoupling perturbed, but
also interference with precoupling cannot be compensated
by collision coupling-initiated signaling (Fig. 9).
Notably, tight regulation of intracellular DVL levels
impairs FZD–G-protein precoupling and WNT-induced
G-protein signaling, not only in a recombinant overexpression
cell system, but also in cells with physiological
receptor/G-protein stoichiometry. Based on these findings,
one might even speculate that fine-tuning subcellular
DVL concentrations presents a means of compartmentalizing
FZD/G-protein signals in living cells. In
addition, the DVL-mediated regulation of FZD–G-protein
precoupling identifies DVL as the first regulator of
GPCR–G-protein precoupling, thereby uncovering a
novel regulatory mechanism for GPCR signaling.
Domain mapping with DVL deletion mutants showed
the DIX domain to be responsible for the negative
regulation of FZD–G-protein precoupling (Fig. 7). This
domain was previously assigned a dominant role in
WNT/␤-catenin signaling, signalosome formation, and
DVL-mediated low-density lipoprotein receptor–related
protein 6 phosphorylation. On the other hand, the DIX
domain is not known for mediating WNT/␤-cateninindependent
signaling (7, 62). Since the DIX domain
mediates DVL–DVL interaction and polymerization,
this feature may in fact also be responsible for the
inhibition of FZD–G-protein coupling. It could be
possible, for example, that FZD-associated endogenous
DVL is bound by overexpressed DIX-domain containing
DVL molecules (overexpressed mutants or wildtype
proteins) in a way that sterically blocks G-protein
coupling.
FZD–DVL interaction is notoriously difficult to assess
and quantify. With the FZD–DVL dcFRAP measurements
(Fig. 4), we present for the first time a quantitative
method opening new possibilities for measurements
of WNT-induced dynamics in DVL localization
and its interaction with membrane proteins.
In summary, we have shed light on the longstanding
question of FZD–G-protein coupling. The identification
of the dual role of DVL as a necessary and
negatively regulating factor for FZD–G-protein precoupling
may explain previous difficulties in mechanistically
pinpointing G protein coupling of FZDs in the
context of WNT signaling and the ambiguous data on
the involvement of G proteins and DVL, as well as their
relative localization to each other in several cellular
systems (54, 63). Nevertheless, further studies are
needed to determine FZD complex stoichiometry and
dynamics, to fully understand signal initiation and
specification by Class FZD receptors.
The authors thank Madelon M. Maurice (University Medical
Center, Utrecht, The Netherlands), Robert J. Lefkowitz
(Duke University Medical Center, Durham, NC, USA), Randall
T. Moon (University of Washington School of Medicine,
Seattle, WA, USA), Jyrki Kukkonen (Turku University Hospital,
Turku, Finland), Mark Rasenick (University of Chicago,
Chicago, IL, USA), Nevin A. Lambert (Georgia Health Sciences
University, Augusta, GA, USA), and Zsolt Lenkei (Ecole
Supérieure de Physique et Chimie Industrielle–Paristech,
Paris, France) for reagents. The work was supported by grants
from Karolinska Institutet, the Swedish Research Council
(K2008-68P-20810-01-4, K2008-333 68X-20805-01-4, and
K2012-67X-20805-05-3), the Swedish Cancer Society (CAN
2008/539, 2011/690), the Knut and Alice Wallenberg Foundation
(KAW2008.0149), the Board of Doctoral Education at
Karolinska Institutet (to M.B.C.K. and J.P.), Engkvist’s Foundations,
Foundation Lars Hiertas Minne, Swedish Royal Academy
of Sciences/Foundation Hierta-Retzius Fond, the Swedish Foundation
for International Cooperation in Research and Higher
Education (STINT), the Czech Science Foundation (204/09/
H058, 204/09/0498, and 13-32990S), the Ministry of Education,
Youth and Sports of The Czech Republic (MSM0021622430),
and the Program KI-MU (CZ.1.07/2.3.00/20.0180), cofinanced
by the European Social Fund and the state budget of the Czech
Republic. The authors declare no conflicts of interest.
REFERENCES
1. Nusse, R. (2003) Wnts and Hedgehogs: lipid-modified proteins
and similarities in signaling mechanisms at the cell surface.
Development 130, 5297–5305
2. Schulte, G. (2010) International Union of Basic and Clinical
Pharmacology LXXX: the Class Frizzled receptors. Pharmacol.
Rev. 62, 632–667
3. Schulte, G., and Bryja, V. (2007) The Frizzled family of unconventional
G-protein-coupled receptors. Trends Pharmacol. Sci. 28,
518–525
4. Dijksterhuis, J. P., Petersen, J., and Schulte, G. (2013) WNT/
Frizzled signaling: receptor-ligand selectivity with focus on
FZD-G protein signaling and its physiological relevance. [E-pub
ahead of print] Br. J. Pharmacol. doi: 10.1111/bph.12364
5. Barker, N., and Clevers, H. (2006) Mining the Wnt pathway for
cancer therapeutics. Nat. Rev. Drug Discov. 5, 997–1014
6. Angers, S., and Moon, R. T. (2009) Proximal events in Wnt
signal transduction. Nat. Rev. Mol. Cell Biol. 10, 468–477
7. Gao, C., and Chen, Y. G. (2010) Dishevelled: the hub of
Wnt signaling. Cell. Signal. 22, 717–727
8. Oldham, W. M., and Hamm, H. E. (2008) Heterotrimeric G
protein activation by G-protein-coupled receptors. Nat. Rev. Mol.
Cell Biol. 9, 60–71
9. Koval, A., Purvanov, V., Egger-Adam, D., and Katanaev, V. L.
(2011) Yellow submarine of the Wnt/Frizzled signaling: sub-
11DVL AS MASTER REGULATOR OF FZD–G-PROTEIN COUPLING
merging from the G protein harbor to the targets. Biochem.
Pharmacol. 82, 1311–1319
10. Malbon, C. C., Wang, H., and Moon, R. T. (2001) Wnt signaling
and heterotrimeric G-proteins: strange bedfellows or a classic
romance? Biochem. Biophys. Res. Commun. 287, 589–593
11. Slusarski, D. C., Corces, V. G., and Moon, R. T. (1997) Interaction
of Wnt and a Frizzled homologue triggers G-protein-linked
phosphatidylinositol signalling. Nature 390, 410–413
12. Slusarski, D. C., Yang-Snyder, J., Busa, W. B., and Moon, R. T.
(1997) Modulation of embryonic intracellular Ca2ϩ
signaling by
Wnt-5A. Dev. Biol 182, 114–120
13. Liu, T., Liu, X., Wang, H., Moon, R. T., and Malbon, C. C.
(1999) Activation of rat frizzled-1 promotes Wnt signaling and
differentiation of mouse F9 teratocarcinoma cells via pathways
that require Galpha(q) and Galpha(o) function. J. Biol. Chem.
274, 33539–33544
14. Liu, X., Liu, T., Slusarski, D. C., Yang-Snyder, J., Malbon, C. C.,
Moon, R. T., and Wang, H. (1999) Activation of a frizzled-2/
beta-adrenergic receptor chimera promotes Wnt signaling and
differentiation of mouse F9 teratocarcinoma cells via Galphao
and Galphat. Proc. Natl. Acad. Sci. U. S. A. 96, 14383–14388
15. Sheldahl, L. C., Park, M., Malbon, C. C., and Moon, R. T. (1999)
Protein kinase C is differentially stimulated by Wnt and Frizzled
homologs in a G-protein-dependent manner. Curr. Biol. 9,
695–698
16. Katanaev, V. L., Ponzielli, R., Semeriva, M., and Tomlinson, A.
(2005) Trimeric G protein-dependent frizzled signaling in
Drosophila. Cell 120, 111–122
17. Halleskog, C., Dijksterhuis, J. P., Kilander, M. B., BecerrilOrtega,
J., Villaescusa, J. C., Lindgren, E., Arenas, E., and
Schulte, G. (2012) Heterotrimeric G protein-dependent WNT-
5A signaling to ERK1/2 mediates distinct aspects of microglia
proinflammatory transformation. J. Neuroinflammation 9, 111
18. Kilander, M. B., Halleskog, C., and Schulte, G. (2011) Recombinant
WNTs differentially activate ␤-catenin-dependent and
-independent signalling in mouse microglia-like cells. Acta
Physiol. (Oxf.) 203, 363–372
19. Kilander, M. B. C., Dijksterhuis, J. P., Ganji, R. S., Bryja, V., and
Schulte, G. (2011) WNT-5A stimulates the GDP/GTP exchange
at pertussis toxin-sensitive heterotrimeric G proteins. Cell. Signal.
23, 550–554
20. Koval, A., and Katanaev, V. L. (2011) Wnt3a stimulation elicits
G-protein-coupled receptor properties of mammalian Frizzled
proteins. Biochem. J. 433, 435–440
21. Katanaev, V. L., and Buestorf, S. (2009) Frizzled Proteins are
bona fide G protein-coupled receptors. Nat. Prec. doi: hdl:
10101/npre.2009.2765.1
22. Wess, J. (1998) Molecular basis of receptor/G-protein-coupling
selectivity. Pharmacol. Ther. 80, 231–264
23. Wong, H. C., Bourdelas, A., Krauss, A., Lee, H. J., Shao, Y., Wu,
D., Mlodzik, M., Shi, D. L., and Zheng, J. (2003) Direct binding
of the PDZ domain of Dishevelled to a conserved internal
sequence in the C-terminal region of Frizzled. Mol. Cell 12,
1251–1260
24. Tauriello, D. V., Jordens, I., Kirchner, K., Slootstra, J. W.,
Kruitwagen, T., Bouwman, B. A., Noutsou, M., Rudiger, S. G.,
Schwamborn, K., Schambony, A., and Maurice, M. M. (2012)
Wnt/beta-catenin signaling requires interaction of the Dishevelled
DEP domain and C terminus with a discontinuous motif
in Frizzled. Proc. Natl. Acad. Sci. U. S. A. 109, E812–E820
25. Simons, M., Gault, W. J., Gotthardt, D., Rohatgi, R., Klein, T. J.,
Shao, Y., Lee, H. J., Wu, A. L., Fang, Y., Satlin, L. M., Dow, J. T.,
Chen, J., Zheng, J., Boutros, M., and Mlodzik, M. (2009)
Electrochemical cues regulate assembly of the Frizzled/Dishevelled
complex at the plasma membrane during planar epithelial
polarization. Nat. Cell Biol. 11, 286–294
26. Ayoub, M. A., Al-Senaidy, A., and Pin, J. P. (2012) Receptor-G
protein interaction studied by bioluminescence resonance energy
transfer: lessons from protease-activated receptor 1. Front.
Endocrinol. (Lausanne) 3, 82
27. Neubig, R. R. (1994) Membrane organization in G-protein
mechanisms. FASEB J. 8, 939–946
28. Hein, P., Frank, M., Hoffmann, C., Lohse, M. J., and Bunemann,
M. (2005) Dynamics of receptor/G protein coupling in living
cells. EMBO J. 24, 4106–4114
29. Qin, K., Dong, C., Wu, G., and Lambert, N. A. (2011) Inactivestate
preassembly of G(q)-coupled receptors and G(q) heterotrimers.
Nat. Chem. Biol. 7, 740–747
30. Nobles, M., Benians, A., and Tinker, A. (2005) Heterotrimeric G
proteins precouple with G protein-coupled receptors in living
cells. Proc. Natl. Acad. Sci. U. S. A. 102, 18706–18711
31. Gales, C., Van Durm, J. J., Schaak, S., Pontier, S., Percherancier,
Y., Audet, M., Paris, H., and Bouvier, M. (2006) Probing the
activation-promoted structural rearrangements in preassembled
receptor-G protein complexes. Nat. Struct. Mol. Biol. 13, 778–786
32. Gales, C., Rebois, R. V., Hogue, M., Trieu, P., Breit, A., Hebert,
T. E., and Bouvier, M. (2005) Real-time monitoring of receptor
and G-protein interactions in living cells. Nat. Methods 2, 177–
184
33. Frojmark, A. S., Schuster, J., Sobol, M., Entesarian, M., Kilander,
M. B., Gabrikova, D., Nawaz, S., Baig, S. M., Schulte, G., Klar, J.,
and Dahl, N. (2011) Mutations in Frizzled 6 cause isolated
autosomal-recessive nail dysplasia. Am. J. Hum. Genet. 88, 852–
860
34. Yu, J. Z., and Rasenick, M. M. (2002) Real-time visualization of
a fluorescent G(alpha)(s): dissociation of the activated G protein
from plasma membrane. Mol. Pharmacol. 61, 352–359
35. Qin, K., Sethi, P. R., and Lambert, N. A. (2008) Abundance and
stability of complexes containing inactive G protein-coupled
receptors and G proteins. FASEB J. 22, 2920–2927
36. Digby, G. J., Lober, R. M., Sethi, P. R., and Lambert, N. A.
(2006) Some G protein heterotrimers physically dissociate in
living cells. Proc. Natl. Acad. Sci. U. S. A. 103, 17789–17794
37. Yagi, H., Tan, W., Dillenburg-Pilla, P., Armando, S., Amornphimoltham,
P., Simaan, M., Weigert, R., Molinolo, A. A., Bouvier,
M., and Gutkind, J. S. (2011) A synthetic biology approach
reveals a CXCR4-G13-Rho signaling axis driving transendothelial
migration of metastatic breast cancer cells. Sci. Signal. 4, ra60
38. Bryja, V., Schambony, A., Cajanek, L., Dominguez, I., Arenas, E.,
and Schulte, G. (2008) Beta-arrestin and casein kinase 1/2
define distinct branches of non-canonical WNT signalling pathways.
EMBO Rep. 9, 1244–1250
39. Phair, R. D., Gorski, S. A., and Misteli, T. (2004) Measurement
of dynamic protein binding to chromatin in vivo, using photobleaching
microscopy. Methods Enzymol. 375, 393–414
40. Schwarz-Romond, T., Merrifield, C., Nichols, B. J., and Bienz, M.
(2005) The Wnt signalling effector Dishevelled forms dynamic
protein assemblies rather than stable associations with cytoplasmic
vesicles. J. Cell Sci. 118, 5269–5277
41. De Lean, A., Stadel, J. M., and Lefkowitz, R. J. (1980) A ternary
complex model explains the agonist-specific binding properties
of the adenylate cyclase-coupled beta-adrenergic receptor. J.
Biol. Chem. 255, 7108–7117
42. Halleskog, C., and Schulte, G. (2013) Pertussis toxin-sensitive
heterotrimeric G(␣i/o) proteins mediate WNT/beta-catenin and
WNT/ERK1/2 signaling in mouse primary microglia stimulated
with purified WNT-3A. Cell. Signal. 25, 822–828
43. Cui, C. Y., Klar, J., Georgii-Heming, P., Frojmark, A. S., Baig,
S. M., Schlessinger, D., and Dahl, N. (2013) Frizzled6 deficiency
disrupts the differentiation process of nail development. J.
Invest. Dermatol. 133, 1990–1997
44. Vásquez, C., and Lewis, D. L. (1999) The CB1 cannabinoid
receptor can sequester G-proteins, making them unavailable to
couple to other receptors. J. Neurosci. 19, 9271–9180
45. Bilic, J., Huang, Y. L., Davidson, G., Zimmermann, T., Cruciat,
C. M., Bienz, M., and Niehrs, C. (2007) Wnt induces LRP6
signalosomes and promotes dishevelled-dependent LRP6 phosphorylation.
Science 316, 1619–1622
46. Schwarz-Romond, T., Fiedler, M., Shibata, N., Butler, P. J.,
Kikuchi, A., Higuchi, Y., and Bienz, M. (2007) The DIX domain
of Dishevelled confers Wnt signaling by dynamic polymerization.
Nat. Struct. Mol. Biol. 14, 484–492
47. Malbon, C. C. (2011) Wnt signalling: the case of the ‘missing’
G-protein (published correction appears in Biochem J., 434, 575).
Biochem. J. 433, e3–e5
48. Ahumada, A., Slusarski, D. C., Liu, X. X., Moon, R. T., Malbon,
C. C., and Wang, H. Y. (2002) Signaling of rat Frizzled-2
through phosphodiesterase and cyclic GMP. Science 298, 2006–
2010
49. Liu, T., DeCostanzo, A. J., Liu, X., Wang, H., Hallagan, S.,
Moon, R. T., and Malbon, C. C. (2001) G protein signaling from
12 Vol. 28 May 2014 KILANDER ET AL.The FASEB Journal ⅐ www.fasebj.org
activated rat frizzled-1 to the beta-catenin-Lef-Tcf pathway.
Science 292, 1718–1722
50. Sheldahl, L. C., Slusarski, D. C., Pandur, P., Miller, J. R., Kuhl,
M., and Moon, R. T. (2003) Dishevelled activates Ca2ϩ flux,
PKC, and CamKII in vertebrate embryos. J. Cell Biol. 161,
769–777
51. Slusarski, D. C., Yang-Snyder, J., Busa, W. B., and Moon, R. T.
(1997) Modulation of embryonic intracellular Ca2ϩ signaling
by Wnt-5A. Dev. Biol. 182, 114–120
52. Wang, H. Y., Liu, T., and Malbon, C. C. (2006) Structurefunction
analysis of Frizzleds. Cell. Signal. 18, 934–941
53. Lohse, M. J., Nuber, S., and Hoffmann, C. (2012) Fluorescence/
bioluminescence resonance energy transfer techniques to study
G-protein-coupled receptor activation and signaling. Pharmacol.
Rev. 64, 299–336
54. Liu, X., Rubin, J. S., and Kimmel, A. R. (2005) Rapid, Wntinduced
changes in GSK3beta associations that regulate betacatenin
stabilization are mediated by Galpha proteins. Curr. Biol.
15, 1989–1997
55. Wang, C., Wu, H., Katritch, V., Han, G. W., Huang, X. P., Liu,
W., Siu, F. Y., Roth, B. L., Cherezov, V., and Stevens, R. C. (2013)
Structure of the human smoothened receptor bound to an
antitumour agent. Nature 497, 338–343
56. Gayen, S., Li, Q., Kim, Y. M., and Kang, C. (2013) Structure of
the C-terminal region of the Frizzled receptor 1 in detergent
micelles. Molecules 18, 8579–8590
57. Wess, J., Han, S. J., Kim, S. K., Jacobson, K. A., and Li, J. H.
(2008) Conformational changes involved in G-protein-coupledreceptor
activation. Trends Pharmacol. Sci. 29, 616–625
58. Hein, P., and Bünemann, M. (2009) Coupling mode of receptors
and G proteins. Naunyn Schmiedebergs Arch. Pharmacol 379,
435–443
59. Neubig, R. R., Gantzos, R. D., and Thomsen, W. J. (1988)
Mechanism of agonist and antagonist binding to alpha 2
adrenergic receptors: evidence for a precoupled receptorguanine
nucleotide protein complex. Biochemistry 27, 2374–
2384
60. Philip, F., Sengupta, P., and Scarlata, S. (2007) Signaling
through a G Protein-coupled receptor and its corresponding G
protein follows a stoichiometrically limited model. J. Biol. Chem.
282, 19203–19216
61. Rasmussen, S. G., DeVree, B. T., Zou, Y., Kruse, A. C., Chung,
K. Y., Kobilka, T. S., Thian, F. S., Chae, P. S., Pardon, E.,
Calinski, D., Mathiesen, J. M., Shah, S. T., Lyons, J. A., Caffrey,
M., Gellman, S. H., Steyaert, J., Skiniotis, G., Weis, W. I.,
Sunahara, R. K., and Kobilka, B. K. (2011) Crystal structure of
the b2 adrenergic receptor-Gs protein complex. Nature 477,
549–555
62. Boutros, M., and Mlodzik, M. (1999) Dishevelled: at the crossroads
of divergent intracellular signaling pathways. Mech. Dev.
83, 27–37
63. Bikkavilli, R. K., Feigin, M. E., and Malbon, C. C. (2008) G
alpha(o) mediates WNT-JNK signaling through Dishevelled 1
and 3, RhoA family members, and MEKK 1 and 4 in mammalian
cells. J. Cell Sci. 121, 234–245
Received for publication November 22, 2013.
Accepted for publication January 23, 2014.
13DVL AS MASTER REGULATOR OF FZD–G-PROTEIN COUPLING
 
Supplementary Figure S1: Localization of FZD6, Gi1 and DVL overexpressed in HEK293
cells. (A) Confocal photomicrographs show FZD6-mCherry, Gi1-GFP or DVL2-CFP expression in
transiently transfected and living HEK293 cells. Note the membranous localization of FZD6 and
Gi1 and punctate distribution pattern in DVL2-expressing cells, when each plasmid is transfected
alone. (B) FZD6-mCherry recruits DVL2-CFP to the membrane and co-expression prevents DVL
from punctate aggregation in the cytosol. Further, both FZD6-mCherry and Gi1-GFP co-localize in
the plasma membrane of HEK293 cells Triple transfection is shown in Fig. 1a in the main body of
the paper. Scale bar = 10 µm.
 
Supplementary Figure 2: MYR-mCherry “no receptor” controls for specificity of dcFRAP
experiments. In order to control for specificity of FZD effects and possible crosslinking artifacts,
dual color FRAP experiments were performed in HEK293 cells co-expressing MYR-mCherry and
the Gi1-GFP (A-D) or MYR-mCherry and DVL2-GFP (e-h) serving as “no receptor” control. Before
and after crosslinking (CL), the lateral mobility of both proteins was assessed. Panels (A,E)
compare the mobile fractions of MYR-mCherry and Gi1-GFP/DVL2-GFP indicating that CL affects
neither of them. This control is especially important to support the specificity of FZD-G protein and
FZD-DVL2 interactions in the dual color FRAP and excludes interaction with endogenously
expressed, cross-linked membrane proteins. Schemes indicate the replacement of FZD6-mCherry
with MYR-mCherry in combination with Gi1-GFP or DVL2-GFP for dcFRAP experiments. (I)
Changes in receptor mobility upon WNT stimulation could be affected by receptor internalization.
The photomicrographs show a time series performed on a FZD6-mCherry expressing HEK293 cells
in the absence of stimulation and with 5 and 15 min WNT-5A (300 ng/ml) stimulation. No distinct
receptor internalization was observed in this time frame during which dcFRAP measurements were
performed.
1
 
Supplementary Figure S3: Subcellular localization of FZD6 and heterotrimeric G proteins in
HEK293 cells. In the main body of the paper (Fig. 1 and Fig. 2) we address whether FZD6mCherry
precouples to heterotrimeric G proteins. We have used fluorescently-tagged Gsubunits
of representatives of the four families of G proteins (Gs/Gi/Gq/G12) in combination with tagged
FZD6 for double color FRAP analysis. The photomicrographs show confocal images from FZD6mCherry/GFP
and fluorescently-tagged G subunits (in coexpression with  subunits) in living
cells. Both FZD6 and the G subunits were expressed in the membrane, a prerequisite for their
physical interaction. Size bar = 10 µm.
 
Supplementary Fig. 4: Protein sequence alignment of FZD C-terminal sequences from
different species show evolutionary conservation of the arginine resembling Arg511 in
human FZD6. C terminal sequences for Class Frizzled receptors from Xenopus laevis (XFz),
Drosophila melanogaster (Dfz), and Caenorhabditis elegans (MIG-1, MOM-5, CFZ-2, LIN-17) are
shown. Basic amino acids are labeled in blue. Red highlights the conserved KTXXXW DVL-binding
sequence. Green pinpoints the amino acid resembling the Arg511 in human FZD6. The C terminal
sequences are numbered from 1, resembling the first amino acid after the seventh transmembrane
helix. Note the occurrence of basic regions in most of the FZDs in Xenopus laevis as well as
Drosophila melanogaster Dfz1, 2. Sequence alignment was done with STRAP Interactive Structure
based Sequences Alignment Program available at http://www.bioinformatics.org/strap/
 
 
 
Vítězslav Bryja, 2014    Attachments 
 
 
#20 
 
 
O.  Bernatík1
,  K.  Šedová1
,  R.  Sri  Ganji,  I.  Červenka,  L.  Trantírek,  Z.  Zdráhal,  V.  Bryja. 
Functional  analysis  of  Dishevelled‐3  phosphorylation  identifies  distinct  mechanisms 
driven by Casein Kinase 1ε and Fzd5 (J. Biol. Chem., in revision). 
 
 
Impact factor (2012): 4.651 
Times cited (without autocitations, WoS, Feb 21st 2014): 0 
Significance:  In  this  study  we  have  for  the  first  time  described  all  (or  almost  all) 
phosphorylation  events  triggered  by  CK1ε  on  Dishevelled‐3.  Further  functional 
analysis  confirmed  in  much  greater  detail  the  dual  role  of  CK1  in  Dvl  biology 
postulated  by  us  earlier  (see  study  #12).  Moreover,  we  uncovered  unexpected 
fundamental differences between phosphorylation triggered by CK1 and Frizzled, 
a Wnt receptor. 
Contibution of the author/author´s team: The study has been designed and performed 
in our lab. The mass spectrometry analysis has been done in collaboration with 
proteomic facility headed by Z. Zdráhal. 
 
 
 
 
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
1
Functional analysis of Dishevelled-3 phosphorylation identifies distinct mechanisms driven by
Casein Kinase 1 and Frizzled5
Ondřej Bernatík1,2!
, Kateřina Šedová3,4!
, Ranjani Sri Ganji1
, Igor Červenka1
, Lukáš Trantírek5,6
,
Zbyněk Zdráhal3,4
, Vitězslav Bryja1,2
*
1
Institute of Experimental Biology, Faculty of Science, Masaryk University, Kotlarska 2, 61137 Brno,
Czech Republic; 2
Department of Cytokinetics, Institute of Biophysics Academy of Sciences of the
Czech Republic, Kralovopolska 135, 61265 Brno, Czech Republic; 3
National Centre for Biomolecular
Research, Faculty of Science, Masaryk University, Kamenice 5, 62500 Brno, Czech Republic;
4
Research Group–Proteomics and 5
Structural Biology Program, Central European Institute of
Technology (CEITEC), Masaryk University, Kamenice 5, 62500 Brno, Czech Republic; 6
Cellular
Protein Chemistry, Utrecht University, Padualaan 8, 3584 CH Utrecht, Netherlands,
Running title: Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
! Authors contributed equally to this work
*Address correspondence to:Vitezslav Bryja Ph.D., Institute of Experimental Biology, Faculty of
Science, Masaryk University, Kotlarska 2, 611 37, Brno, Czech Republic, phone: +420-549493291,
Email: bryja@sci.muni.cz
Key words: Dishevelled-3, Casein kinase 1ε, Frizzled 5, phosphorylation, MS/MS, Wnt/-catenin
pathway
Background: Phosphorylation of Dishevelled
(Dvl) by casein kinase 1ε (CK1ε) is a key event
in Wnt signal transduction.
Results: Dvl3 residues phosphorylated by
CK1ε were identified by proteomics and
analyzed functionally.
Conclusion: Individual phosphorylation events
control different aspects of Dvl biology.
Significance: CK1ε and Fzd5, a Wnt receptor,
act on Dvl via distinct mechanism, suggesting
that CK1ε is not directly downstream of
Frizzled5.
ABSTRACT:
Dishevelled-3 (Dvl3), a key component of
the Wnt signaling pathways, acts
downstream of Frizzled (Fzd) receptors and
gets heavily phosphorylated in response to
pathway activation by Wnt ligands. Casein
kinase (CK) 1ε was identified as the major
kinase responsible for Wnt-induced Dvl3
phosphorylation. Currently it is not clear,
which Dvl residues are phosphorylated and
what is the consequence of individual
phosphorylation events. In the present study,
we employed mass spectrometry to analyze
in a comprehensive way the phosphorylation
of human Dvl3 induced by CK1ε. Our
analysis revealed more than 50
phosphorylation sites on Dvl3; only minority
of these sites was found dynamically induced
after co-expression of CK1ε and,
surprisingly, phosphorylation of one cluster
of modified residues was downregulated.
Dynamically phosphorylated sites were
analyzed functionally. Mutations within PDZ
domain (S280A and S311A) reduced the
ability of Dvl3 to activate TCF/LEF-driven
transcription. In contrast, mutations of
clustered S/T in the Dvl3 C-terminus
prevented ability of CK1ε to induce
electrophoretic mobility shift of Dvl3 and its
even subcellular localization. Surprisingly,
mobility shift and subcellular localization
changes induced by Fzd5, a Wnt receptor,
were in all these mutants indistinguishable
from wild type Dvl3. In summary, our data
on the molecular level (i) support previous
assumption that CK1ε acts via
phosphorylation of distinct residues as the
activator as well as shut off signal (via
negative effects on Dvl polymerization) of
downstream Wnt/-catenin signaling, and
(ii) suggest that CK1ε acts on Dvl via
different mechanism than Fzd5 and is not
directly downstream of Fzd receptor
complex.
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
2
INTRODUCTION
Wnt/-catenin pathway is a conserved
signaling machinery, which coordinates cell
proliferation, cell fate and cell differentiation
during development and during maintenance of
homeostasis in the adult tissues (1,2).
Dishevelled (Dvl) with three isoforms in
vertebrates (Dvl1, Dvl2 and Dvl3) is a key
cytoplasmic protein required for signal
transduction of the canonical Wnt signal. Dvl is
a modular protein composed of three domains,
N terminal DIX (Dishevelled, Axin), central
PDZ (Postsynaptic density, Discs large, Zonula
ocludens), and DEP (Dvl, Egl-10, Pleckstrin).
The linking regions between the domains do not
seem to have well defined tertiary structure, and
might thus act as “hinge” regions, allowing Dvl
to achieve various conformations. Although the
reports about the function of individual domains
are not always in full agreement, it is
commonly acknowledged that DIX and PDZ
domains are necessary for transduction of
canonical Wnt signal, whereas PDZ and DEP
are necessary for other, so called non-canonical
Wnt pathways (3-5). The part of Dvl located Cterminally
from all three domains has no clear
attributed function, although it was shown that
it has inhibitory effect on canonical Wnt
pathway (6).
Upon stimulation of cells by Wnt-3a, which
is the best defined ligand of Wnt/β-catenin
pathway, Dvl electrophoretic mobility gets
reduced due to multiple phosphorylations (7).
Wnt-3a-induced activation of endogenous Dvl
leads to a variant of Dvl with retarded
electrophoretic mobility named phosphorylated
and shifted (PS)-Dvl (8-10). It has been clearly
demonstrated that both the activation of Dvl in
the Wnt/β-catenin pathway (11-15) and Wntinduced
PS-Dvl formation is dependent on
casein kinase 1 (CK1)/ activity (8,10). From
the several protein kinases identified as Dvl
binding partners, only CK1δ and CK1ε (for
simplicity referred in further text as CK1ε) were
shown to be required for Wnt-induced Dvl shift
(11,16) and at the same time capable of
inducing PS-Dvl when overexpressed (13).
Serines (S), threonines (T) and tyrosines
(Y), residues, which can be modified by
phosphorylation, represent roughly15% of Dvl
aminoacid (aa) residues. Despite the fact that
many phosphorylation sites have been
identified in Dvl (17-24), it is currently
unknown, which Dvl residues are dynamically
phosphorylated by CK1ε. In order to overcome
this caveat we have used mass-spectrometry
(MS) based approach to identify in an unbiased
way the phosphorylation sites of human (h)
Dvl3 in absence and presence of overexpressed
CK1ε. We have identified more than 50
phosphorylated S and T residues on Dvl3.
Majority of these sites were found to be
constitutively phosphorylated. Using criteria
such as the site conservation, phosphorylation
dynamics and the position in Dvl3 we have
selected several phosphorylation sites/clusters
for mutation and subsequent functional
analysis. Among these we have identified
phosphorylation sites which (i) contribute to the
electrophoretic mobility of Dvl3, (ii) control
Dvl3-driven activation of the Wnt/β-catenin
pathway and (iii) are required for even
subcellular localization of Dvl3.
EXPERIMENTAL PROCEDURES
Cell Culture, Transfection, and Treatments.
- HEK-293t cells were propagated in
DMEM/10% FCS/2 mM L-glutamine/50
units/ml penicillin/50 units/ml streptomycin.
Cells (40,000–60.000 per well) were seeded in
24-well plates. The next day, cells were
transfected using polyethylenimine (PEI) in a
stoichiometry of 2.5 μl PEI per 1 μg of DNA.
Cells were harvested for immunoblotting or
immunocytofluorescence 24 h after
transfection, only for WB analysis of Fzd
induced Dvl shift samples were collected after
12h. The following plasmids have been
described previously: FLAG-Dvl3 wt (25),
FLAG Dvl1 wt (26), and FLAG-Dvl2 wt (27),
CK1ε (28), V5-Fzd5 (29). Mutagenesis was
performed using Quikchange XL kit following
manufacturer’s instructions (Stratagene
#200518). All mutations were verified by
sequencing.
Dual Luciferase Assay, Western blotting,
pS643 Dvl3 antibody production and
immunoprecipitation - For the luciferase
reporter assay, cells were transfected with 0.1
μg Super8X TopFlash construct and 0.1 μg
pRLTK luc (Renilla) luciferase construct per
well in a 24-well plate, 24 hours after seeding.
Cells were then transfected with corresponding
plasmids, and processed 24 hours after
transfection. For the TopFlash assay, a Promega
dual luciferase assay kit was used according to
manufacturer’s instructions. Relative luciferase
units (RLU) of Firefly luciferase were measured
on a MLX luminometer (Dynex Technologies)
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
3
and normalized to the Renilla luciferase signal.
Immunoblotting and sample preparation was
performed as previously described (30) The
following antibodies were used: FLAG M2
(F1804, Sigma-Aldrich), CK1ε (sc-6471; Santa
Cruz Biotechnology), V5 (R960-25,
Invitrogen), FLAG (F7425, Sigma-Aldrich).
Anti-hDvl3-pS643 (pS643) antibody was
prepared by immunizing rabits by
HHSLAS(pS)LRSHH peptide. Immunization
and production of antibody was performed on a
service basis by Moravian Biotechnology
(http://www.moravian-biotech.com/).
For MS/MS based identification of
phosphorylation HEK293t cells were seeded on
15-cm dishes and transfected with
corresponding plasmids 24h after seeding.
Immunoprecipitation protocol used was
modified from (31). In short, 2 ml of cold lysis
buffer supplemented with protease inhibitors
(Roche, 11836145001), phosphatase inhibitors
(Calbiochem, 524625), 0.1 mM DTT and 10
mM NEM (N-ethylmaleimide) (Sigma-Aldrich
E3876) was used for lysis of one 15 cm dish.
Lysate was collected after 20 minutes of lysis
on 4o
C, and was cleared by centrifugation at
16.1 RCF for 20 minutes. Three μg of antibody
were used per sample. Samples were incubated
with the antibody for 40 min, then 45 μl of G
protein sepharose beads (GE Healthcare, 17-
0618-05) equilibrated in the lysis buffer were
added to each sample. Samples were incubated
on the carousel overnight, washed 6 times with
lysis buffer, 40 μl of 2x Laemmli buffer was
added and samples were boiled. The antibody
used for immunoprecipitation was FLAG M2
(F1804; Sigma)
Immunocytofluorescence - HEK-293t cells
were seeded (2x105
cells/well) on gelatine
coated coverslips in 24-well plates. Cells were
transfected the next day and 24 hours later were
fixed in fresh 4% paraformaldehyde,
permeabilized with 0.05% Triton-X100,
blocked with PBTA (3% BSA, 0,25% Triton,
0,01% NaN3) for 1 hour and incubated
overnight with primary antibodies. Next day,
coverslips were washed in PBS, and incubated
with secondary antibodies conjugated to Alexa
Fluor 488 (Life Technologies A11001) or Alexa
Fluor 594 (Life Technologies A11058), washed
with PBS, stained with DAPI (1:5000) and
mounted on microscopic slides. Cells were
visualized using Olympus IX51 fluorescent
microscope. Hundred positive cells per
condition were analyzed and scored based on
the pattern of intracellular Dvl3 distribution.
3D predictions, folding, kinase motives Analysis
and modeling of Dvl3 PDZ domain
3D structure was performed using Chimera
software (32). Folding prediction was generated
by PONDR-FIT prediction software (33).
Phosphorylation prediction was performed
using GPS 2.1 program using predefined values
for high, medium and low stringency of the
prediction (34).
LC-MS/MS analysis - Samples from
immunoprecipitation were separated on a 8%
SDS-PAGE, fixed with solution A (50%
methanol, 10% acetic acid) then stained with
Coomassie (0.1% Coomassie briliant blue
(Sigma, BO149), 20% methanol, 10% acetic
acid) for 2 hours. Gel was destained using
solution A. Corresponding 1-D bands were
excised. After destaining, the proteins in gel
pieces were incubated with 10 mM DTT at
56°C for 45 min. After removal of DTT excess
samples were incubated with 55 mM IAA at
room temperature in darkness for 30 min, then
alkylation solution was removed and gel pieces
were hydrated for 45 min at 4 °C in digestion
solution (5 ng/μl trypsin, sequencing grade,
Promega, Fitchburg, Wisconsin, USA, in 25
mM AB). The trypsin digestion was performed
for 2 hours at 40°C on Thermomixer (750 rpm;
Eppendorf, Hamburg, Germany). Subsequently,
the tryptic digests were cleaved by
chymotrypsin (5 ng/μl, sequencing grade,
Roche, Basel, Switzerland, in 25 mM AB) for 2
hours at 30 °C or 40°C. Digested peptides were
extracted from gels using 50% ACN solution
with 2.5% formic acid and concentrated in
speedVac concentrator (Eppendorf, Hamburg,
Germany).
The aliquot (1/10) of concentrated sample
was directly analysed by LC-MS/MS for
protein identification. The rest of sample was
used for phosphopeptide analysis. Sample was
diluted with acidified acetonitrile solution (80%
ACN, 2% FA). Phosphopeptides were enriched
using Pierce Magnetic Titanium Dioxide
Phosphopeptide Enrichment Kit (Thermo
Scientific, Waltham, Massachusetts, USA)
according to slightly modified manufacturer
protocol (samples were mixed with binding
solution in ratio 1:2 prior loading and one
additional washing step with binding solution
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
4
after phosphopeptides capture was
implemented). Eluates were concentrated under
vacuum and then diluted in 10 μl of 0.1% FA
solution before LC-MS/MS analysis.
Liquid chromatography-tandem mass
spectrometry (LC–MS/MS) analysis was
performed using reverse phase RSLCnano
system (Dionex, Sunnyvale, CA, USA) on-line
coupled with an HCT Ultra PTM Discovery
System ion trap mass spectrometer equipped
with ETD source II (Bruker Daltonik, Bremen,
Germany) or with an Orbitrap Elite hybrid
spectrometer (Thermo Fisher Scientific,
Waltham, MA, USA).
(i) LC-MS/MS with HCT Ultra PTM
Discovery System. Samples (10 μl) were
injected in loading solution (0.1% FA) on
trapping column (100 μm × 30 mm) filled with
4-μm Jupiter Proteo sorbent (Phenomenex,
Torrance, CA, USA) where the analytes were
desalted and concentrated. Subsequently, the
analytes were eluted from the trapping column
using an acetonitrile/water gradient (350
nl/min) onto a fused-silica capillary column
(100 μm × 180 mm), on which they were
separated. The column was filled with 3.5-μm
X-Bridge BEH 130 C18 sorbent (Waters,
Milford, MA, USA). The mobile phase A and B
consisted of 0.1% formic acid in water and in
acetonitrile, respectively. The gradient elution
started at 4 % of mobile phase B and increased
to 30% B after 30 min and to 60% B in the next
10 minutes, then 90% B was reach in one
minute and system remained at this state for 5
min, finally proportion of phase B was reduced
to 4% B in 1 min. Equilibration of the
precolumn and the column lasting 25 min was
done prior to sample injection to sample loop.
The analytical column outlet was directly
connected to the nanoelectrospray ion source.
Mass spectrometer was operated in the
positive ion mode with collision induced
dissociation (CID) followed, in case of
phosphopeptides, by data-depended electron
transfer dissociation (ETD) fragmentation;
triggered by detection of neutral loss of
phosphoric acid in CID spectrum. Nitrogen was
used as nebulizing as well as drying gas. The
pressure of nebulizing gas was 8 psi. The
temperature and flow rate of drying gas were
set to 300 ºC and 6 l/min, respectively. The
capillary voltage was 4.0 kV. Ion charge control
(ICC) controlling the filling of ion trap was set
to 200,000. The mass spectrometer scanned in
m/z range of 300 –1500 for MS and 100-2500
for MS/MS operation. The data were processed
with DataAnalysis 4.0 and BioTools 3.0
software (Bruker Daltonik)
(ii) LC-MS/MS with Orbitrap Elite hybrid
spectrometer. Prior to LC separation, tryptic
digests were online concentrated and desalted
using trapping column (100 μm × 30 mm) filled
with 3.5-μm X-Bridge BEH 130 C18 sorbent
(Waters, Milford, MA, USA). After washing of
trapping column with 0.1% FA, the peptides
were eluted (300 nl/min) from the trapping
column onto a Acclaim Pepmap100 C18
column (2 µm particles, 75 μm × 250 mm;
Thermo Fisher Scientific, Waltham, MA, USA)
by the following gradient program (mobile
phase A: 0.1% FA in water; mobile phase B:
ACN:methanol:2,2,2-trifluoroethanol (6:3:1;
v/v/v) containing 0.1% FA): the gradient
elution started at 2% of mobile phase B and
increased from 2% to 45% during the first 90
min (11% in the 30th, 25% in the 60th and 45%
in 90th min), then increased linearly to 95% of
mobile phase B in the next 5 min and remained
at this state for the next 15 min. Equilibration of
the trapping column and the column was done
prior to sample injection to sample loop. The
analytical column outlet was directly connected
to the Nanospray Flex Ion Source (Thermo
Fisher Scientific, Waltham, MA, USA).
MS data were acquired in a data-dependent
strategy selecting up to top 10 precursors based
on precursor abundance in the survey scan
(350-1700 m/z). Mass spectrometer was
operating in the positive ion mode with
collision induced dissociation (CID) followed,
in case of neutral loss detection (32.7, 49.0,
65.3 and 98; with m/z tolerance of -1.5 and
+0.5 Da), by electron transfer dissociation
(ETD) fragmentation with supplemental
activation (energy 20). The resolution of the
survey scan was 120 000 (400 m/z) with a
target value of 1×106
ions, one microscan and
maximum injection time of 200 ms. Low
resolution CID or ETD MS/MS spectra were
acquired with a target value of 10 000 ions in
rapid scan mode with m/z range adjusted
according to actual precursor mass and charge.
MS/MS acquisition in the linear ion trap was
carried out in parallel to the survey scan in the
Orbitrap analyser by using the preview mode.
The maximum injection time for MS/MS was
50 ms. ETD reaction time was 100 ms (doubly
charged precursors, adjusted according to
charge state). Dynamic exclusion was enabled
for 45 s after one MS/MS spectra acquisition
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
5
and early expiration was disabled. The isolation
window for MS/MS fragmentation was set to 2
m/z.
Database searching. The processed data
were searched with MASCOT (version 2.2 or
higher, Matrix Science, Boston, Massachusetts,
USA) against NCBInr database (non-redundant,
taxonomic restriction Mammalia) with settings
corresponding to trypsin/chymotrypsin specifity
(two miss-cleavages allowed) and optional
modifications: oxidation (M),
carbamidomethylation (C), phosphorylation (S,
T, Y). Mass tolerances for peptides and MS/MS
fragments were 0.5 Da in case of HCT Ultra
system (correction for one 13
C atom) and 5
ppm and 0.5 Da, respectively, in case of
Orbitrap system.The significance threshold was
set to p < 0.05 and p < 0.01 for HCT Ultra and
Orbitrap Elite generated data, respectively. All
phosphorylation sites were manually confirmed
in profile MS/MS spectra for generation of
phosphorylation variants, when necessary.
phoshoRS feature was used for phosphorylation
localization in case of Orbitrap Elite data.
RESULTS
MS/MS-based identification of Dvl3
phosphorylation in the presence and absence
of CK1ε - CK1ε (together with the closely
related CK1δ) is the only Dvl kinase, which is
both required and sufficient for the shift of Dvl
electrophoretical mobility (Fig. 1A) and
activation of the Wnt/-catenin pathway (eg.
analyzed using the TopFlash reporter (35)) at
the same time (Fig. 1B). Other kinases such as
CK2, PAR1, RIPK4, PKC or Abl known to
bind/activate Dvl upon overexpression do not
lead to this phenotype (11,16,36-40). In order to
identify Dvl3 phosphorylation sites controlled
by CK1ε, we overexpressed FLAG-tagged
human Dvl3 in HEK293t cells alone or together
with CK1ε. Overexpressed Dvl3 was
immunoprecipitated, separated on 1D SDSPAGE
and stained using Coomassie blue (for
typical gel see Fig. 1C). Bands were then
excised from the gel and phosphorylation was
analyzed by LC-MS/MS.
Identification of phosphorylations in
Dvl3/Dvl3+CK1ε samples was repeated in
seven independent experiments. All
significantly identified phosphorylation sites are
summarized in Table 1 and Figure 2A. Out of
more than fifty detected phosphorylation sites,
only 9 were found uniquely in samples
activated by CK1ε (Fig. 2, in red). Additional 7
serines were detected more frequently in
presence of CK1ε, but were also occasionally
seen in the control samples (Fig. 2, in orange).
We propose that phosphorylation of these 16
sites contribute to the Dvl3-associated
phenotypes induced by CK1ε. Interestingly,
phosphorylation of residues S175, S192, S197,
S202 and S203 in the region between DIX and
PDZ domain, which is rich in basic aminoacids
(the basic region), of Dvl3 was less abundant
after CK1ε coexpression. These data suggest
that some Dvl phosphorylation events may be
inhibitory and mutually exclusive with others.
Phosphorylation of the remaining 30 sites (Fig.
2A, indicated in blue) was not affected by CK1ε
and seems to be constitutive in the used culture
conditions. Most of the phosphorylation sites
were found on residues conserved among Dvl
isoforms and species (Dvl1, Dvl2 and Dvl3 of
Homo sapiens, Mus musculus, Xenopus laevis
and Xenopus tropicalis were considered for the
analysis) but some were unique for Dvl3 – this
was the case of S611, S612, S633 S636, S639,
S642 and S643 in the His-rich region of the
Dvl3 C-terminus. For complete information
about all identified phosphorylation sites see
Table1.
The MS/MS-based analysis demonstrated a
complex pattern of Dvl3 phosphorylation and
showed that many phosphorylation events take
place independently of exogenous CK1. In
order to classify individual phosphorylated
motives, we searched the sequence of Dvl3 for
substrate motives of known Dvl kinases,
specifically CK1, CK2, protein kinase C (PKC)
and Polo-like kinase 1 (PLK1) using GPS 2.1
software (34). High stringency searches did not
result in the prediction of kinases responsible
for all phosphorylation sites; we thus present in
Table 1 the results of searches with lower
stringency. Surprisingly, this analysis showed
that only two (S61, S211) out of 16
phosphorylation events induced by CK1
(indicated in orange or red in Fig. 2) appeared
in a canonical CK1 motif (see Table 1).
Moreover, based on the software prediction,
sequences containing S280, S350 and S636 are
not recognized by any of the considered Dvl
kinases (CK1, CK2, PKC and PLK1). This
suggests that either CK1 recognizes atypical
motives or alternatively that its phosphorylation
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
6
sites are primed for subsequent phosphorylation
by so far unidentified kinases. Our analysis
does not provide definitive answer to that
question.
Majority of the identified phosphorylated
residues were found outside of the DIX, PDZ
and DEP domains (Fig. 2A). The only
exceptions from this rule are infrequently
detected T15, S48 and S61 in the DIX and
CK1ε-induced S280 and S311 in the PDZ
domain. These three structured regions are
linked by intrinsically unstructured regions (see
PONDR-FIT prediction for hDvl3 in Fig. 2B)
(33), which contained almost all
phosphorylation sites (Table 1 and Fig. 2A).
We have thus tested in silico whether or not the
phosphorylations change the secondary
structure and folding of the protein. Mimicking
phosphorylation by changing phosphorylated
S/T residues in the unstructured regions for
aspartic acid (D) (Dvl3 S-D) resulted in a slight
increase of the score for the unstructured
regions (Fig. 2B). However, the overall
distribution of structured/unstructured regions
was not massively affected and it is unlikely
that even robust Dvl3 phosphorylation at
multiple sites affects the secondary structure of
the protein. However, we cannot exclude minor
changes or phosphorylation-induced formation
of novel tertiary contacts.
Basal Dvl-induced TCF/LEF-driven
transcription is significantly reduced by the
mutation of PDZ domain residues S280 and
S311 - In order to study the function of the
repeatedly identified (detected more than once)
phosphorylations, we decided to mutate the
S/Ts, which were selected based on the
following priority criteria: (i) unknown
function, (ii) induction/repression by CK1ε, (iii)
sequence conservation, and/or (iv) presence in
the structured regions with the well-defined
function.
In the first step we functionally analyzed the
phosphorylation of two individual serines: S280
and S311. These fully conserved residues are
present in the central part of the PDZ domain,
which is critically required for the function in
the Wnt/β-catenin pathway. We mutated S280
and S311 of human Dvl3 to either alanine (A),
to prevent phosphorylation or to glutamic acid
(E), to mimic constitutive phosphorylation and
tested the ability of these mutants to activate the
Wnt/β-catenin pathway by TopFlash assay. As
we show in Fig. 3A, Wnt/β-catenin pathway
induction by Dvl3 (S280A) was decreased
whereas induction by Dvl3 (S280E) was
increased when compared to wt Dvl3. S280 is
conserved among all Dvl isoforms. In order to
test the level of conservation of S280 function,
we have mutated corresponding serines in Dvl1
(S282A) and Dvl2 (S298A). As shown in Fig.
3B, the mutations of serines corresponding to
S280 (hDvl3) to alanine in Dvl1 and Dvl2 also
significantly reduced their ability to promote
downstream signaling. These data suggest that
phosphorylation of S280 is required for the
efficient Dvl activity in Wnt/β-catenin pathway
across the whole Dvl family.
In contrast to S280 both phospho-mimicking
and phospho-preventing mutation of S311
(S311A or S311E) resulted in a decreased
activation of Wnt/β-catenin pathway. The
function of S311 phosphorylation, however,
seems to be synergistic with S280 as shown by
the analysis double mutants. Mutation of
S280/S311 to A or E almost completely
abolished the activation of Wnt/β-catenin
pathway by Dvl3 (Fig. 3A). Interestingly, when
we co-expressed CK1ε (Fig. 3C) we have not
observed any significant differences among
individual mutants although S280A and
S280/311A mutants were slightly hypoactive
whereas S280E was hyperactive.
Data in Fig. 3A-C suggested an important
role of S280 and S311 for the downstream
canonical Wnt signaling. Specifically,
phosphorylation at S280 and subsequent
electrostatic changes might be relevant because
S280A decreases whereas phospho-mimicking
S280E increases the signaling efficiency of
Dvl3. The observed functional phenotype might
be explained by the fact that the S280 directly
borders with binding area common to several
proteins known to modulate Wnt signaling,
namely Idax (41), Fzd7 (42), and TMEM88
(43) (Fig. 3D). Considering that the binding
area for these proteins is predominantly
positively charged, the introduction of a strong
negative charge at its border is expected to
produce notable impact on binding affinity
between the Dvl PDZ domain and abovementioned
proteins (Fig. 3E).
Phosphorylation of residues in the Dvl3
C-terminus causes the electrophoretic
mobility changes induced by CK1ε but not
by Fzd5 - As the second step we have mutated
additional four clusters of S/Ts, which were
chosen based on the criteria defined above. The
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
7
mutated residues included the cluster of
S202/S203/S204/T205 from the basic region
(Cluster1; C1) and three C-terminally located
clusters S630/S633/S636 (Cluster2; C2),
S639/S642/S643 (Cluster3; C3), and S611/S612
(Cluster4; C4) (Fig. 4A). The cluster C1 was
selected because the level of phosphorylation of
this region decreased after CK1ε co-expression
and these sites are conserved in all considered
Dvl isoforms. The clusters C2, C3 and C4 are
conserved only in Dvl3 but phosphorylation of
these residues was strongly induced after CK1ε
co-expression. The four clusters of residues
were mutated to alanine.
Dvl can be detected on Western blot as two
bands designated Dvl and P (phosphorylated)Dvl.
Co-expression of CK1ε promotes the
formation of novel even more slowly migrating
form of Dvl3 named PS-(phosphorylated and
shifted)-Dvl (see Fig. 1A), which corresponds
to endogenous Dvl form induced by Wnts
(8,9,16,30). When we analyzed individual
mutants, we found that they show rather
comparable electrophoretic mobility (Fig. 4B).
The only exception was Dvl3-C1-SA with
electrophoretic migration slightly more retarded
than that of wt. This is in agreement with
original MS/MS data, which suggest that
phosphorylation of C1 residues opposes the
effects of CK1ε. In contrast, co-expression of
CK1ε led to the formation of PS-Dvl3 in all
Dvl3 variants with the exception of Dvl3-C2,
C2+C3 and C2+C3+C4 SA mutants (Fig. 4C).
The effects are not due to decreased ability of
CK1ε to bind to Dvl3 because wt Dvl3 and its
mutants C1 S-A and C2+3+4 S-A were able to
bind to CK1ε with similar efficiency (Fig. 4D).
The ability to activate TCF/LEF-driven
transcription (Topflash), which reflects the
ability to activate Wnt/β-catenin pathway, was
not significantly affected in any of the cluster
mutants (Fig. 4E). These observations suggest
that residues in clusters C2, C3 and C4 are
required for PS-Dvl formation but not for Dvl3
activity in the Wnt/β-catenin signaling.
It has been shown that not only CK1ε but
also Frizzled (Fzd) overexpression can lead to
the electrophoretic mobility shift of Dvl. Wnt
receptors Fzd are known to recruit Dvl to
cytoplasmatic membrane and to trigger Dvl
phosphorylation (5,29). In the next step we thus
tested the ability of Fzd5, selected for this
study, to control electrophoretic migration of
Dvl3 mutants. Although Fzd5 was able to
induce phosphorylation-dependent shift of
Dvl3, the shift was never as prominent as PSDvl3
induced by CK1ε (Fig. 4F). Moreover, the
intensity of Dvl3 phosphorylation was
comparable in all Dvl3 mutants including Dvl3
C2+3+4 S-A (Fig. 4F). This opened the
surprising possibility that CK1ε and Fzd5induced
phosphorylation is qualitatively
different. In order to test this possibility, we
introduced to hDvl3 K435M mutation in the
DEP domain, which corresponds to fly Dsh1
mutant (K417 in dDsh), which cannot interact
with Frizzled (5). Surprisingly, shift of Dvl3K435M
caused by CK1ε is comparable if not
identical to that of wt Dvl3 (Fig. 4C) whereas
Fzd5 is not able to trigger any detectable
change in the mobility of Dvl3-K435M, in
striking contrast to other mutants used in this
study (Fig. 4F). This suggests that the
phosphorylation events triggered by Fzd5 and
CK1ε are not identical.
Phospho-preventing mutations in Dvl3 Cterminus
interfere with CK1ε-induced but
not Fzd5-induced changes in Dvl3
subcellular localization - Dvl3 is usually
found in dynamic multiprotein aggregates
(44,45) called Dvl dots or puncta. After
coexpression of CK1ε, Dvl intracellular
localization changes from punctate to even (for
example see Fig. 5A); a phenomenon, which is
associated with decreased polymerization of
Dvl molecules (16). In contrast, high levels of
Fzd receptor or Fzd co-expression (5,29,46)
lead to membrane recruitment of Dvl (Fig. 5A).
In the next step we thus tested whether Dvl3
S/T-A mutants affect subcellular localization of
Dvl3. As we show in Fig. 5B all Dvl3 mutants
showed in HEK293t predominantly punctate
localization pattern. Interestingly, following
overexpression of CK1ε, C1 mutant and
K435M acquired even localization similarly to
wt Dvl3 whereas C2, C2+3 and C2+3+4 S-A
mutants showed an additive deficit in their
ability to achieve even subcellular distribution.
Localization of C2+C3+C4 S-A mutant in
presence and absence of overexpressed CK1ε
was indistinguishable. Mutations within PDZ
domain showed no detectable effect on
localization pattern of Dvl3 following CK1ε
overexpression.
In contrast to CK1ε, none of the tested Dvl3
S-A mutants showed a deficit in the Fzd5mediated
recruitment of Dvl3 to the plasma
membrane (Fig. 5B). Dvl3 (K435M), which is
analogous to Drosophila dDsh mutant Dsh1
(5)
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
8
and is expected to be deficient in membrane
recruitment by Fzd, however, clearly failed to
be recruited to plasma membrane by Fzd5 coexpression
(Fig. 5B). This suggests that
residues phosphorylated in response to CK1ε
and mutated in this study are not required for
Fzd5-induced membrane localization of Dvl3.
In combination with data in Fig. 4 we propose
that membrane recruitment of Dvl3 is required
for phosphorylation events induced by Fzd5 but
not by CK1ε.
Phospho-S643-antibody recognizes CK1εphosphorylated
and evenly distributed Dvl3 To
get better insight into the subcellular
localization of individual phospho pools of
Dvl3 we have raised a phospho-specific
antibody recognizing phosphorylated S643. We
have selected phospho-serine 643 as a candidate
epitope because it belongs to the cluster of
residues phosphorylated after CK1ε
coexpression, and it is the last phosphorylated
residue in the cluster of pS633, pS636, pS639,
pS642 and pS643. As we demonstrate on
Western blotting anti-pS643-Dvl3 antibody
strongly detected Dvl3 co-expressed with
CK1ε, whereas it almost did not recognize
FLAG-Dvl3 expressed alone or in combination
with Fzd5 (Fig. 5C). Anti-pS643-Dvl3 antibody
failed to detect Dvl3 (C2+3 SA) mutant where
S643 is mutated to A643, which demonstrates
that it is specific.
Next we analyzed subcellular distribution of
pS643-Dvl3 by immunocytochemistry in order
to identify the pool of Dvl3 specifically
modified by phosphorylation in the C-terminus.
The staining showed a weak signal that was
dramatically boosted by CK1ε overexpression
causing even localization of Dvl3 (Fig. 5D).
Importantly, Fzd5 overexpression leading to
Dvl3 membrane recruitment did not increase
the pS643-Dvl3 signal. This suggests that
membranous, Fzd5-recruited, Dvl3 is not
modified by CK1ε at S643. This observation
correlates well with the analysis of Dvl3
electrophoretic shift (Fig. 4C) and demonstrates
that phosphorylation of C2/C3/C4 residues is
part of the mechanism, which promotes even
localization of Dvl3 and is distinct from the
signaling events induced by Fzd5.
DISCUSSION
In this study, we performed unbiased
proteomic identification of Dvl3
phosphorylation pattern induced by CK1ε.
Previous studies in various experimental
systems identified several phosphorylation sites
spread throughout the structure of Dvl protein
(18,20-22). Combination of all data clearly
demonstrates that phosphorylation of Dvl
protein is extensive and the number of
phosphorylated sites extends 50. However, it is
likely that the number of phosphorylated
residues on a single Dvl molecule is lower
because MS/MS analysis cannot distinguish
individual differentially modified Dvl pools.
This assumption is supported by our
observation, that despite general increase in the
number of phosphorylated residues, some
phosphorylation sites in the basic region of
Dvl3 disappeared after CK1 co-expression.
To our surprise, the majority of the detected
phosphorylation events were not promoted by
CK1. This suggests that Dvl3 gets heavily
phosphorylated prior to Wnt-induced CK1mediated
activation. This is in good agreement
with our previous work where we show that
CK2 mediates such basal state of Dvl
phosphorylation, which is then required for
dynamic phosphorylation by CK1ε and for
further downstream signaling in the Wnt/catenin
pathway (16). Several kinases including
PKC, CK2, PLK1, RIPK4, and Abl have been
implicated previously in Dvl binding and
phosphorylation (11,19,37-40) and our in silico
analysis of phosphorylation sites supports
possible involvement of these kinases in the
basal state Dvl phosphorylation.
Our findings support earlier assumption that
CK1ε has a dual function in Dvl biology (16). It
seems that CK1ε acts as (i) the activator of
downstream Wnt/-catenin signaling via
phosphorylation of distinct S/T residues
(phosphorylation of S280/S311 in the PDZ
domain) as well as (ii) the inactivating kinase
affecting Dvl polymerization via
phosphorylation of the residues (C2+C3+C4) in
the C-terminus of Dvl3. The role of Dvl Cterminus
in the Wnt/β-catenin signaling was
established by our previous work, where we
proposed that it acts as the CK1-controlled
negative regulator (6,16). Here we identified
specific residues phosphorylated by CK1ε in
the C-terminus of Dvl3 (clusters C2, C3 and
C4). We demonstrate that these residues control
PS-Dvl formation and are critical for CK1εinduced
changes in Dvl3 subcellular
localization. Although the clusters C2, C3 and
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
9
C4 are conserved only in Dvl3, multiple S/T
residues are present also in the C-terminal
region of Dvl1 and Dvl2. This opens the
possibility that function of phosphorylated Cterminus
is conserved despite the differences in
the primary sequence. This possibility is
supported by recent findings by GonzalezSancho
and colleagues (17), which
demonstrated that formation of PS-Dvl2 and its
even localization depends on other residues of
hDvl2 C-terminus. The residues are conserved
in Dvl3 (S578 and S581 in hDvl3) but were
found constitutively phosphorylated in our
study.
Our data support the line of recent evidence
that Dvl C-terminus and the phosphorylation
therein controls the activity of Dvl in Wnt/βcatenin
pathway. It was reported that Dvl Cterminus
binds several components of the noncanonical
Wnt pathway such as NFAT (47) or
Ror2 (6). This together with other reports (48)
suggests that Dvl C-terminus can critically
contribute to several branches of non-canonical
Wnt signaling. In line with these observations,
it was recently shown that the phosphorylation
of the residues in the C-terminus of Dvl2
necessary for PS-Dvl2 formation is required for
Dvl2-dependent neurite outgrowth in TC-32
cells, a process not mediated by Wnt/β-catenin
pathway (17). It is not well understood how Dvl
C-terminus exerts its function, however recent
report proposes that C-terminus can
intramolecularly interact with the PDZ domain
(49). Phosphorylation in the C-terminus can
then affect the intramolecular conformation
similarly to the regulatory mechanism well
described among protein kinases. This
possibility is supported by earlier analysis of
the interaction of Ror2 and Dvl3, which showed
that Ror2 could efficiently recognize only PSDvl3
or Dvl3 C-terminus as such (6).
Most comprehensive study to date, which
attempted to identify Dvl phosphorylation, was
performed in Drosophila model and used
activation of Dvl by Frizzled overexpression
(18). This study concluded that S/T
phosphorylation of Dvl has no role neither in
PCP nor canonical Wnt signaling in fly. In
difference to that study we tested
phosphorylation of Dvl3 by overexpression of
the most relevant Dvl kinase – CK1ε. To our
surprise, when we mutated the most
dynamically phosphorylated Dvl3 residues in
the C-terminus we found that they are deficient
only in CK1ε-induced but not in Fzd5-induced
mobility shift or subcellular localization
changes. These distinct molecular features of
CK1ε- and Fzd5-induced events were further
confirmed by implementing anti-pS643-Dvl3
phospho-specific antibody, which recognized
only Dvl3 modified by CK1ε but not by Fzd5.
This data suggest that CK1ε is not directly
downstream of Fzd receptor but rather
represents independent, possibly parallel,
molecular mechanism of activation/deactivation
of Dvl.
In summary, our findings shed more light
onto complex molecular events on the level of
Dvl3 phosphorylations triggered by CK1ε. On
the single aminoacid level we show that CK1εmediated
phoshorylation in the PDZ domain
Ser280 and Ser311 is one of the steps in the
chain of events leading to the Wnt/-catenin
downstream activation. On the contrary,
phosphorylations in the C-terminus contribute
to the change of Dvl3 electrophoretic mobility
and mediate negative effects of CK1ε on Dvl
polymerization, which were postulated to be
part of the negative feedback loop.
REFERENCES:
1. Clevers, H. (2006) Wnt/beta-catenin signaling in development and disease. Cell 127, 469-480
2. MacDonald, B. T., Tamai, K., and He, X. (2009) Wnt/beta-catenin signaling: components,
mechanisms, and diseases. Dev Cell 17, 9-26
3. Schwarz-Romond, T., Fiedler, M., Shibata, N., Butler, P. J., Kikuchi, A., Higuchi, Y., and
Bienz, M. (2007) The DIX domain of Dishevelled confers Wnt signaling by dynamic
polymerization. Nat Struct Mol Biol 14, 484-492
4. Gao, C., and Chen, Y. G. (2010) Dishevelled: The hub of Wnt signaling. Cell Signal 22, 717-
727
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
10
5. Axelrod, J. D., Miller, J. R., Shulman, J. M., Moon, R. T., and Perrimon, N. (1998)
Differential recruitment of Dishevelled provides signaling specificity in the planar cell polarity
and Wingless signaling pathways. Genes Dev 12, 2610-2622
6. Witte, F., Bernatik, O., Kirchner, K., Masek, J., Mahl, A., Krejci, P., Mundlos, S.,
Schambony, A., Bryja, V., and Stricker, S. (2010) Negative regulation of Wnt signaling
mediated by CK1-phosphorylated Dishevelled via Ror2. Faseb J 24, 2417-2426
7. Yanagawa, S., van Leeuwen, F., Wodarz, A., Klingensmith, J., and Nusse, R. (1995) The
dishevelled protein is modified by wingless signaling in Drosophila. Genes Dev 9, 1087-1097
8. Bryja, V., Schulte, G., Rawal, N., Grahn, A., and Arenas, E. (2007) Wnt-5a induces
Dishevelled phosphorylation and dopaminergic differentiation via a CK1-dependent
mechanism. J Cell Sci 120, 586-595
9. Gonzalez-Sancho, J. M., Brennan, K. R., Castelo-Soccio, L. A., and Brown, A. M. (2004) Wnt
proteins induce dishevelled phosphorylation via an LRP5/6- independent mechanism,
irrespective of their ability to stabilize beta-catenin. Mol Cell Biol 24, 4757-4768
10. Bryja, V., Schulte, G., and Arenas, E. (2007) Wnt-3a utilizes a novel low dose and rapid
pathway that does not require casein kinase 1-mediated phosphorylation of Dvl to activate bcatenin.
Cell. Signal. 19, 610-616
11. Peters, J. M., McKay, R. M., McKay, J. P., and Graff, J. M. (1999) Casein kinase I transduces
Wnt signals. Nature 401, 345-350
12. Sakanaka, C., Leong, P., Xu, L., Harrison, S. D., and Williams, L. T. (1999) Casein kinase
iepsilon in the wnt pathway: regulation of beta-catenin function. Proc Natl Acad Sci U S A 96,
12548-12552
13. Kishida, M., Hino, S., Michiue, T., Yamamoto, H., Kishida, S., Fukui, A., Asashima, M., and
Kikuchi, A. (2001) Synergistic activation of the Wnt signaling pathway by Dvl and casein
kinase Iepsilon. J Biol Chem 276, 33147-33155
14. Cong, F., Schweizer, L., and Varmus, H. (2004) Casein kinase Iepsilon modulates the
signaling specificities of dishevelled. Mol Cell Biol 24, 2000-2011
15. Foldynova-Trantirkova, S., Sekyrova, P., Tmejova, K., Brumovska, E., Bernatik, O.,
Blankenfeldt, W., Krejci, P., Kozubik, A., Dolezal, T., Trantirek, L., and Bryja, V. (2010)
Breast cancer-specific mutations in CK1epsilon inhibit Wnt/beta-catenin and activate the
Wnt/Rac1/JNK and NFAT pathways to decrease cell adhesion and promote cell migration.
Breast Cancer Res 12, R30
16. Bernatik, O., Ganji, R. S., Dijksterhuis, J. P., Konik, P., Cervenka, I., Polonio, T., Krejci, P.,
Schulte, G., and Bryja, V. (2011) Sequential activation and inactivation of Dishevelled in the
Wnt/beta-catenin pathway by casein kinases. J Biol Chem 286, 10396-10410
17. Gonzalez-Sancho, J. M., Greer, Y. E., Abrahams, C. L., Takigawa, Y., Baljinnyam, B., Lee,
K. H., Lee, K. S., Rubin, J. S., and Brown, A. M. (2013) Functional consequences of Wntinduced
dishevelled 2 phosphorylation in canonical and noncanonical Wnt signaling. J Biol
Chem 288, 9428-9437
18. Yanfeng, W. A., Berhane, H., Mola, M., Singh, J., Jenny, A., and Mlodzik, M. (2011)
Functional dissection of phosphorylation of Disheveled in Drosophila. Dev Biol 360, 132-142
19. Kikuchi, K., Niikura, Y., Kitagawa, K., and Kikuchi, A. (2010) Dishevelled, a Wnt signalling
component, is involved in mitotic progression in cooperation with Plk1. EMBO J 29, 3470-
3483
20. Klimowski, L. K., Garcia, B. A., Shabanowitz, J., Hunt, D. F., and Virshup, D. M. (2006)
Site-specific casein kinase 1epsilon-dependent phosphorylation of Dishevelled modulates
beta-catenin signaling. The FEBS journal 273, 4594-4602
21. Klein, T. J., Jenny, A., Djiane, A., and Mlodzik, M. (2006) CKIepsilon/discs overgrown
promotes both Wnt-Fz/beta-catenin and Fz/PCP signaling in Drosophila. Curr Biol 16, 1337-
1343
22. Wu, C., Wei, W., Li, C., Li, Q., Sheng, Q., and Zeng, R. (2012) Delicate analysis of posttranslational
modifications on Dishevelled 3. Journal of proteome research 11, 3829-3837
23. Yokoyama, N., and Malbon, C. C. (2009) Dishevelled-2 docks and activates Src in a Wntdependent
manner. J Cell Sci 122, 4439-4451
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
11
24. Lee, K. H., Johmura, Y., Yu, L. R., Park, J. E., Gao, Y., Bang, J. K., Zhou, M., Veenstra, T.
D., Yeon Kim, B., and Lee, K. S. (2012) Identification of a novel Wnt5a-CK1varepsilonDvl2-Plk1-mediated
primary cilia disassembly pathway. EMBO J 31, 3104-3117
25. Angers, S., Thorpe, C. J., Biechele, T. L., Goldenberg, S. J., Zheng, N., MacCoss, M. J., and
Moon, R. T. (2006) The KLHL12-Cullin-3 ubiquitin ligase negatively regulates the Wnt-betacatenin
pathway by targeting Dishevelled for degradation. Nat Cell Biol 8, 348-357
26. Tauriello, D. V., Haegebarth, A., Kuper, I., Edelmann, M. J., Henraat, M., Canninga-van Dijk,
M. R., Kessler, B. M., Clevers, H., and Maurice, M. M. (2010) Loss of the tumor suppressor
CYLD enhances Wnt/beta-catenin signaling through K63-linked ubiquitination of Dvl. Mol
Cell 37, 607-619
27. Narimatsu, M., Bose, R., Pye, M., Zhang, L., Miller, B., Ching, P., Sakuma, R., Luga, V.,
Roncari, L., Attisano, L., and Wrana, J. L. (2009) Regulation of planar cell polarity by Smurf
ubiquitin ligases. Cell 137, 295-307
28. McKay, R. M., Peters, J. M., and Graff, J. M. (2001) The casein kinase I family in Wnt
signaling. Dev Biol 235, 388-396
29. Tauriello, D. V., Jordens, I., Kirchner, K., Slootstra, J. W., Kruitwagen, T., Bouwman, B. A.,
Noutsou, M., Rudiger, S. G., Schwamborn, K., Schambony, A., and Maurice, M. M. (2012)
Wnt/beta-catenin signaling requires interaction of the Dishevelled DEP domain and C
terminus with a discontinuous motif in Frizzled. Proc Natl Acad Sci U S A 109, E812-820
30. Bryja, V., Schulte, G., and Arenas, E. (2007) Wnt-3a utilizes a novel low dose and rapid
pathway that does not require casein kinase 1-mediated phosphorylation of Dvl to activate
beta-catenin. Cell Signal 19, 610-616
31. Bryja, V., Cajanek, L., Pachernik, J., Hall, A. C., Horvath, V., Dvorak, P., and Hampl, A.
(2005) Abnormal development of mouse embryoid bodies lacking p27Kip1 cell cycle
regulator. Stem Cells 23, 965-974
32. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C.,
and Ferrin, T. E. (2004) UCSF Chimera--a visualization system for exploratory research and
analysis. J Comput Chem 25, 1605-1612
33. Xue, B., Dunbrack, R. L., Williams, R. W., Dunker, A. K., and Uversky, V. N. (2010)
PONDR-FIT: a meta-predictor of intrinsically disordered amino acids. Biochim Biophys Acta
1804, 996-1010
34. Xue, Y., Ren, J., Gao, X., Jin, C., Wen, L., and Yao, X. (2008) GPS 2.0, a tool to predict
kinase-specific phosphorylation sites in hierarchy. Mol Cell Proteomics 7, 1598-1608
35. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W.,
Vogelstein, B., and Clevers, H. (1997) Constitutive transcriptional activation by a betacatenin-Tcf
complex in APC-/- colon carcinoma. Science 275, 1784-1787
36. Ossipova, O., Dhawan, S., Sokol, S., and Green, J. B. (2005) Distinct PAR-1 proteins function
in different branches of Wnt signaling during vertebrate development. Dev Cell 8, 829-841
37. Willert, K., Brink, M., Wodarz, A., Varmus, H., and Nusse, R. (1997) Casein kinase 2
associates with and phosphorylates dishevelled. Embo J 16, 3089-3096
38. Singh, J., Yanfeng, W. A., Grumolato, L., Aaronson, S. A., and Mlodzik, M. (2010) Abelson
family kinases regulate Frizzled planar cell polarity signaling via Dsh phosphorylation. Genes
Dev 24, 2157-2168
39. Huang, X., McGann, J. C., Liu, B. Y., Hannoush, R. N., Lill, J. R., Pham, V., Newton, K.,
Kakunda, M., Liu, J., Yu, C., Hymowitz, S. G., Hongo, J. A., Wynshaw-Boris, A., Polakis, P.,
Harland, R. M., and Dixit, V. M. (2013) Phosphorylation of Dishevelled by protein kinase
RIPK4 regulates Wnt signaling. Science 339, 1441-1445
40. Kinoshita, N., Iioka, H., Miyakoshi, A., and Ueno, N. (2003) PKC delta is essential for
Dishevelled function in a noncanonical Wnt pathway that regulates Xenopus convergent
extension movements. Genes Dev 17, 1663-1676
41. London, T. B., Lee, H. J., Shao, Y., and Zheng, J. (2004) Interaction between the internal
motif KTXXXI of Idax and mDvl PDZ domain. Biochem Biophys Res Commun 322, 326-332
42. Wong, H. C., Bourdelas, A., Krauss, A., Lee, H. J., Shao, Y., Wu, D., Mlodzik, M., Shi, D. L.,
and Zheng, J. (2003) Direct binding of the PDZ domain of Dishevelled to a conserved internal
sequence in the C-terminal region of Frizzled. Mol Cell 12, 1251-1260
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
12
43. Lee, H. J., Finkelstein, D., Li, X., Wu, D., Shi, D. L., and Zheng, J. J. (2010) Identification of
transmembrane protein 88 (TMEM88) as a dishevelled-binding protein. J Biol Chem 285,
41549-41556
44. Schwarz-Romond, T., Merrifield, C., Nichols, B. J., and Bienz, M. (2005) The Wnt signalling
effector Dishevelled forms dynamic protein assemblies rather than stable associations with
cytoplasmic vesicles. J Cell Sci 118, 5269-5277
45. Smalley, M. J., Signoret, N., Robertson, D., Tilley, A., Hann, A., Ewan, K., Ding, Y.,
Paterson, H., and Dale, T. C. (2005) Dishevelled (Dvl-2) activates canonical Wnt signalling in
the absence of cytoplasmic puncta. J Cell Sci 118, 5279-5289
46. Schulte, G., and Bryja, V. (2007) The Frizzled family of unconventional G-protein-coupled
receptors. Trends Pharmacol Sci 28, 518-525
47. Huang, T., Xie, Z., Wang, J., Li, M., Jing, N., and Li, L. (2011) Nuclear factor of activated T
cells (NFAT) proteins repress canonical Wnt signaling via its interaction with Dishevelled
(Dvl) protein and participate in regulating neural progenitor cell proliferation and
differentiation. J Biol Chem 286, 37399-37405
48. Ma, L., Wang, Y., Malbon, C. C., and Wang, H. Y. (2010) Dishevelled-3 C-terminal His
single amino acid repeats are obligate for Wnt5a activation of non-canonical signaling. J Mol
Signal 5, 19
49. Smietana, K., Mateja, A., Krezel, A., and Otlewski, J. (2011) PDZ domain from Dishevelled --
a specificity study. Acta Biochim Pol 58, 243-249
ACKNOWLEDGMENTS
We would like to thank Randy Moon, Madelon Maurice, Jeff Wrana, Jonathan M. Graff and S.
Yanagawa for providing plasmids. We would also like to thank Hana Pecuchova and Lenka Bryjova
for excellent technical assistance and members of the lab for inspirational discussions about the
results.
This study was supported by the grants from the Ministry of Education, Youth, and Sports of the
Czech Republic (MSM0021622430), and by the Czech Science Foundation (204/09/0498; 13-
31488P). The MS/MS analysis was supported by the project “CEITEC - Central European Institute of
Technology” (CZ.1.05/1.1.00/02.0068) from European Regional Development Fund and by CEITEC
Open Access project (LM2011020), funded by the Ministry of Education, Youth and Sports of the
Czech Republic under the activity „Projects of major infrastructures for research, development and
innovations”). LT thanks for support from VIDI - Career Development (Netherland’s Organisation for
Scientific Research.
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
13
FIGURE LEGENDS
Figure 1: Co-expression of CK1ε with FLAG-Dvl3 retards electrophoretic migration and induces
phosphorylation-dependent shift of Dvl (PS-Dvl3) (A) and induces TCF/LEF dependent transcription
as shown by TopFlash assay (B). C: Representative example of Coomassie Brilliant Blue R-stained
gel used for MS/MS analysis. See details in Material and methods.
Figure 2: (A) Dvl3 phosphorylation (summary of MS/MS data). Position and dynamics of detected
phosphorylations is indicated by color coded lines: green – less frequent in CK1ε induced samples,
blue – constitutive, orange – more often in CK1ε-induced samples, red – only in CK1ε induced
samples. The yellow/violet lines indicate hDvl3 protein coverage in the MS/MS analysis (yellow –
significant identification, violet – insignificant identification). C1, C2, C3, C4, S280 and S311 labels
indicate the position of residues mutated in the study. (B) Secondary structure of Dvl3 as predicted by
PONDR-FIT software (upper panel). Structured regions are indicated by values <0.5, unstructured by
values >0.5. Accuracy of the prediction is confirmed by the identification of DIX, PDZ and DEP
domains as regions with secondary structure. In silico mutation of all identified phosphorylated S/T
sites in basic region and C-terminus for D did not lead to the massive changes in the secondary
structure (lower panel).
Figure 3: Phosphopreventing mutations of S280/S311 in the PDZ domain block activation of the
Wnt/β-catenin pathway. (A-C): HEK 293 cells were transfected with indicated Dvl3 constructs,
TopFlash and Renilla and CK1ε. (A) Mutations of S280 and S311 prevent efficient activation of
Wnt/β-catenin by Dvl3. (B) The function of S280 is conserved in Dvl1 and Dvl2. Dvl1-S282A and
Dvl2-S298A, corresponding to Dvl3 S280A, activated Wnt/β-catenin pathway less efficiently than wt
Dvl1 and Dvl2 respectively. (C) In CK1ε treated samples no significant differences between the wt
Dvl3 and the mutant Dvl3 were detected. Samples were analyzed by One-way ANOVA followed by
Tukey post tests. * p<0.05, *** p<0.001, number of experiments ≥4. (D) Interaction sites of Idax (in
yellow), Fzd7 (in blue) and Tmem88 (in green) proteins determined for mouse Dvl1 PDZ domain
(PDB ID 1MC7). Phylogentically conserved S280 and S311 phosphorylation sites in human Dvl3
PDZ are shown in red. (E) Left panel: Schematic representation of secondary structure of mouse Dvl1
PDZ domain. Central panel: Modeled electrostatic surface potential of mDvl1 PDZ. Right panel:
Electrostatic surface potential of mDvl1 PDZ bearing phosphomimicking mutations at positions
corresponding to S280 and S311 of human Dvl3 PDZ. Phosphorylation sites are highlighted in
magenta (magenta arrow). Calculations of electrostatic surface potential were performed in UCSF
Chimera software
Figure 4: Functional analysis of phosphorylation sites in clusters C1-C4. (A) Representation of Dvl
structure with the positions of mutated residues. (B,C) HEK 293 cells were transfected with the
indicated plasmids, and the electrophoretic migration of Dvl3 in absence (B) and presence (C) of CK1
ε was analyzed by Western blotting with anti-Flag antibody. Mutations in C1 decreased Dvl3 mobility
(B) whereas mutations in C2, C2+3, C2+3+4 blocked PS-Dvl3 induction by CK1ε (C). The protein
expression levels of individual mutants were comparable. (D) The ability of individual Dvl3 mutants
to interact with CK1ε was tested by immunoprecipitation of CK1ε and Flag-Dvl3 and subsequent
analysis by Western blotting. (E) HEK293t cells were transfected with the indicated plasmids and the
ability to activate TCF/LEF-dependent transcription was assessed by TopFlash system. None of the
C1, C2, C2+3, C2+3+4 mutants showed any statistically significant difference. Statistical differences
were analyzed by One-way ANOVA followed by Tukey post tests. Number of experiments n≥3. (F)
HEK293t cells were transfected with the indicated plasmids, and the electrophoretic mobility of Dvl3
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
14
after V5-Fzd5 coexpression was analyzed by Western blotting. With the exception of Dvl3-K435M
electrophoretic mobility of all Dvl3 mutants was indistinguishable from wild type.
Figure 5: Analysis of subcellular localization of individual Dvl pools. (A) Representation of typical
distribution patterns of Dvl3 – punctate (i), even (ii), and membrane (iii). (B) HEK293 cells were
transfected with corresponding plasmids, fixed and Dvl3 was stained with anti-FLAG antibody.
Distribution pattern of Dvl3 was analyzed in at least 100 cells. CK1ε is unable to promote even
localization of Dvl3 in C2, C3 and C4 S-A mutants, whereas V5-Fzd5 changes the intracellular
distribution of Dvl3 to membranous in all tested constructs with the exception of Dvl3-K435M, which
served as positive control. (C, D) Phospho-S643-Dvl3 was detected using anti-pS643-Dvl3 specific
antibody by Westen blotting (C) or immunocytochemistry (D). Total Dvl3 was detected by anti-FLAG
antibody. (C) Anti-pS643-Dvl3 specific antibody does not detect Dvl3 C2+C3 S-A mutant, but it
strongly recognizes Dvl3 co-expressed with CK1ε. (D) The signal of anti-pS643-Dvl3 antibody (red)
is negligible for Dvl3 expressed either alone or in combination with Fzd5 but strong for evenly
distributed Dvl3 after CK1ε co-expression. Total Dvl3 detected by anti-Flag antibody is shown in
green. All confocal images were acquired using the same laser/detector settings and subsequently
quantified using ImageJ software. Graphs show the overlap of fluorescence intensity peaks of
individual channels along profiles indicated in the merged micrographs by a white line.
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
15
Table 1
Position 1
Dvl/Dvl+CK1ε2
Presence 3
Conservation 4
CK1 5
CK2 6
PKC 7
PLK1 8
Peptide 9
Note 10
15 0/1 ↑ Y o HLDGQETPYLVKLPL
48 1/0
↓
Y X RPSYKFFFKSMDDDFGVV
K
61 0/1 ↑ Dvl2 X FGVVKEEISDDNAKLPCF
116 1/1 ↔ Y X GIGDSRPPSFHPHAGGGS
125 6/6 ↔ Y X HPHAGGGSQENLDND
133 3/3 ↔ y X X QENLDNDTETDSLVS
135 2/3 ↖↗ y X X NLDNDTETDSLVSAQ
137 3/3 ↔ Y X DNDTETDSLVSAQRE
140 4/4 ↔ Y X X TETDSLVSAQRERPR
175 2/1 ↓ Y ~ RRREPGGYDSSSTLM
192 7/5 ↓ Y X ETTSFFDSDEDDSTS
197 3/1 ↓ Dvl2 X X X FDSDEDDSTSRFSSS
202 4/4 ↓ Y X X DDSTSRFSSSTEQSS C1
203 7/4 ↓ y X X DDSTSRFSSSTEQSS C1
204 2/1 ↔ Y o o o DDSTSRFSSSTEQSS C1
205 3/6 ↔ Y ~ ~ TSRFSSSTEQSSASRL C1
208 5/7 ↔ Y X FSSSTEQSSASRLMR
209 5/7 ↔ Y X FSSSTEQSSASRLMR
211 0/1 ↑ Y o o SSTEQSSASRLMRRHK
232 5/5 ↔ Dvl2 X X KVSRIERSSSFSSIT
234 6/5 ↔ Y X KVSRIERSSSFSSIT
237 6/4 ↔ Y o ERSSSFSSITDSTMS
280 0/4 ↑ Y GGIYIGSIMKGGA
311 0/4 ↑ Y X EINFENMSNDDAVRV
350 0/4 ↑ n CFTLPRSEPIRPID
421 3/2 ↔ n X AIVKAMASPESGLEV
512 2/3 ↔ Y X SLHDHDGSSGASDQD
516 4/5 ↔ Y o DGSSGASDQDTLA
564 1/1 ↔ Y o LGYSYGGGSASSQHSEGS
566 1/3 ↔ n X SYGGGSASSQHSEGS
567 3/5 ↖↗ Y o SYGGGSASSQHSEGS
570 6/4 ↔ Y X GSASSQHSEGSRSSG
573 5/6 ↔ Y X SSQHSEGSRSSGSNR
575 4/5 ↔ Y X HSEGSRSSGSNRSGS
576 4/5 ↔ Y X X HSEGSRSSGSNRSGS
578 3/4 ↔ Y X EGSRSSGSNRSGSDR
601 3/4 ↔ Y X GDSKSGGSGSESDHT
603 4/3 ↔ Y X X GDSKSGGSGSESDHT
605 1/1 ↔ Y o SGGSGSESDHTTRSSLR
611 1/3 ↖↗ Dvl1 X ESDHTTRSSLRGPRE C4
612 1/3 ↖↗ Dvl1 X ESDHTTRSSLRGPRE C4
622 2/6 ↔ n X GPRERAPSERSGPAA
Phosphorylation of Dvl3 by CK1ε: MS/MS analysis
16
625 2/6 ↔ n o RERAPSERSGPAASEHS
633 0/1 ↑ n o RSGPAASEHSHRSHHSLAS C2
636 0/5 ↑ n ASEHSHRSHHSLASSLR C2
639 0/6 ↑ n ~ EHSHRSHHSLASSLRSH C3
642 1/3 ↖↗ n o SHHSLASSLRSHHTH C3
643 1/5 ↖↗ n X SHHSLASSLRSHHTH C3
689 2/5 ↖↗ Dvl2 PPGRDLASVPPELTA
697 1/1 ↔ Y o SVPPELTASRQSFRMAMG
700 1/1 ↔ Y X ELTASRQSFRMAMGN
1
Position of aa; 2
Number of identification in Dvl/Dvl3 +CK1ε; (found in n= experiments, n=7)3
Presence of phosphorylation; ↑ only in
induced; ↖↗ more in induced; ↔ constitutively phosphorylated; ↓ less in induced; 4
Y- conserved in all isoforms (species considered: M.
musculus, H. sapiens, X. laevis, X. tropicalis) as S/T/Y; y- conserved in all Dvl isoforms either as S/T/Y or polar aa (D,E,Q,N);
Dvl1/Dvl2 conserved also in this isoform; n- not conserved; 5;6;7;8;
X high strindency prediction; o medium stringeny prediction; ~ low
stringency prediction;9
phosphorylated peptide sequence;
Phosphorylation in Bold10
C1/C2/C3/C4 – mutated in cluster
Předmět: JBC/2014/547521 ‐‐ Manuscript Decision
Od: jkyriakis@asbmb.org
Datum: 24.1.2014 16:56
Komu: "V&iacute;t&ecaron;zslav Bryja" <bryja@sci.muni.cz>
MS ID#: JBC/2014/547521
MS TITLE: Functional analysis of Dishevelled‐3 phosphorylation identifies
distinct mechanisms driven by Casein Kinase 1&[epsilon] and Frizzled5
Dear Dr. Bryja:
Your manuscript entitled "Functional analysis of Dishevelled‐3 phosphorylation
identifies distinct mechanisms driven by Casein Kinase 1&[epsilon] and
Frizzled5" (JBC/2014/547521) has been reviewed by the Editorial Board.  
Unfortunately, the decision was made to decline the manuscript in its current
form.  The reviewers did, however, recommend consideration of a suitably and
substantially revised version that addresses the criticisms raised in the
comments shown below. Note that no guarantee of acceptance of the revised
manuscript is implied.
Some new experimentation is needed in any revision, and a revision that does not
include new experiments will not be considered.  Chiefly, only a
gain‐of‐function approach was taken to identify CK1‐related phosphorylation
sites. These events have to be evaluated in the absence of CK1 activity by using
a loss‐of‐function approach, such as RNAi.  In addition, the in vivo
physiological/functional significance of the phosphorylation (or
de‐phosphorylation) of some of the sites, such as S280/S311, needs to be
demonstrated.  Lastly, several of the figures need to be reconfigured for
greater clarity.
Upon receipt of a revised manuscript, it will be sent for further editorial
evaluation.  The revised manuscript should be submitted via the JBC Electronic
Submission site at http://submit.jbc.org as a single PDF file. Any supplemental
files to be published with the manuscript must conform to our Editorial
Policies. Supplemental information must be limited to such things as videos, 3‐D
structures/images, extended chemical syntheses, extensive NMR data, molecular
dynamics, kinetic modeling data, and other large data sets — e.g., those
obtained with microarray analyses or mass spectrometry studies. (For more
information, please see http://www.jbc.org/site/misc/ifora.xhtml#supplemental)
The manuscript should be accompanied by a cover letter in which you provide a
point‐by‐point listing of the changes made. The cover letter should not be in
the PDF file containing the manuscript—it must be entered at the online
submission site.  It is important for major findings of your study to be
intelligible to all of our readers, including those who are not specialists in
the field.  Please review your title and summary to make sure they convey your
essential points succinctly and clearly and do not contain undefined
abbreviations or specialized terms. If you resubmit, please carefully follow the
Instructions to Authors at the JBC Online Submission Site for preparation of
text and graphic files at http://www.jbc.org/site/misc/itoa.xhtml to resubmit
your manuscript on line.
Please note that the revised manuscript must be submitted within 120 days of the
decision date or a new manuscript number will be assigned.  Please include the
manuscript number of your original submission in your cover letter.
Thank you for the opportunity to consider your work.
Sincerely,
John M. Kyriakis
Associate Editor
Reviewer 1
COMMENTS FOR THE AUTHOR:
The authors addressed which Dvl residues were phosphorylated by CK epsilon.
Using LC‐MS/MS, 16 sites 
were identified to be candidate phosphorylation sites of Dvl induced by CK
epsilon. They then carried out 
mutation experiments. Mutations in PDZ domain prevented activation induced by
Wnt/beta‐catenin. 
Mutations of clustered S/T in the C‐terminus prevented CK1‐induced mobility
shift, whereas the 
downstream signal was not affected. However, phosphorylation triggered by Fzd5
seems to be qualitatively 
JBC/2014/547521	‐‐	Manuscript	Decision mailbox:///C:/Users/Vita	Bryja/AppData/Roaming/Thunderbird...
1	z	2 4.3.2014	8:47
different. To explore further the functional implication, they examined
subcellular localization. Although 
Dvl signal was found to be punctate, co‐expression of CK epsilon lead to even
pattern, and Fzd expression 
resulted in membrane pattern. Mutations of clustered S/T in the C‐terminus Dvl
prevented this subcellular 
localization. From these data, the authors suggest that CK epsilon acts on Dvl
that is independent of Fzd5. 
The data are clear and supportive of the conclusions. However, some of the
results should be described in 
more detail and several data need to be shown clearly. Specific comments are as
follows: 
1. Figure 1A and B: Molecular weight for A should be labeled, and y‐axis of
graph B should also be labeled.
2. Figure 3A, B, and C: y‐axis of the graphs should be labeled. Appropriate
description about the graphs is 
also lacking.
3. Figure 4E: y‐axis of the graphs should be labeled. Appropriate description
about the graphs is lacking.
4. Figure 4B: I could not find retarded migration of the band of Dvl‐C1‐SA.
5. Figure 4F: Expression level of FLAG‐hDvl3 seems to be low when co‐transfected
withV5‐Fzd5. Why?
Reviewer 2
COMMENTS FOR THE AUTHOR:
Bernatik et al. has analyzed phosphorylation events of human Dvl3 induced by CK1
kinase. Since there are ~50 phosphorylation sites identified, the authors
focused on some, like S280 and S311, and carried out further in vitro functional
analysis. Molecular details learned from this study are certainly very useful
for a better understanding of Wnt signaling and its regulation. However, there
are some major concerns about this work.
1) Only a gain‐of‐function approach was taken to identify CK1‐related
phosphorylation sites. These events have to be evaluated in the absence of CK1
activity by using a loss‐of‐function approach, such as RNAi.
2) In vivo physiological/functional significance of the phosphorylation (or
de‐phosphorylation) of some of the sites, such as S280/S311, need to be
demonstrated.
Sent on: January 24, 2014
JBC/2014/547521	‐‐	Manuscript	Decision mailbox:///C:/Users/Vita	Bryja/AppData/Roaming/Thunderbird...
2	z	2 4.3.2014	8:47