1234
© The Author(s) 2020. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved.
For permissions, please e-mail: journals.permissions@oup.com
Biology of Reproduction, 2020, 102(6), 1234–1247
doi:10.1093/biolre/ioaa024
Research Article
Advance Access Publication Date: 26 February 2020
Research Article
Knockout of mouse receptor accessory protein 6
leads to sperm function and morphology
defects†
Darius J. Devlin1,2,‡, Smriti Agrawal Zaneveld3,4,‡, Kaori Nozawa2,5,
Xiao Han3,4,7, Abigail R. Moye6, Qingnan Liang3,4,6,
Jacob Michael Harnish4, Martin M. Matzuk2,4,5,* and Rui Chen3,4,*
1Interdepartmental Program in Translational Biology & Molecular Medicine, Baylor College of Medicine, Houston,
TX, USA, 2Department of Pathology & Immunology, Baylor College of Medicine, Houston, TX, USA, 3Human Genome
Sequencing Center, Baylor College of Medicine, Houston, TX, USA, 4Department of Molecular and Human Genetics,
Baylor College of Medicine, Houston, TX, USA, 5Center for Drug Discovery, Baylor College of Medicine, Houston,
TX, USA, 6Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX, USA, and
7Reproductive Medical Center, People’s Hospital of Zhengzhou University, Zhengzhou, China
*Correspondence: Center for Drug Discovery and Department of Pathology & Immunology, Baylor College of Medicine,
One Baylor Plaza, Houston, TX 77030, USA. Tel: (713) 798-6451, (713) 798-5838; E-mail: mmatzuk@bcm.edu (Martin M.
Matzuk); Human Genome Sequencing Center and Department of Molecular and Human Genetics, Baylor College of
Medicine, One Baylor Plaza, Houston, TX 77030, USA. Tel: (713) 798-5194, (713) 798-5741; E-mail: ruichen@bcm.edu (Rui
Chen)
†Grant Support: Eunice Kennedy Shriver National Institute of Child Health and Human Development (R01HD088412 to
MMM), National Eye Institute (R01EY022356 to RC), National Institute of General Medical Sciences (T32GM088129 and
T32GM120011 to DJD), Japan Society for the Promotion of Science Overseas Research Fellowship and Lalor Foundation
(to KN). This work is partially supported by National Eye Institute grant R01EY026545 to Theodore G. Wensel (for ARM).
‡Equal contributors
Received 25 August 2019; Revised 31 December 2019; Editorial Decision 18 February 2020; Accepted 26 May 2020
Abstract
Receptor accessory protein 6 (REEP6) is a member of the REEP/Ypt-interacting protein family that
we recently identified as essential for normal endoplasmic reticulum homeostasis and protein
trafficking in the retina of mice and humans. Interestingly, in addition to the loss of REEP6 in
our knockout (KO) mouse model recapitulating the retinal degeneration of humans with REEP6
mutations causing retinitis pigmentosa (RP), we also found that male mice are sterile. Herein, we
characterize the infertility caused by loss of Reep6. Expression of both Reep6 mRNA transcripts
is present in the testis; however, isoform 1 becomes overexpressed during spermiogenesis. In
vitro fertilization assays reveal that Reep6 KO spermatozoa are able to bind the zona pellucida but
are only able to fertilize oocytes lacking the zona pellucida. Although spermatogenesis appears
normal in KO mice, cauda epididymal spermatozoa have severe motility defects and variable
morphological abnormalities, including bent or absent tails. Immunofluorescent staining reveals
that REEP6 expression first appears in stage IV tubules within step 15 spermatids, and REEP6
localizes to the connecting piece, midpiece, and annulus of mature spermatozoa. These data reveal
an important role for REEP6 in sperm motility and morphology and is the first reported function for
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1235
a REEP protein in reproductive processes. Additionally, this work identifies a new gene potentially
responsible for human infertility and has implications for patients with RP harboring mutations in
REEP6.
Summary sentence
Receptor accessory protein 6 is essential for sperm motility, morphology, and penetration of the
zona pellucida in mice.
Key words: sperm, spermatid, sperm hyperactivation, sperm motility, testis, epididymis, fertilization, male infertility,
male reproductive tract..
Introduction
Infertility, the inability to conceive after 12 months of intercourse,
is a condition that affects nearly 15% of couples worldwide and is
attributed to a male factor in at least 50% of cases [1]. Asthenozoospermia,
or reduced sperm motility, is a defect that often leads
to infertility in humans due to the requirement of rigorous motility
for passage through the female reproductive tract and penetration
of the cumulus–oocyte complex [2, 3]. Defects in many aspects of
sperm development and function can lead to asthenozoospermia,
including defective axoneme formation, mitochondrial mislocalization,
mislocalization of flagellar accessory structures, and many
others [4]. Though new proteins governing aspects of motility are
still being identified like SUN5 [5], TCTE1 [6], SSP411 [7], and
CFAP69 [8], more work is needed to identify new proteins playing
roles in spermiogenesis and sperm function and to elucidate their
molecular functions to improve infertility diagnosis, identify targets
for contraceptive development, and further basic biological under-
standing.
In our previous study for the transmembrane protein receptor
accessory protein 6 (REEP6), we developed a knockout (KO) mouse
to study the roles of REEP6 in the retina, after discovering that
mutations in human REEP6 cause retinitis pigmentosa (RP) [9, 10].
Being a member of the REEP/Yop1p family of proteins, which are
well studied in somatic cells such as retinal rod cells for their roles
in endoplasmic reticulum (ER) shaping and vesicle trafficking [11–
17], we discovered new roles in ER and mitochondrial homeostasis
and protein trafficking in rod photoreceptors for this understudied
member of the REEP family [9]. An unexpected finding
from our follow-up studies was that while Reep6 KO females
were fertile, Reep6 KO males were sterile, never siring offspring
throughout the entire study. Herein, we describe the characterization
of Reep6 KO male infertility and define a role for REEP6 in spermatogenesis,
sperm motility, and fertilization. The work presented
here is significant for the male patients identified in our previous
study and to the greater public for its implications in human male
fertility.
Materials and methods
Animals
All experiments involving animals were approved by the Institutional
Animal Care and Use Committee (IACUC) of Baylor College of
Medicine (Houston, TX) and were conducted in compliance with
the guidelines and regulations for animal experimentation at this
institution under protocol AN-716 in the laboratory of M.M.M. and
protocol AN-4175 in the laboratory of R.C. All experiments were
also in compliance with the ‘Ethical Guidelines and Responsibilities’
defined in the Biology of Reproduction Author Guidelines. Mice
were maintained under a 12 h:12 h light:dark cycle (from 6:00 AM
to 6:00 PM).
In this study, C57BL/6J male mice with heterozygous (HET) or
homozygous (KO) null mutations in Reep6 were used as generated
from our previous report [9]. For all in vivo and in vitro fertilization
(IVF) experiments, Reep6 male mice were mated to wild-type (WT)
female CD-1 or B6D2F1 mice from Charles River Laboratories.
Antibodies, lectins, and stains
A custom rabbit polyclonal anti-REEP6 antibody (1:1000 dilution
for western blot, 1:200 for immunostaining) was kindly provided
by Dr Anand Swaroop (National Eye Institute, National Institutes
of Health) as described previously [13]. Mouse monoclonal antiGAPDH-HRP
was purchased from ProteinTech (product no. HRP-
60004). Mouse monoclonal anti-αtubulin-AF488 was purchased
(1:200 dilution; product no. 322588; ThermoFisher) to stain spermatozoa
axoneme. Rabbit monoclonal anti-acetylated-α-tubulin was
purchased (1:800 dilution; product no. 5335; Cell Signaling) to
stain motile spermatozoa axonemes. The lectins peanut agglutinin
(PNA)-FITC (1:250 dilution; product no. L7381; Sigma-Aldrich)
and soybean agglutinin (SBA)-FITC were purchased (1:500 dilution;
product no. FL-1011; Vector Labs). MitoTracker Red FM was
purchased (400 nM dilution; product no. M7512; Invitrogen) as
a mitochondrial stain. The 4 ,6-diamidino-2-phenylindole (DAPI)
was purchased for immunofluorescence (1 μg/mL dilution; product
no. D9542; Sigma-Aldrich) as a nuclear stain. LIVE/DEAD sperm
viability kit was purchased (product no. L-7011; Invitrogen) to
determine sperm viability.
Western blot analysis
Testis and whole epididymis tissue were collected from adult mice
(≥12 weeks) and frozen on dry ice. Frozen tissues were weighed
and 100–200 mg pieces of tissue were placed in cold tissue protein
extraction reagent (T-PER, ThermoFisher) and homogenized. The
homogenate was centrifuged at 15 000 RPM for 15 min at 4 ◦C in
a tabletop centrifuge. The supernatant was collected and quantified
using a bicinchoninic acid protein assay kit (ThermoFisher). On a
4–12% Bis-Tris polyacrylamide gel, 30 μg of protein was loaded to
each well. The proteins from the Bis-Tris gel were transferred to a
PVDF membrane using the TransBlot TURBO (BioRad). Membranes
were blocked with 5% skim milk in Tris-buffered saline-Tween 20
(TBST; 20 mM Tris-HCl pH 7.6, 150 mM NaCl, 0.1% Tween 20)
for 1 h at room temperature (RT). Primary antibodies were diluted
in blocking solution and incubated with the membranes overnight at
4 ◦C or 1 h at RT. Membranes were washed three times with TBST
before being incubated with donkey polyclonal anti-rabbit IgGHRP-conjugated
secondary antibody (Jackson ImmunoResearch,
#711-035-152) diluted 1:5000 in blocking buffer. Membranes were
1236 D.J. Devlin et al., 2020, Vol. 102, No. 6
washed and developed with SuperSignal West Pico PLUS chemiluminescent
substrate (ThermoFisher) and imaged on a BioRad ChemiDoc.
For repeat probing of the polyvinylidene fluoride (PVDF)
membrane, a 15-min incubation in mild stripping buffer (200 mM
glycine pH 2.5, 1% sodium dodecyl sulfate, and 1% Tween 20) at RT
was performed before washing the membrane 3× in TBS for 5 min
each and repeating the blocking step for 30 min.
Reverse transcriptase-PCR
For mRNA temporal expression analysis,testes from WT B6129SF1/J
hybrid mice were collected at postnatal days (PND) 3, 6, 10,
14, 21, 28, and 35 and frozen at −80 ◦C. These time points
were selected based on the progression of testis development and
the onset of the first wave of spermatogenesis [18]. Total RNA
was extracted from the tissues using TRIzol reagent (Invitrogen),
treated with DNaseI to remove genomic DNA, and cleaned with
the RNeasy Mini Kit (Qiagen). The qScript cDNA Supermix
(Quanta Biosciences) was used to generate cDNA. Reep6 mRNA
was amplified by PCR using the cDNA as a template with the
following primers: (F) 5 -AGCGGAAGAGCATTGGACCTA, (R) 5 GTGGGGTCTGACTTTACTTGG,
which amplify transcript variants
1 (Reep6.1, 145-bp amplicon) and 2 (Reep6.2, 64-bp amplicon).
Hypoxanthine guanine phosphoribosyl transferase (Hprt) was used
as an expression control and amplified (400-bp amplicon) using the
following primers: (F) 5 -TGGACAGGACTGAAAGACTTGCTCG,
(R) 5 -GGCCTGTATCCAACACTTCGAGAGG. PCR was conducted
using the GoTaq Green Master Mix (Promega) according
to the manufacturer’s instructions, with a final primer concentration
of 500 nM and amplifying in the thermocycler for 35 cycles. An
additional sample containing no cDNA input was included as a
no-template control (NTC) for the PCR and was loaded onto the
agarose gel as a negative control.
Histology of reproductive tissues
For periodic acid-Schiff (PAS)–hematoxylin staining, testis and
whole epididymis tissues were collected from ≥8-week-old mice
and fixed in Bouin’s fixative (Sigma Aldrich) for 4–6 h while
rotating. Tissues were then washed in 70% ethanol to remove excess
fixative. Testes were cut along the transverse plane to allow for crosssectioning.
Tissues were submitted in cassettes submerged in 70%
ethanol to the Baylor College of Medicine Pathology & Histology
Core for processing and paraffin embedding. Embedded tissues were
sectioned at 5 μm and mounted on slides. PAS–hematoxylin staining
was conducted according to Ahmed and de Rooij, deparaffinized
in histoclear, rehydrated from ethanol to water, stained with PAS
reagent, counterstained with hematoxylin, dehydrated, cleared with
Histoclear, and mounted with permount [19].
CASA and CASAnova mouse sperm motility analysis
Spermatozoa from the cauda epididymis of adult mice (≥12 weeks)
were collected by dissecting the tissue and placing it in a 1.5 mL
microcentrifuge tube with 1.0 mL human tubal fluid (HTF) medium
(101 mM NaCl, 4.69 mM KCl, 0.2 mM MgSO4, 0.37 mM KH2PO4,
2.04 mM CaCl2, 25 mM NaHCO3, 2.78 mM glucose, 0.33 mM
sodium pyruvate, 21.4 mM sodium lactate, 75 μg/mL penicillin G,
50 μg/mL streptomycin sulfate, 2 μg/mL phenol red, and 9 mg/mL
bovine serum albumin) pre-equilibrated in a 37 ◦C incubator with
5% CO2 [20]. The tissue was minced by cutting 30 times with small
scissors and placed in the incubator with the tubes ajar under 5%
CO2 for 15 min to allow spermatozoa to release. Using a widebore
micropipette tip, spermatozoa were diluted 1:50 into 1.0 mL
of fresh equilibrated media. A 20-μL sample of the dilution was
placed on a chamber of 100 μm-depth counting slides (CellVision)
for measuring with the CEROS II animal Computer Assisted Sperm
Analysis (CASA) machine (Hamilton Thorne) and the 1:50 dilution
was returned to the incubator. Sperm hyperactivity was measured
from the 1:50 dilution after an additional 105 min (120 min total)
of incubation. Hyperactivated spermatozoa were classified using
CASAnova (https://uncnri.org/CASAnova). CASAnova is an online
multiclass support vector machine (SVM) algorithm (trained with
over 2000 manually classified sperm motility tracks) for classifying
sperm motility patterns into vigorous (progressive, intermediate, or
hyperactive) and non-vigorous motility patterns (slow or weak), as
detailed in Goodson [21]. CASAnova takes five sperm kinematic
measurements from CASA (average path velocity, VAP; curvilinear
velocity, VCL; straight line velocity, VSL; amplitude of lateral head
displacement, ALH; and beat cross frequency, BCF) into account and
uses a decision tree based on equations derived from the training
set to classify motility patterns. To use CASAnova, motility data for
individual spermatozoa recorded by the CEROS II were exported to
ASCII files, which were uploaded to the website for analysis. The
CASAnova output was copied into an Excel (Microsoft) spreadsheet
for data manipulation and statistical analysis.
Sperm viability analysis
Freshly released cauda epididymal sperm suspension was collected
and diluted to 3 × 106
cells/mL in 1.0 mL HEPES-buffered HTF
media (mHTF; 101.6 mM NaCl, 4.69 mM KCl, 0.2 mM MgSO4,
0.37 mM KH2PO4, 2.04 CaCl2, 4.0 mM NaHCO3, 21.0 mM
HEPES pH 7.4, 2.78 mM glucose, 0.33 mM sodium pyruvate,
21.4 mM sodium lactate, 75 μg/mL penicillin G Na salt, 50 μg/mL
streptomycin sulfate, 2 μg/mL phenol red, and 5 mg/mL BSA) in
a 2-mL microcentrifuge tube at 37 ◦C in a water bath. SYBR-14
and propidium iodide dyes were included in the LIVE/DEAD sperm
viability kit to stain live spermatozoa (green) and dead spermatozoa
(red) as reported [22, 23]. To each sperm suspension, SYBR-14 was
diluted to a 100-nM final concentration and incubated for 10 min at
37 ◦C. After the incubation period, propidium iodide was diluted to
a 12-μM final concentration in each sperm suspension and incubated
for 10 min at 37 ◦C. A 20-μL sample was pipetted onto a superfrost
microscope slide for each sample, cover slipped, and imaged with
an epifluorescence microscope. At least 100 cells were counted per
mouse and 500 cells counted per genotype. Cells were manually
counted with ImageJ software (National Institutes of Health) Cell
Counter plugin.
Immunofluorescent staining
For testis cryosections, tissues from adult mice were dissected and
fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline
(PBS; 137 mM NaCl, 2.7 mM KCl, 1.8 mM KH2PO4, 10 mM
Na2HPO4 pH 7.4) + 0.1% Triton X-100 (PBTx) overnight at 4 ◦C.
Testes were incubated in increasing sucrose/PBS buffer from 10
to 20%, allowing the testis to sink to the bottom of each tube
before changing buffer. A final incubation in a 1:1 mixture of 20%
sucrose:optimal cutting temperature compound (O.C.T., Tissue-Tek)
for an overnight incubation at 4 ◦C was done before placing the
tissue in a cryomold, covering with OCT, and freezing the block
at −80 ◦C. The blocks were sectioned at 10 μm and mounted on
slides. Tissue sections were blocked with PBTx + 3% BSA + 5%
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1237
normal donkey serum for 1 h at RT. Primary antibodies were
diluted in blocking buffer (without Triton X-100) and incubated
with sections overnight at 4 ◦C. Sections were washed with 3%
BSA/PBS before incubating with secondary antibodies for 1 h at
RT. In the final wash, DAPI was added at 1:1000 dilution in the
wash buffer for 10 min. Primary antibodies used include rabbit
anti-REEP6, mouse anti-αtubulin-AF488, SBA-FITC, and PNAFITC.
Secondary antibodies were donkey anti-rabbit-AF594
and donkey anti-mouse-AF488 (Life Technologies, #a21207 and
a21202). Slides were imaged with a Zeiss AxioObserver Z.1 inverted
fluorescence microscope. Images were processed using the Zeiss Zen
Blue software version 2.6.
For spermatozoa, samples were collected from the cauda epididymis
or vas deferens and allowed to swim up in HTF media
for 15 min. For labeling mitochondria in spermatozoa, a freshly
collected sperm suspension was prepared in 1.0 mL mHTF in a 37 ◦C
water bath or heat block. Mitochondria were stained with a final
concentration of 400 nM MitoTracker Red CMXRos (Invitrogen)
according to the protocol by Sutovsky [24]. After 10-min incubation
of spermatozoa with MitoTracker dye at 37 ◦C, cells were washed
twice with PBS by centrifugation at 300 × g for 5 min. A 20-μL
sample of spermatozoa was placed on a poly-L-lysine coated slide,
and spermatozoa were allowed to bind for at least an hour before
starting the immunofluorescence protocol. Otherwise, medium from
the top portion of each suspension was collected and centrifuged at
300 × g for 5 min at RT to wash the spermatozoa in PBS. Using
poly-L-lysine coated slides, 20 μL of sperm suspension was placed
on slides and allowed to attach for 1 h at RT. Attached spermatozoa
were fixed in 30 μL of 4% PFA/PBTx for 30 min at RT. Slides
were washed in PBS, then blocked with 5% BSA/PBS for 1 h at RT.
Primary antibodies were diluted in blocking buffer and incubated
with spermatozoa overnight at 4 ◦C in a humidified chamber. Slides
were washed and incubated with fluorescent secondary antibodies
diluted in blocking buffer. Slides were washed with PBS for 5 min,
then DAPI diluted in PBS for 10 min, then a final PBS wash for
5 min. Slides were mounted with a drop of Immu-mount aqueous
medium (Thermo Fisher). Images were captured with either a Zeiss
LSM 880 Confocal microscope at 63× magnification or a Zeiss
AxioObserver epifluorescence microscope at 40× magnification.
Fluorescence intensity of confocal microscopy images from a representative
Reep6 HET and Reep6 KO mouse epididymal spermatozoa
was quantified using ImageJ [25]. For both HET and KO mice,
five field images of sperm were captured, containing a total of at
least 50 spermatozoa, and fluorescence intensity for each field was
determined by ImageJ. The raw fluorescence intensity of each field
was normalized by dividing by the number of spermatozoa in the
corresponding field. The resulting intensity/sperm values for the HET
and KO mouse were analyzed for statistical differences by a Student’s
t-test and represented as the mean intensity/spermatozoa ± standard
error of the mean (SEM).
In vivo and in vitro fertilization analysis
For in vivo fertilization analysis, 3-week-old B6129SF1/J hybrid
female mice were superovulated by I.P. injection with 5 IU pregnant
mare serum gonadotropin (PMSG) (0.1 mL/mouse) in the evening
and a follow-up injection of 5 IU hCG after 48 h. After injection
of hCG, two superovulated females were mated in a trio to a single
Reep6 HET or KO mouse overnight. The next morning, females were
checked for copulation plugs. Females with copulation plugs were
euthanized using isofluorane followed by cervical dislocation, and
zygotes or unfertilized oocytes were subsequently collected from the
oviducts by dissecting and flushing them with HTF media. Collected
zygotes/oocytes were inspected for the presence of two pronuclei and
extrusion of the polar body. Zygotes/oocytes were cultured overnight
in a 37 ◦C incubator under 5% CO2 and observed for progression
to the two-cell stage.
The IVF experiments were performed as described previously
[26].
Induced acrosome reaction
Spermatozoa from the cauda epididymis of adult mice were released
by mincing the tissue 30 times in 1.0 mL equilibrated HTF media and
incubating for 15 min at 37 ◦C under 5% CO2. The sperm suspension
was then diluted to 1 × 106
cells/mL in 1.0 mL fresh HTF and
incubated for 120 min at 37 ◦C under 5% CO2. A 5-mM stock of the
calcium ionophore A23187 prepared in dimethyl sulfoxide (DMSO)
or a DMSO control was diluted 1:500 into the sperm suspension for
a final concentration of 10 μM A23187, as we previously reported
[27]. Sperm samples were incubated under CO2 for 1 h to allow the
acrosome reaction to complete. Finally, the treated sperm samples
were washed twice in PBS, mounted on slides, stained with PNA
to assess the acrosomal status and counterstained with DAPI. Slides
were imaged with a Zeiss AxioObserver epifluorescence microscope
at 40× magnification. At least 200 spermatozoa were counted per
mouse.
Sperm population counting
Spermatozoa from the cauda epididymis of adult mice were released
by making a single cut in the cauda with fine scissors and dragging
the sperm fluid into 1.0 mL equilibrated HTF media. The sperm
suspension was incubated for 15 min at 37 ◦C under 5% CO2 to
allow spermatozoa to disperse. Spermatozoa were diluted 1:50 into
fresh 1.0 mL equilibrated HTF media. A 20-μL sample was placed
on a microscope slide, cover slipped, and incubated in a humidified
chamber until spermatozoa were no longer motile. Spermatozoa
were imaged using phase contrast microscopy at 20× magnification.
For each analysis, at least 80 spermatozoa were counted per mouse
and at least 400 spermatozoa combined were counted per genotype
using ImageJ (NIH) with the cell counter plugin.
Scanning electron microscopy and transmission
electron microscopy
For scanning electron microscopy (SEM) of spermatozoa, a single
cut was made in cauda epididymis tissue and using fine tweezers,
fluid released from the epididymis was placed in a 2-mL microcentrifuge
tube with 1.0 mL equilibrated TYH media + 4 mg/mL
BSA (119.37 mM NaCl, 4.78 mM KCl, 1.19 mM MgSO4, 1.19 mM
KH2PO4, 1.71 mM CaCl2, 25.07 mM NaHCO3, 5.56 mM glucose,
1 mM sodium pyruvate, 75 μg/mL penicillin G, 50 μg/mL streptomycin
sulfate, and 2 μg/mL phenol red) [28]. Spermatozoa were
incubated for 15 min at 37 ◦C under 5% CO2 to allow spermatozoa
to disperse, then centrifuged at 300 × g for 5 min at RT and
resuspended in Dulbecco PBS (DPBS) to wash. Spermatozoa were
centrifuged again and resuspended in 2.5% glutaraldehyde in DPBS
for 30 min at RT to fix. Spermatozoa were washed in increasing
concentrations of ethanol from 20 to 100% to dehydrate, incubating
for 10 min in each. Spermatozoa were centrifuged at 1500 × g for
5 min at RT and resuspended in 50% t-butanol/50% ethanol for
15 min at RT. A 20-μL sample of sperm suspension was dried on a
specimen pin mount. The samples were sputter-coated with iridium
before imaging.
1238 D.J. Devlin et al., 2020, Vol. 102, No. 6
Figure 1. Analysis of Reep6 expression profile and fertility assessment of KO males. (A) RT-PCR of mouse testis mRNA from PND 3 to 35, amplifying the two
transcript variants of Reep6 and using Hprt as an expression control. Lane 1, labeled “Lad,” contains the DNA ladder. A NTC was included in the final lane.
(B) Western blot of 30 μg per lane testis and whole epididymis extracts from adult Reep6 WT, HET, and KO mice using GAPDH as an expression control. Both
REEP6 isoforms, REEP6.1 (22.2 kDa) and REEP6.2 (19.4 kDa), were absent in Reep6 KO testis and epididymis. (C) Mating analysis data from trio breedings of
Reep6 HET and KO mice, counting 6 L per male from three males in each breeding group. Mean litter size was calculated as the number of live pups born per
number of birthing events. Error bars represent SEM. Analyzed by one-way ANOVA with Tukey–Kramer post-hoc test. Not significant (ns), P < 0.05 (∗), P < 0.01
(∗∗), P < 0.001 (∗∗∗), and P < 0.0001 (∗∗∗∗).
For transmission electron microscopy (TEM) of testes, mice were
injected via I.P. with 0.01 mL/g ketamine–xylazine to anesthetize.
Mice were then fixed with 2.5% glutaraldehyde in DPBS by transcardial
perfusion with a peristaltic pump. Testes and cauda epididymis
were dissected and placed in fixative overnight at 4 ◦C. Tissues
were washed with PBS and incubated with 1% osmium tetroxide
in cacodylate buffer for 2 h at RT. After dehydration with 30, 50,
70, 90% ethanol, 90% acetone, and 100% acetone, tissues were
incubated in 50% resin/50% acetone for 2 h, followed by 66%
resin/33% acetone overnight, and finally in 100% resin for 3 h.
Samples were then embedded in 100% resin and embedded molds
were incubated at 60 ◦C for 48 h. Ultrathin 100-nm tissue sections
were cut with a diamond knife and mounted on a copper grid.
Sections were stained with uranyl acetate and lead citrate.
Statistical analysis
For all interval data, statistical significance between two groups was
determined using a two-tailed Student’s t-test assuming unequal variances
with an α level of 0.05. Significance between more than two
groups of interval data was determined by one-way ANOVA with a
post-hoc Tukey–Kramer HSD test. For nominal data, statistical significance
was determined either by a Chi-square test of independence
followed a Fisher’s exact test or by calculating the adjusted standard
residuals for post-hoc testing. P values less than 0.05 were considered
significant. All statistical analyses were performed using Microsoft
Office Excel with the Analysis ToolPak and RealStats plug-ins (www.
real-statistics.com/free-download/).
Results
Reep6 KO male mice are sterile
Since Reep6 has two major isoforms that differ in the inclusion
(Reep6.1) or exclusion (Reep6.2) of exon 5, we wanted to investigate
the temporal expression of Reep6 transcript variants during testis
development [12]. Reverse transcriptase (RT)-PCR analysis of WT
mouse testis tissue from PND 3 to 35 revealed that both isoforms
are expressed throughout testis development; however, expression
of Reep6.1 (the full-length transcript) spikes at PND 28 (Figure 1A).
This corresponds with the appearance of the first round spermatids
at PND 18 [18]. In our previous report [9], we demonstrated the loss
of REEP6 from the retina in our KO mouse via immunofluorescence.
To confirm loss of REEP6 from the male reproductive tract in our
KO model, we performed western blot analysis of testis and epididymis
tissue from adult KO and control males. The approximately
20-kDa REEP6 protein is reduced in the testis of HET males and is
absent in the testis and epididymis of KO males (Figure 1B). We also
noted that Reep6 KO female mice were fertile, based on progeny
produced from KO females bred to HET males. To examine the
fertility of KO males, 8-week-old Reep6 KO males were mated to
Reep6 HET females for several months. Reep6 KO males were found
to be completely infertile, siring no litters within the breeding period
(Figure 1C). Mating behavior for Reep6 KO males was normal;
males were observed to successfully produce copulation plugs similar
to HET controls. In contrast to KO males, the mean litter size of
Reep6 KO females was 6.0 ± 0.5 and was comparable with the
6.6 ± 0.4 mean litter size of heterozygous controls, confirming that
Reep6 KO females are fertile. These data indicate that Reep6 is
essential for male fertility in mice.
Reep6 KO spermatozoa are unable to penetrate the
zona pellucida
To further assess the cause of Reep6 KO male infertility, Reep6 HET
and Reep6 KO males were mated to superovulated WT B6129SF1/J
females, and after mating, the oviducts were collected and flushed.
The collected zygotes or unfertilized oocytes were cultured overnight
to allow progression to the two-cell stage to determine if fertilization
had occurred. Reep6 HET males successfully fertilized 90.7 ± 2.7%
of oocytes that progressed to the two-cell stage, while Reep6 KO
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1239
Figure 2. In vivo and IVF analysis of Reep6 KO spermatozoa. (A) Light microscopy images of oocytes/zygotes 48 h post-coitus from natural mating of Reep6 HET
or KO males to superovulated WT females. Arrows show fertilized oocytes that have progressed to two-cell stage embryos. (B) Quantification of two-cell embryos
from in vivo fertilization by trio mating Reep6 HET and KO males to two WT females each. Three males of each genotype were used in each mating group.
(C) Quantification of two-cell embryos from IVF using spermatozoa from Reep6 HET and KO males and oocytes from superovulated WT females. Oocytes
with intact zona pellucida or zona-free oocytes were prepared for the IVF experiment. Percent two-cell embryos were calculated as the number of fertilized
oocytes divided by the number of total oocytes collected. (D) Quantified comparison of sperm acrosome exocytosis between WT and Reep6 KO spermatozoa
by induction with 10 μM A23187 or DMSO as a negative control. Data represent three independent experiments using n = 3 males for each genotype. At least
1200 total spermatozoa were counted for each treatment group. (E) Representative images of spermatozoa from each of the acrosome reaction assay treatment
groups. PNA–FITC (green) was used to stain the acrosome, while DAPI (blue) was used to stain sperm nuclei. Images were taken at 40× magnification. Error
bars represent standard error (SE) for independent sample proportions. Analyzed by Chi-square test of independence with adjusted standard residual or Fisher’s
exact test post-hoc testing. Not significant (ns), P < 0.05 (∗), P < 0.01 (∗∗), P < 0.001 (∗∗∗), and P < 0.0001 (∗∗∗∗).
males fertilized only 5.1 ± 1.7% of oocytes that progressed to
the two-cell stage (Figure 2A and B). Under the microscope, it was
evident that Reep6 spermatozoa were able to bind the zona pellucida,
but perhaps were unable to penetrate. To test whether penetration
of the zona pellucida was the source of fertilization failure in Reep6
KO males, spermatozoa from Reep6 HET and Reep6 KO males were
used in zona-free versus zona-intact IVF experiments. Both Reep6
HET and Reep6 KO spermatozoa were able to fertilize 100% of
zona-free oocytes; however, Reep6 KO spermatozoa were unable
to fertilize zona-intact oocytes 0.9 ± 0.9% (Figure 2C). To confirm
that Reep6 KO spermatozoa were able to bind the zona pellucida,
the acrosome reaction was induced using the calcium ionophore
A23187, as most spermatozoa undergo the acrosome reaction
before binding the zona pellucida [29]. After treating WT and KO
1240 D.J. Devlin et al., 2020, Vol. 102, No. 6
spermatozoa with either 10 μM A23187 or DMSO control,
KO spermatozoa were able to execute acrosomal exocytosis
(70.9 ± 1.2%), although slightly decreased compared with WT
spermatozoa (79.3 ± 1.1%) (Figure 2D and E). These data highlight
that REEP6 is needed for spermatozoa to penetrate the zona
pellucida, although it is not essential for the ability of sperm to
bind this structure.
Loss of Reep6 causes epididymal sperm abnormalities
To better understand why Reep6 KO spermatozoa are unable to
penetrate the zona pellucida, we first examined the testes, in which
there were no differences between the sizes of Reep6 HET and
Reep6 KO mice (Figure 3A and B). There was also no significant
difference in the average body weight between the two groups
of mice (supplementary Figure S1A and B). Upon examining the
testis histology with PAS–hematoxylin staining, there were no clear
aberrations in spermatogenesis (Figure 3C). Although all generations
of spermatids seemed to be present, there were appearances of
atypical residual bodies remaining toward or within the lumen
in some stage IX tubules of Reep6 KO mice (supplementary Figure
S2). Histological sections of the cauda epididymis revealed
that the lumen of Reep6 HET mice appeared normal and was
filled with spermatozoa (Figure 3D, left), while the lumen of Reep6
KO mice contained large, round cell masses, which are likely the
atypical residual bodies from the testis (Figure 3D, right). In addition,
cauda epididymal sperm counts were 28% reduced in Reep6
KO (30.2 ± 4.3 × 106
cells) compared with Reep6 HET controls
(42.1 ± 3.7 × 106
cells), suggesting lower sperm production
or degradation of defective spermatozoa (Figure 3E) [30]. Reep6
KO spermatozoa also exhibited various morphological abnormalities
when compared with WT spermatozoa, including significantly
reduced normal sperm morphology (7.9 ± 1.2% vs. 31.5 ± 2.2%)
mostly because of a significant increase in tails bent at the annulus
(41.6 ± 2.1% vs. 20.3 ± 1.9%) or absent tails (13.3 ± 1.5%
vs. 3.6 ± 0.9%) (Figure 3F and G). The annulus is a ring-like diffusion
barrier between the midpiece of the sperm tail and the
principal piece [4]. These data suggest that REEP6 has a role in
late spermiogenesis that, when perturbed, disrupts the annulus,
disturbs proper head-tail coupling, and leads to abnormal epididymis
histology.
Reep6 KO spermatozoa demonstrate severe loss of
motility
To assess the motility of Reep6 HET and Reep6 KO spermatozoa,
CASA was conducted to assess general sperm motility and kinematics,
while CASAnova was subsequently performed to classify the
types of motility on sperm extracted from the cauda epididymis of
adult mice. All nominal variables (percent of spermatozoa counted
per category) were analyzed using the Chi-square test of independence
with a Fisher’s exact test for post-hoc analysis. All integer
variables (measured sperm kinematics) were analyzed with a Student’s
t-test assuming unequal variances. The percent of total motile
Reep6 KO spermatozoa was significantly reduced (7.64 ± 0.3%)
compared with Reep6 HET spermatozoa (43.3 ± 0.8% of total spermatozoa)
(Figure 4A). Representative videos from CASA analysis
illustrate the stark difference in motility between HET (supplementary
Figure S3 and supplementary Movie 1) and KO spermatozoa
(supplementary Figure S3 and supplementary Movie 2), as there are
significantly fewer motile sperm tracks (marked in green) in KO
sperm samples. Reep6 KO spermatozoa also exhibited significantly
reduced progressive motility (3.91 ± 0.2%) compared with controls
(29.2 ± 0.7%) (Figure 4B). After incubating spermatozoa for
120 min in HTF to allow capacitation [31–33], the spermatozoa
were reanalyzed for hyperactivation and other motility classifications
using the CASAnova SVM. Although slightly reduced, there
was no significant difference in the level of hyperactivation among
motile spermatozoa between Reep6 HET (5.15 ± 0.8%) and KO
(2.20 ± 0.5%) mice after 120 min (Figure 4C). This observation
demonstrates that although there are far fewer motile spermatozoa
in the Reep6 KO epididymis, the spermatozoa that are motile are
able to hyperactivate. Hyperactivation is an essential component
of sperm capacitation (the acquisition of fertilizing capability) [31,
32, 34]. CASAnova also classifies sperm motility into intermediate,
slow, and weak motility profiles (supplementary Figure S1C).
Reep6 KO spermatozoa exhibited significantly higher percentages
of slow (79.1 ± 1.4% vs. 30.7 ± 1.6%) and weak (3.3 ± 0.6%
vs. 0%) motility profiles compared with HET control spermatozoa
after 120 min (supplementary Table S1). The CASAnova data were
in agreement with the sperm kinematic data from CASA, as all
three measurements (average path velocity, VAP; curvilinear velocity,
VCL; and straight-line velocity, VSL) [35] were significantly reduced
in Reep6 KO spermatozoa (Figure 4D–F). Finally, to ensure that
the poor motility of the Reep6 KO spermatozoa was due to a
motility-specific defect and not caused by cell death, spermatozoa
from WT and KO mice were co-stained with SYBR-14 to label
living (membrane-intact) cells and propidium iodide to label dead
(membrane-disrupted) cells [22]. Although there was a significant
reduction in KO sperm viability (31.0 ± 1.0%) compared with WT
controls (35.7 ± 1.1%) determined by a Chi-square test of independence
and Fisher’s exact post-hoc test, this slight reduction does
not account for the severe reduction in motility (Figure 4G and H).
These data suggest that REEP6 has a critical role in sperm motility
and highlight that loss of Reep6 leads to a severe motility
defect.
REEP6 localizes to the connecting piece and midpiece
of spermatozoa
To determine the subcellular localization of REEP6, an anti-REEP6
antibody was used in immunofluorescence experiments within the
testis and spermatozoa of Reep6 HET and Reep6 KO specimens.
Within the seminiferous tubules, REEP6 localized to midpiece
of elongating spermatids (Figure 5A). The earliest appearance of
REEP6 staining is in the midpiece of step 15 spermatids in stage IV
seminiferous tubules [36]. The signal is strongest in stages VII–VIII
seminiferous tubules, as step 16 spermatids prepare for spermiation.
Within spermatozoa collected from the cauda epididymis, REEP6
demonstrates more pronounced localization at two focal points:
the connecting piece and the annulus as the base of the midpiece
(Figure 5B). REEP6 staining is also prominent along the entire
midpiece. As expected, no REEP6 signal is observed in Reep6 KO
testis and spermatozoa. To investigate the mitochondria integrity
of Reep6 KO sperm, spermatozoa were labeled with MitoTracker
Red. In addition, the status of acetylated α-tubulin was investigated,
as its expression has been reported to be reduced in cases of poor
sperm motility [37]. Structural integrity of the midpiece and the
mitochondria were not noticeably compromised by the loss of
REEP6 (Figure 5C). There were also no significant differences in
the fluorescence intensity of MitoTracker or acetylated α-tubulin
staining between HET and KO spermatozoa (Figure 5D). These
data suggest that the motility deficit and sperm tail defects in Reep6
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1241
Figure 3. Gross and histological characterization of Reep6 KO consequences in the testis, epididymis, and spermatozoa. (A) Representative whole testis images
and (B) gross testis weights from Reep6 HET and KO mice. (C) PAS–hematoxylin staining of testis cross-sections from HET and KO mice showing individual
seminiferous tubules in stage XI. Images were taken at 40× magnification. (D) PAS–hematoxylin staining of the cauda epididymis from HET and KO mice. Arrows
indicate abnormal round cells in the epididymal lumen. Images were taken at 20× magnification. (E) Quantification of cauda epididymal spermatozoa extracted
from HET and KO mice. Total sperm count was calculated as the number of spermatozoa counted from a 1:50 dilution in 1 mL of HTF media, represented as an
average for each group. Error bars represent SEM. Analyzed by a Student’s t-test. (F) Quantification of sperm morphology populations in WT and KO mouse
cauda epididymis. Error bars represent SE of independent sample proportions. Analyzed by a Chi-square test of independence with adjusted standard residual
post-hoc testing. (G) Representative phase contrast microscopy images of the various sperm populations in WT and KO mice taken at 20× magnification. Not
significant (ns), P < 0.05 (∗), P < 0.01 (∗∗), P < 0.001 (∗∗∗), and P < 0.0001 (∗∗∗∗).
1242 D.J. Devlin et al., 2020, Vol. 102, No. 6
Figure 4. Motility analysis by CASA for Reep6 HET and KO spermatozoa. (A–C) Classification of sperm motility by CASA and CASAnova. Error bars represent
SE. Data analyzed by a Chi-square test of independence with a post-hoc Fisher’s exact test. (A) Assessment of total sperm motility was calculated by counting
sperm movement irrespective of the pattern. (B) Assessment of progressive motility derived from counting only spermatozoa moving in progressive forward
motion. (C) Comparison of hyperactivation between Reep6 HET (n = 3) and KO (n = 4) spermatozoa by CASAnova classification was assessed at 15 min and again
after incubating for 120 min in HTF media. The percent hyperactivated sperm increases after capacitation in normal motile spermatozoa. (D–F) Sperm kinematic
analysis by CASA for Reep6 HET and KO spermatozoa, measuring mean sperm directional velocities (D) VAP, (E) VCL, and (F) VSL. Error bars represent SEM.
Analyzed by a two-tailed Student’s t-test assuming unequal variance. Several fields of sperm were captured so that at least 400 spermatozoa were analyzed per
mouse. (G) Quantification of a sperm viability assay comparing WT and KO spermatozoa. Error bars represent SE. Analyzed by Chi-square test of independence
with a post-hoc Fisher’s exact test. Not significant (ns), P < 0.05 (∗), P < 0.01 (∗∗), P < 0.001 (∗∗∗), and P < 0.0001 (∗∗∗∗). (H) Representative images of the sperm
viability assay. Live spermatozoa stained with SYBR-14 (green) and dead spermatozoa stained with propidium iodide (red) are presented at 20× magnification.
KO spermatozoa are not directly due to mitochondrial or sperm
axoneme defects.
To assess the Reep6 KO sperm defects in greater detail, SEM
was used to image sperm extracted from the cauda epididymis.
Compared with WT mouse spermatozoa (Figure 6A–C), Reep6 KO
spermatozoa (Figure 6D–F) exhibited abnormal head morphology
including truncated sperm head, abnormally wide sperm head, and
sperm with a sharp bend in the tail at the annulus—a common
feature of a defective annulus [4]. These observations were in agreement
with the sperm populations quantified from phase contrast
microscopy (Figure 3F and G). To look at the ultrastructural differences
in WT and Reep6 KO spermatids throughout spermatogenesis,
TEM images from the testes were analyzed. Elongated
spermatids (steps 15–16) in the WT testis showed proper head and
nuclear shaping, while some elongated spermatids in Reep6 KO
testes, presented with abnormal head morphology (Figure 6G). This
observation, in agreement with the sperm populations identified in
Figures 3F and 6D, is indicative of manchette abnormalities in the
Reep6 KO, as abnormalities in the manchette and intramanchette
transport (IMT) can lead to sperm head shape defects [4, 38–
40]. Despite this defect, however, other spermatids in the KO testis
appeared normal and the axoneme microtubule 9 + 2 structure
was unaffected in both WT and Reep6 KO testes (supplementary
Figure S4).
Discussion
REEP6 is a member of a group of REEP proteins, belonging to the
Ypt-interacting protein family, that were discovered for their ability
to enhance the expression of G protein-coupled receptors (GPCRs)
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1243
Figure 5. REEP6 subcellular localization in testis and spermatozoa. (A) Immunofluorescent staining of adult WT mouse testis cryosections showing different
stages of the cycle of seminiferous epithelium. Anti-REEP6 (red) is indirectly stained t, SBA-FITC (green) is used to mark the acrosome of spermatids, and
DAPI (blue) marks the nucleus. (B) Immunofluorescent staining of cauda epididymal spermatozoa from Reep6 HET and KO mice. Anti-REEP6 (red) is used to
label REEP6, anti-α-tubulin (green) is used to mark the flagella, and DAPI (white) marks the nucleus. (C) Immunofluorescent staining to evaluate mitochondria
and axoneme structure in Reep6 HET and KO cauda epididymal spermatozoa. MitoTracker (red) is used to stain mitochondria in the midpiece, anti-acetylated
α-tubulin (acTubulin, green) is used to mark the axoneme, and DAPI (white) marks the nucleus. (D) Fluorescence quantification of MitoTracker and acTubulin
staining in Reep6 HET and KO cauda epididymal spermatozoa using ImageJ. Quantification was conducted from five raw images each from a representative
Reep6 HET and Reep6 KO mouse, which included at least 50 spermatozoa for each genotype. The raw fluorescence intensity of each image was divided by the
number of spermatozoa in the corresponding image, giving an intensity per sperm value. The fluorescence intensity per sperm values for the Reep6 HET and
KO was analyzed using a Student’s t-test. Not significant (ns). Arbitrary units (AU). Error bars represent SEM.
1244 D.J. Devlin et al., 2020, Vol. 102, No. 6
Figure 6. Ultrastructural characterization of Reep6 KO testis and spermatozoa. (A–C) SEM images of cauda epididymal spermatozoa from WT mice displaying
normal morphology. (D–F) SEM images of Reep6 KO (bottom) spermatozoa showing (D and E) abnormal sperm head morphology and (F) normal head
morphology, but abnormal bending of the tail at the annulus (inset, 9114× magnification). Images were taken at 15 000× magnification. (G) TEM of testis
sections from WT (left, 4000× magnification) and Reep6 KO (right, 3000× magnification) mice showing sections through steps 15–16 spermatids.
on the surface of cells in in-vitro culture systems [11]. In somatic
cells, REEP proteins localize primarily to the ER and have various
roles in modulating ER structure, regulating ER–Golgi transport,
and localization of cargo proteins. The importance of REEP6 was
highlighted in the development of rod photoreceptors, as its elevated
expression was first discovered in the mouse retina, a retina-specific
isoform was discovered in mice, and we previously reported that
human mutations in REEP6 cause RP, the most common inherited
retinal disease [10, 12, 17]. In our recent report, we evaluated a
CRISPR/Cas9-generated Reep6 KO mouse model and showed that
loss of REEP6 led to retinal degeneration caused by ER dysregulation,
abnormal mitochondria proliferation, mislocalization of retinal
guanylate cyclases, and induction of ER stress [9]. Throughout these
studies, fertility did not appear to be affected when initially analyzed
from Reep6 KO female matings; however, after noticing Reep6 KO
males sired no pups over the entire study length, despite evidence of
copulation plugs, we initiated an investigation of male fertility.
It was previously established that Reep6 has two major
transcripts, with the larger one, Reep6.1, exhibiting retina-specific
expression [12]. After examining the temporal expression of both
Reep6 isoforms during testis development, we found that the
Reep6.1 isoform is predominant. However, since the retina of
the eye is part of the central nervous system and considerable
expression similarities between the brain and testis have been
reported in humans and mice, this finding is not alarming [12,
41]. Instead, it is suggestive that REEP6 plays a similar role in
the testis as it does in the retina. Using our established Reep6 KO
line, we demonstrate herein that Reep6 KO males are sterile and
sire no offspring from natural mating. Upon further investigation,
we learned that Reep6 KO spermatozoa are only able to fertilize
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1245
zona-free oocytes, revealing that REEP6 is required for penetration
of the zona pellucida. Reep6 KO spermatozoa were able to bind
the zona pellucida, indicating that REEP6 is not necessary for
zona pellucida binding. CASA and CASAnova analysis of Reep6
KO spermatozoa was critical in revealing that loss of REEP6
leads to a drastic loss of motility. Demonstrating that Reep6 KO
spermatozoa can undergo acrosome reactions (Figure 2D and E)
provided evidence that the spermatozoa could bind the zona
pellucida; however, the severe motility defect provides an answer
for why Reep6 KO spermatozoa are unable to penetrate the zona
pellucida. This also suggests that it is more difficult for KO males to
impregnate females because the spermatozoa are not motile enough
to traverse the female reproductive tract. Although there are far
fewer motile spermatozoa present in the Reep6 KO epididymis,
the spermatozoa that are motile are capable of hyperactivation
(Figure 4C) and are likely the explanation for the few fertilized
eggs in the in vivo fertilization experiment (Figure 2B).
Spermatogenesis in Reep6 KO testes was evaluated using PAS–
hematoxylin staining [19, 42] and appeared normal, as all steps of
spermatid development could be identified (Figure 3C). However,
in many tubules in stage IX of the seminiferous epithelium, large
atypical residual bodies were left in the lumen after spermiation
(supplementary Figure S2). This defect is indicative of abnormal
spermatid cytoplasm removal due to defective disengagement from
the ectoplasmic specialization (ES) junction to the sertoli cell [43,
44]. This abnormal spermatid cytoplasm is likely the explanation for
the round masses in the Reep6 KO epididymal lumen (Figure 3D).
MAKORIN-2 is another protein recently described with a similar
defect [45]. Another unexpected finding was that the loss of
REEP6 also leads to abnormal truncated and abnormal apical hook
head shapes (Figure 3G). Although the acrosome remains an intact
structure in Reep6 KO sperm, several of the sperm heads are misshapen
(Figure 2E). A review by O’Donnell [43] highlighted that
abnormalities in the manchette during spermiogenesis can cause
sperm head shape defects; however, we have not found evidence of
manchette defects here. The two most significant abnormalities in
Reep6 KO spermatozoa were tails bent at the annulus and detached
sperm heads. The annulus is a ring-like structure, made up of a
complex of septin proteins, which migrates toward the fibrous sheath
border during late spermiogenesis as mitochondria assemble into the
midpiece behind it [46, 47]. As reviewed by Lehti and Sironen [4],
loss of proteins involved in annulus formation often leads to bent
tails and defective motility, suggesting a potential role for REEP6
in this process. Similarly, it was recently reported that sad1 and
unc84 domain containing 5 (SUN5) is a protein that localizes to
the sperm head–tail coupling apparatus (HTCA) in the connecting
piece and mediated sperm head attachment [5]. Sun5 KO led to
detached sperm heads, like that seen in Reep6 KO spermatozoa.
Immunofluorescence staining in the testis and spermatozoa revealed
that REEP6 expression appears in stage IV seminiferous tubules
within step 15 spermatids and is present until the release of step 16
spermatids in stage VIII. In mature spermatozoa, REEP6 localizes to
the connecting piece, midpiece, and annulus. These final two steps of
spermatid development see the disappearance of the manchette by an
unknown mechanism, the formation of the annulus, and mitochondria
assembly in the midpiece [4, 40]. Given the late appearance of
REEP6 in spermiogenesis and its localization pattern, it may have a
role in these processes.Also,due to the appearance of detached sperm
heads in Reep6 KO epididymal sperm and REEP6’s localization to
the connecting piece, it may play a role in the HTCA, similar to
SUN5. A reported mouse KO model for kinase suppressor of Ras
2 (KSR2) found that loss of KSR2 leads to nuclear shape defects and
sperm with detached heads, similar to our findings with REEP6 [4,
48]. Future proteomic studies will be beneficial in identifying the true
molecular roles and interactions of REEP6 in these various processes
during spermiogenesis and sperm tail function.
TEM revealed a normal 9 + 2 axoneme microtubule organization
in absence of REEP6 (supplementary Figure S4). This observation
suggests that the cause of motility defects in Reep6 KO spermatozoa
is not due to structural defects of the tail and, instead, could be due to
the mislocalization of accessory proteins for tail function (motor proteins,
ion channels, etc.). We recently reported on the sperm flagella
protein, T-complex associated testis expressed 1 (Tcte1) [6], in which
gene KO in mice caused male sterility due to motility defects. In that
study, we found that TCTE1 was part of the nexin–dynein regulatory
complex (N-DRC), a critical motility component that provides
resistance to microtubule sliding and assists doublet alignment in the
flagellum [49]. Akin to the Reep6 KO, Tcte1 KO did not affect the
axoneme structure, but instead, is required for metabolism and ATP
generation. Due to the severe motility defects in Reep6 KO mice and
REEP6 midpiece localization, it would be interesting to investigate
whether REEP6 also has a role related to N-DRC function.
These studies have shown that REEP6 is essential for male
fertility, as it has a critical role in sperm motility, and likely roles in
annulus function and head–tail coupling. Future studies will investigate
whether the phenotype of the Reep6 KO is due to the loss of
REEP6 causing aberrant motor protein movement, mislocalization
of proteins essential for IMT, or intraflagellar transport [50–52],
or mislocalization of essential GPCRs [53] through proteomic and
immunofluorescent staining approaches.
We previously identified seven individuals from five families with
autosomal recessive mutations in REEP6 that were causative of their
RP [10]. As RP is the most common inherited retinal dystrophy
(affecting approximately 1 in 4000) [54], it will be valuable to
investigate whether the sperm motility defects and sterility caused by
loss of REEP6 reported herein has the same pathology in humans.
This information could inform patients of reproductive age living
with RP to help improve success in pregnancy through artificial
reproductive technologies and overall quality of life.
Supplementary material
Supplementary material is available at BIOLRE online.
Acknowledgment
The authors would like to thank Dr Anand Swaroop for providing the REEP6
antibody and the Baylor College of Medicine Pathology & Histology Core
for processing and embedding histology samples. We would also like to thank
Dr Jianhua Gu and Huie Wang at Houston Methodist Research Institute’s
Electron Microscopy Core for their expertise in acquiring scanning and TEM
images. We thank Dr Deborah A. O’Brien at the University of North Carolina
School of Medicine for valuable assistance using the CASAnova program to
classify sperm motility. We also thank Dr Thomas X. Garcia at Baylor College
of Medicine Center for Drug Discovery and the University of Houston-Clear
Lake for providing the mouse testis cDNA from PND 3 to 35.
Conflict of interest
The authors have declared that no conflict of interest exists.
1246 D.J. Devlin et al., 2020, Vol. 102, No. 6
References
1. Kumar N, Singh AK. Trends of male factor infertility, an important cause
of infertility: a review of literature. J Hum Reprod Sci 2015; 8:191–196.
2. Cao X, Cui Y, Zhang X, Lou J, Zhou J, Bei H, Wei R. Proteomic profile
of human spermatozoa in healthy and asthenozoospermic individuals.
Reprod Biol Endocrinol 2018; 16:4–11.
3. Tosti E, Ménézo Y. Gamete activation: basic knowledge and clinical
applications. Hum Reprod Update 2016; 22:420–439.
4. Lehti MS, Sironen A. Formation and function of sperm tail structures in
association with sperm motility defects. Biol Reprod 2017; 97:522–536.
5. Shang Y, Zhu F, Wang L, Ouyang YC, Dong MZ, Liu C, Zhao H, Cui X,
Ma D, Zhang Z, Yang X, Guo Y et al. Essential role for SUN5 in anchoring
sperm head to the tail. elife 2017; 6:1–19.
6. Castaneda JM, Hua R, Miyata H, Oji A, Guo Y, Cheng Y, Zhou T,
Guo X, Cui Y, Shen B, Wang Z, Hu Z et al. TCTE1 is a conserved
component of the dynein regulatory complex and is required for motility
and metabolism in mouse spermatozoa. Proc Natl Acad Sci USA 2017;
114:E5370–E5378.
7. Liu M, Ru Y, Gu Y, Tang J, Zhang T, Wu J, Yu F, Yuan Y, Xu
C, Wang J, Shi H. Disruption of Ssp411 causes impaired sperm head
formation and male sterility in mice. Biochim Biophys Acta, Gen Subj
2018; 1862:660–668.
8. Dong FN, Amiri-Yekta A, Martinez G, Saut A, Tek J, Stouvenel L, Lorès P,
Karaouzène T, Thierry-Mieg N, Satre V, Brouillet S, Daneshipour A et al.
Absence of CFAP69 causes male infertility due to multiple morphological
abnormalities of the flagella in human and mouse. Am J Hum Genet 2018;
102:636–648.
9. Agrawal SA, Burgoyne T, Eblimit A, Bellingham J, Parfitt DA, Lane
A, Nichols R, Asomugha C, Hayes MJ, Munro PM, Xu M, Wang K
et al. REEP6 deficiency leads to retinal degeneration through disruption
of ER homeostasis and protein trafficking. Hum Mol Genet 2017;
26:2667–2677.
10. Arno G, Agrawal SA, Eblimit A, Bellingham J, Xu M, Wang F, Chakarova
C, Parfitt DA, Lane A, Burgoyne T, Hull S, Carss KJ et al. Mutations in
REEP6 cause autosomal-recessive retinitis pigmentosa. Am J Hum Genet
2016; 99:1305–1315.
11. Björk S, Hurt CM, Ho VK, Angelotti T. REEPs are membrane shaping
adapter proteins that modulate specific G protein-coupled receptor trafficking
by affecting ER cargo capacity. PLoS One 2013; 8:1–28.
12. Hao H, Veleri S, Sun B, Kim DS, Keeley PW, Kim JW, Yang HJ, Yadav
SP, Manjunath SH, Sood R, Liu P, Reese BE et al. Regulation of a
novel isoform of receptor expression enhancing protein REEP6 in rod
photoreceptors by bZIP transcription factor NRL. Hum Mol Genet 2014;
23:4260–4271.
13. Keeley PW, Luna G, Fariss RN, Skyles KA, Madsen NR, Raven MA,
Poché RA, Swindell EC, Jamrich M, Oh EC, Swaroop A, Fisher SK et al.
Development and plasticity of outer retinal circuitry following genetic
removal of horizontal cells. J Neurosci 2013; 33:17847–17862.
14. Mainland J, Matsunami H. Ramp like proteins RTP and REEP family of
proteins. Adv Exp Med Biol 2012; 744:75–86.
15. Park CR, You DJ, Park S, Mander S, Jang DE, Yeom SC, Oh SH, Ahn C,
Lee SH, Seong JY, Hwang JI. The accessory proteins REEP5 and REEP6
refine CXCR1-mediated cellular responses and lung cancer progression.
Sci Rep 2016; 6:1–13.
16. Shibata Y, Hu J, Kozlov MM, Rapoport TA. Mechanisms shaping
the membranes of cellular organelles. Annu Rev Cell Dev Biol 2009;
25:329–354.
17. Sato H, Tomita H, Nakazawa T, Wakana S, Tamai M. Deleted in polyposis
1-like 1 gene (Dp1l1): a novel gene richly expressed in retinal ganglion
cells. Invest Ophthalmol Vis Sci 2005; 46:791–796.
18. Bellvé AR, Cavicchia JC, Millette CF, O’Brien DA, Bhatnagar YM, Dym
M. Spermatogenic cells of the prepuberal mouse. Isolation and morphological
characterization. J Cell Biol 1977; 74:68–85.
19. Ahmed EA, de Rooij DG. Staging of mouse seminiferous tubule crosssections.
Methods Mol Biol 2009; 558:263–277.
20. Quinn P, Kerin JF, Warnes GM. Improved pregnancy rate in human in
vitro fertilization with the use of a medium based on the composition of
human tubal fluid. Fertil Steril 1985; 44:493–498.
21. Goodson SG, Zhang Z, Tsuruta JK, Wang W, O’Brien DA. Classification
of mouse sperm motility patterns using an automated multiclass support
vector machines model. Biol Reprod 2011; 84:1207–1215.
22. Garner DL, Johnson LA. Viability assessment of mammalian sperm using
SYBR-14 and propidium iodide. Biol Reprod 1995; 53:276–284.
23. Pérez-Crespo M, Pintado B, Gutiérrez-Adán A. Scrotal heat stress effects
on sperm viability, sperm DNA integrity, and the offspring sex ratio in
mice. Mol Reprod Dev 2008; 75:40–47.
24. Sutovsky P. Visualization of sperm accessory structures in the mammalian
spermatids, spermatozoa, and zygotes by immunofluorescence, confocal,
and immunoelectron microscopy. Methods Mol Biol 2004; 253:59–77.
25. Schneider CA, Rasband WS, Eliceiri KW. NIH image to ImageJ: 25 years
of image analysis. Nat Methods 2012; 9:671–675.
26. Tokuhiro K, Ikawa M, Benham AM, Okabe M. Protein disulfide isomerase
homolog PDILT is required for quality control of sperm membrane
protein ADAM3 and male fertility [corrected]. Proc Natl Acad Sci USA
2012; 109:3850–3855.
27. Lin Y-N, Roy A, Yan W, Burns KH, Matzuk MM. Loss of zona pellucida
binding proteins in the acrosomal matrix disrupts acrosome biogenesis
and sperm morphogenesis. Mol Cell Biol 2007; 27:6794–6805.
28. Toyoda Y, Yokoyama M. The early history of the TYH medium for in
vitro fertilization of mouse ova. J Mamm Ova Res 2018; 35:71–71.
29. Jin M, Fujiwara E, Kakiuchi Y, Okabe M, Satouh Y, Baba SA, Chiba K,
Hirohashi N. Most fertilizing mouse spermatozoa begin their acrosome
reaction before contact with the zona pellucida during in vitro fertilization.
Proc Natl Acad Sci USA 2011; 108:4892–4896.
30. De Grava KW, Klinefelter GR. Interpreting histopathology in the epididymis.
Spermatogenesis 2014; 4:e979114.
31. Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P, Kopf GS.
Capacitation of mouse spermatozoa. I. Correlation between the capacitation
state and protein tyrosine phosphorylation. Development 1995;
121:1129–1137.
32. Salicioni AM, Platt MD, Wertheimer EV, Arcelay E, Allaire A, Sosnik
J, Visconti PE. Signalling pathways involved in sperm capacitation. Soc
Reprod Fertil Suppl 2007; 65:245–259.
33. Sebkova N, Cerna M, Ded L, Peknicova J, Dvorakova-Hortova K. The
slower the better: how sperm capacitation and acrosome reaction is
modified in the presence of estrogens. Reproduction 2012; 143:297–307.
34. Visconti PE. Understanding the molecular basis of sperm capacitation
through kinase design. Proc Natl Acad Sci USA 2009; 106:667–668.
35. Sloter E, Schmid TE, Marchetti F, Eskenazi B, Nath J, Wyrobek AJ.
Quantitative effects of male age on sperm motion. Hum Reprod 2006;
21:2868–2875.
36. Nakata H, Wakayama T, Takai Y, Iseki S. Quantitative analysis of the
cellular composition in seminiferous tubules in normal and genetically
modified infertile mice. J Histochem Cytochem 2015; 63:99–113.
37. Bhagwat S, Dalvi V, Chandrasekhar D, Matthew T, Acharya K, Gajbhiye
R, Kulkarni V, Sonawane S, Ghosalkar M, Parte P. Acetylated α-tubulin
is reduced in individuals with poor sperm motility. Fertil Steril 2014;
101:95–104.e3.
38. Russell LD, Ettlin RA, Sinha Hikim AP, Clegg ED. Histological and
Histopathological Evaluation of the Testis, 1st ed. Clearwater, FL: Cache
River Press; 1990.
39. O’Donnell L, O’Bryan MK. Microtubules and spermatogenesis. Semin
Cell Dev Biol 2014; 30:45–54.
40. Wei YL, Yang WX. The acroframosome-acroplaxome-manchette axis
may function in sperm head shaping and male fertility. Gene 2018;
660:28–40.
41. Guo JH, Huang Q, Studholme DJ, Wu CQ, Zhao SY. Transcriptomic
analyses support the similarity of gene expression between brain and
testis in human as well as mouse. Cytogenet Genome Res 2005; 111:
107–109.
REEP6 loss leads to male infertility in mice, 2020, Vol. 102, No. 6 1247
42. Meistrich ML, Hess RA. Assessment of Spermatogenesis Through Staging
of Seminiferous Tubules, vol. 927. Totowa, NJ: Humana Press; 2013.
43. O’Donnell L. Mechanisms of spermiogenesis and spermiation and how
they are disturbed. Spermatogenesis 2014; 4:e979623.
44. Creasy D, Bube A, de Rijk E, Kandori H, Kuwahara M, Masson R, Nolte
T, Reams R, Regan K, Rehm S, Rogerson P, Whitney K. Proliferative and
nonproliferative lesions of the rat and mouse male reproductive system.
Toxicol Pathol 2012; 40:40S–121S.
45. Qian X, Wang L, Zheng B, Shi Z-M, Ge X, Jiang C-F, Qian Y-C, Li D-M,
Li W, Liu X, Yin Y, Zheng J-T et al. Deficiency of Mkrn2 causes abnormal
spermiogenesis and spermiation, and impairs male fertility. Sci Rep 2016;
6:39318.
46. Kissel H, Georgescu MM, Larisch S, Manova K, Hunnicutt GR, Steller
H. The Sept4 septin locus is required for sperm terminal differentiation in
mice. Dev Cell 2005; 8:353–364.
47. Kuo YC, Shen YR, Chen HI, Lin YH, Wang YY, Chen YR, Wang CY, Kuo
PL. SEPT12 orchestrates the formation of mammalian sperm annulus by
organizing core octameric complexes with other SEPT proteins. J Cell Sci
2015; 128:923–934.
48. Moretti E, Collodel G, Mazzi L, Russo I, Giurisato E. Ultrastructural
study of spermatogenesis in KSR2 deficient mice. Transgenic Res 2015;
24:741–751.
49. Bower R, Tritschler D, Vanderwaal K, Perrone CA, Mueller J, Fox
L, Sale WS, Porter ME. The N-DRC forms a conserved biochemical
complex that maintains outer doublet alignment and limits
microtubule sliding in motile axonemes. Mol Biol Cell 2013; 24:
1134–1152.
50. Toshimori K, Ito C. Formation and organization of the mammalian sperm
head. Arch Histol Cytol 2003; 66:383–396.
51. Kierszenbaum AL, Rivkin E, Tres LL, Yoder BK, Haycraft CJ, Bornens
M, Rios RM. GMAP210 and IFT88 are present in the spermatid
golgi apparatus and participate in the development of the acrosomeacroplaxome
complex, head-tail coupling apparatus and tail. Dev Dyn
2011; 240:723–736.
52. San Agustin JT, Pazour GJ, Witman GB. Intraflagellar transport is essential
for mammalian spermiogenesis but is absent in mature sperm. Mol
Biol Cell 2015; 26:4358–4372.
53. Flegel C, Vogel F, Hofreuter A, Wojcik S, Schoeder C, Kie´c-Kononowicz K,
Brockmeyer NH, Müller CE, Becker C, Altmüller J, Hatt H, Gisselmann
G. Characterization of non-olfactory GPCRs in human sperm with a focus
on GPR18. Sci Rep 2016; 6:1–10.
54. Ferrari S, Di Iorio E, Barbaro V, Ponzin D, Sorrentino FS, Parmeggiani
F. Retinitis pigmentosa: genes and disease mechanisms. Curr Genomics
2011; 12:238–249.