“Baby talk” of genomic DNA. Fundamental role of repetitions. Edward N. Trifonov University of Haifa, Israel Prague, Brno 2013 Baby talk words, perfect repeats (Russian, if not specified) Mama Papa Baba (grandma) Pipi Caca Sisi (breast) Bobo (pain) Baibai (good night) Tiatia (father) Niania (nanny) Ham-ham (eat, Vietnamese) Ai-ai-ai (mishap) Ne-ne-ne (no, Czech) Wong-wong (drink, Vietnamese) Baby talk words, perfect repeats Lala (doll, baby) Kuku (from hiding) Diadia (man) Oi-oi-oi (mishap) Ni-ni-ni (strictly no) Niam-niam (eat) Dai-dai-dai (give me) Sound imitations, mostly babies Av-av (dog) Bi-bi (car) Cococo (chicken) Kva-kva (frog) Tik-tak (clock) Din’din’ (ringbell) Ga-ga-ga (geese) Kria-kria (duck) Tuk-tuk-tuk (knocking) Kap-kap-kap (rain) Chmok-chmok (kisses) Top-top-top (walk) Skirly-skirly (wooden leg) Rooster (adults): Ku ka re ku Ki ri ko ko (Czech, French) Cock-a-doodle-doo (English) Mooring steamer to a pier Sound imitations from “Adventures of Tom Sawyer” by Mark Twain: He was boat and captain and engine-bells combined, so he had to imagine himself standing on his own hurricane-deck giving the orders and executing them: "Stop her, sir! Ting-a-ling-ling!" The headway ran almost out, and he drew up slowly toward the sidewalk. "Ship up to back! Ting-a-ling-ling!" His arms straightened and stiffened down his sides. "Set her back on the stabboard! Ting-a-ling-ling! Chow! ch-chow-wow! Chow!" His right hand, mean-time, describing stately circles—for it was representing a forty-foot wheel. "Let her go back on the labboard! Ting-a-ling-ling! Chow-ch-chow-chow!" The left hand began to describe circles. "Stop the stabboard! Ting-a-ling-ling! Stop the labboard! Come ahead on the stabboard! Stop her! Let your outside turn over slow! Ting-a-ling-ling! Chow-ow-ow! Get out that head-line! lively now! Come—out with your spring-line—what're you about there! Take a turn round that stump with the bight of it! Stand by that stage, now—let her go! Done with the engines, sir! Ting-a-ling-ling! SH'T! S'H'T! SH'T!" (trying the gauge-cocks). Adult forms, perfect repeats: O-o (warning) Bebe Da-da (come in) Ja-ja (yes, German) Ku-ku (crazy) Ga-ga (crazy, English) Hahaha Nununu (warning to babies) Tuktuk (Cambodia, moto-rickshaw) Tamtam (drum) Tak-tak (all right) Ks-ks-ks (calling cat) Nuka-nuka (go ahead) Chachacha Leat-leat (slowly, Hebrew) Tipa-tipa (little bit, Hebrew) Tilki-tilki (barely fit, Ukrainian) Trochi-trochi (little bit, Ukrainian) Rock-rock-rock (Kenya, lullaby) Langsam-langsam (slowly, Yiddish) Adult forms, perfect repeats: E-e (warning) Ohoho (that much) Mimimi (sweaty, cuty) Bumbum (ignorant) Lalala (empty talk) Tsatsa (girl showing up) Vot-vot (in a moment) Idu-idu (coming) Kto-kto? (who) Gde-gde? (where) Vas‘-vas‘ (friends) Tiny-tiny Jele-jele (barely) Kuda-kuda? (where) Tolko-tolko (barely fit) Chut‘-chut‘ (little bit) Hei-hei-hei (warning) Chevo-chevo? (what) Tsip-tsip-tsip (calling chicken) Skolko-skolko? (how much) Kak eto, kak eto? (why all of a sudden) Mutated, imperfect repeats, babies and adults: Mamy (mother, English) Baby Bibika (car) Mamaya (fruit, Brazil) Papaya (similar fruit, Brazil) O-la-la (surprize, French) Coocook To-to-je (Aliska, co to je, Czech) Ta-ra-ram (mess) Balalaika Tarataika (type of a cart) Yin‘-yan‘ (Chinese) Siusiukat‘ (imitate baby-talk) Tsap-tsarap (catch, about cats) Villi-nilli (against will, Latin) Meli, Emelia (talking nonsense) Olgoi-horhoi (Mongolian, ferrytale creature) Volens-nolens (against will, Latin) Naziuziukalsa (drunk) Futy-nuty, lapti gnuty (mishap) Mutated, imperfect repeats, babies and adults: Nu-i-nu (surprized) Kukushka (coocook) Coca-cola Tra-ta-ta (thunder) Futy-nuty (mishap) Tiap-liap (lousy work) Trali-vali (menstruation) Dura duroi (stupid, her) Figli-migli (flirt) Shito-kryto (everything is fine) Tram-tararam (mess) Durak durakom (stupid, he) Boogie-woogie Trach-tararach (thunder) Postolku-poskolku (as soon as) Baiu-baiushki-baiu (lullaby) Tiutelka v tiutelku (just exactly fit) Counting rhymes for seek and hide game Ene bene rech Kenter menter zhech Ene bene raba Kenter menter zhaba Eniki beniki Eli vareniki Eniki beniki klotz Ine mine Minke tinke Fade rude Rolke tolke Wigel wagel weg (German) Martin Luther King, 1968: “Yes, if you want to say that I was a drum major, say that I was a drum major for justice. Say that I was a drum major for peace. I was a drum major for righteousness.” Criticized misquote: “I was a drum major for justice, for piece, for righteousness.“ Human languages, quite likely, originated from simple repetitive words, continued with their mutated forms, and even today the languages operate with simple repeats, mutated forms, and longer tandem or dispersed repeats (refrains). EXACTLY THE SAME CAN BE SAID ABOUT BIOLOGICAL SEQUENCES (nucleic acids and proteins) All 15-mers of human genome (sorted) 1 1198780 TTTTTTTTTTTTTTT Tn 2 1190667 AAAAAAAAAAAAAAA An 3 366285 TGTGTGTGTGTGTGT TGn 4 362623 ACACACACACACACA ACn 5 348215 GTGTGTGTGTGTGTG GTn 6 344421 CACACACACACACAC CAn 7 223424 GCTGGGATTACAGGC Alu 8 223011 GCCTGTAATCCCAGC Alu 9 9 222894 TATATATATATATAT TAn 10 222730 ATATATATATATATA ATn 11-67 Alu 68 169033 TTTTTTTTTTTTTTG Tn 69-72 Alu 73 167889 CAAAAAAAAAAAAAA An 74 167361 CTAAAAATACAAAAA Alu 75 150349 CTTTTTTTTTTTTTT Tn 76 149748 AAAAAAAAAAAAAAG An 77-82 Alu Three known pathologically expanding (“aggressive”) classes of triplets GCU (GCU, CUG, UGC, AGC, GCA, CAG) , GCC (GCC, CCG, CGC, GGC, GCG, CGG) and GAA (AAG, AGA, GAA, CTT, TTC, TCT). They cause neurodegenerative diseases and chromosome fragility EVOLUTION OF THE TRIPLET CODE E. N. Trifonov, December 2007, Chart 101 Consensus temporal order of amino acids: UCX CUX CGX AGY UGX AGR UUY UAX Gly Ala Asp Val Ser Pro Glu Leu Thr Arg Ser TRM Arg Ile Gln Leu TRM Asn Lys His Phe Cys Met Tyr Trp Sec Pyl 1 GGC-GCC . . . . . . . . . . . . . . . . . | . . . . . . . . 2 | | GAC-GUC . . . . . . . . . . . . . . . | . . . . . . . . 3 GGA--|---|---|--UCC . . . . . . . . . . . . . . | . . . . . . . . 4 GGG--|---|---|---|--CCC . . . . . . . . . . . . . | . . . . . . . . 5 | | (gag)-|---|---|--GAG-CUC . . . . . . . . . . . | . . . . . . . . 6 GGU--|---|---|---|---|---|---|--ACC . . . . . . . . . . | . . . . . . . . 7 . GCG--|---|---|---|---|---|---|--CGC . . . . . . . . . | . . . . . . . . 8 . GCU--|---|---|---|---|---|---|---|--AGC . . . . . . . . | . . . . . . . . 9 . GCA--|---|---|---|---|---|---|---|---|--ugc . . . . . . . | . . UGC . . . . . 10 . . | | | CCG--|---|---|--CGG | | . . . . . . . | . . | . . . . . 11 . . | | | CCU--|---|---|---|---|---|--AGG . . . . . . | . . | . . . . . 12 . . | | | CCA--|---|---|---|---|--ugg | . . . . . . | . . | . . UGG . . 13 . . | | UCG------|---|---|--CGA | | | . . . . . . | . . | . . . . . 14 . . | | UCU------|---|---|---|---|---|--AGA . . . . . . | . . | . . . . . 15 . . | | UCA------|---|---|---|---|--UGA . . . . . . . | . . | . . . UGA . 16 . . | | . . | | ACG-CGU | | . . . . . . . | . . | . . . . . 17 . . | | . . | | ACU-----AGU | . . . . . . . | . . | . . . . . 18 . . | | . . | | ACA---------ugu . . . . . . . | . . UGU . . . . . 19 . . GAU--|-----------|---|----------------------AUC . . . . . | . . . . . . . . 20 . . . GUG----------|---|-----------------------|--cac . . . . |CAC . . . . . . . 21 . . . | . . | CUG----------------------|--CAG . . . . | | . . . . . . . 22 . . . | . . | | . . . . . aug-cau . . . . |CAU . . AUG . . . . 23 . . . | . . GAA--|-----------------------|---|--uuc . . . | . UUC . . . . . . 24 . . . GUA--------------|-----------------------|---|---|--uac . . | . | . . UAC . . . 25 . . . | . . . CUA----------------------|---|---|--UAG . . | . | . . | . . UAG 26 . . . GUU--------------|-----------------------|---|---|---|--AAC . | . | . . | . . . 27 . . . . . . . CUU----------------------|---|---|---|---|--AAG| . | . . | . . . 28 . . . . . . . . . . . . . | CAA-UUG | | | | . | . . | . . . 29 . . . . . . . . . . . . . AUA------|--uau | | | . | . . UAU . . . 30 . . . . . . . . . . . . . AUU------|---|--AAU | | . | . . . . . . 31 . . . . . . . . . . . . . . . UUA-UAA | | . | . . . . . . 32 . . . . . . . . . . . . . . . uuu---------AAA| . UUU . . . . . . CONSECUTIVE ASSIGNMENT OF 64 TRIPLETS CODON CAPTURE aa "age": 17 17 16 16 15 14 13 13 12 11 10 9 8 7 6 5 4 3 2 1 "... if variations useful to any organic being ever do occur, assuredly individuals thus characterized will have the best chance of being preserved in the struggle for life; and from the strong principle of inheritance, these will tend to produce offspring similarly characterized“ Charles Darwin, Origin of Species (1859) Rephrasing (ET): Individuals with useful variations will self-reproduce self-reproduction and variation Any system capable of replication and mutation is alive (Oparin 1961). self-reproduction and variation Gly Ala| Val Asp Ser Pro ... | 1 GGC--GCC| 2 | | GUC--GAC 3 GGA---|----|----|---UCC 4 GGG---|----|----|----|---CCC . . (self-reproduction only) ↓ (self-reproduction and variations) ↓ not Life yet Life Life is self-reproduction with variations LIFE 123 COMPLEXITY 13 living 47 information 8 alive 10 complex 7 being 6 other related words 46 biological 5 Sum 74 other related words 8 Sum 199 REPRODUCTION 10 reproduce 8 SYSTEM 43 replication 7 systems 22 self-reproduction 5 organization 14 other related words 33 organism 14 Sum 63 order 6 organisms 6 EVOLUTION 10 network 5 evolve 7 organized 5 change 6 other related words 40 mutation 5 Sum 155 other related words 20 Sum 48 MATTER 25 organic 11 ENVIRONMENT 20 materials 10 external 6 molecules 6 other related words 15 other related words 36 Sum 41 Sum 88 ENERGY 18 CHEMICAL 17 force 5 process 15 other related words 17 metabolism 14 Sum 40 processes 8 reactions 5 ABILITY 12 other related words 26 able 11 Sum 85 capable 11 capacity 5 other related words 1 Sum 40 From vocabulary of 123 known definitions of life the following groups of meanings are revealed Life (definiendum) Definientia: System Matter Chemical Complexity Reproduction Evolution Environment Energy Ability These appear to be both necessary and sufficient for the definition of life We, thus, come again to the same definition: Life is self-reproduction with variations Human Genome Composition Protein-coding and RNA-coding 3% Non-coding DNA 97% of which Simple sequence repeats 3% (underestimate) Transposable elements 45% “repeat sequences account for at least 50% and, probably, much more” From E. S. Lander et al. Initial sequencing and analysis of the human genome, Nature 409, 860-921, 2001 Aggressive amino acids encoded by expanding triplets Amino acid Triplets L (leucine) CTG CTT A (alanine) GCT GCA GCC GCG G (glycine) GGC P (proline) CCG S (serine) AGC TCT E (glutamate) GAA R (arginine) CGG CGC AGA Q (glutamine) CAG K (lysine) AAG F (phenylalanine) UUC C (cysteine) UGC Majority of homopeptides are built from aggressive amino acids human eukar. prokar. tripeptides Score (Faux (Faux 1st exons (tripept.) et al.) et al.) 1. L3 4552 1446 70(5) 2. A3 4046 5465(3) 251(3) 3. G3 2972 5002(5) 310(2) 4. P3 2258 4157(7) 217(4) 5. S3 1981 5424(4) 378(1) 6. E3 1630 4334(6) 67(6) 7. R3 1145 462 60(8) 8. Q3 802 8022(1) 52(9) 9. K3 535 1920(9) 25 --------------------------------------- 10. V3 414 94 9 11. H3 273 1049 32 12. D3 269 1554 34 13. T3 267 2492(8) 63(7) 14. I3 109 34 3 15. F3 103 175 1 16. C3 92 38 0 17. N3 79 6962(2) 31 18. M3 34 19 0 19. Y3 32 39 4 20. W3 14 3 0 92% 75% 89% (Z. Koren, 2011) Could it be that protein sequences, actually, are ALL originally made from the aggressive repetitions? And we don't see all the original repeats just because they have extensively mutated. If this view is correct, then we should see in mRNA sequences 1. Ideal repeats of some codons • 2. The codons “sandwiched” between two identical codons should be their point mutation derivatives 3. Those codons which are more often in tandem repeats should be also of higher usage in non-repeats We, thus, undertook analysis of the largest non-reduntant database of mRNAs available, of total ~5 000 000 000 codons, from eukaryotes, prokaryotes, viruses, organelles together Z. Frenkel, E. Trifonov, JBSD, 30, 201-210 (2012) 22.5 min Sorted occurrence of the triplet repeats for different groups ("aggressive" triplets) group of codons Occurrence 1 GCC, CCG, CGC, GGC, GCG, CGC 1 784302 2 GCA, CAG, AGC, UGC, GCU, CUG 1 436660 3 GAA, AAG, AGA, UUC, UCU, CUU 1 131214 4 AAU, AUA, uaa, AUU, UUA, UAU 932105 (1 118526) 5 AUC, UCA, CAU, GAU, AUG, uga 735397 (882476) 6 ACC, CCA, CAC, GGU, GUG, UGG 726443 7 AGG, GGA, GAG, CCU, CUC, UCC 706484 8 AAC, ACA, CAA, GUU, UUG, UGU 694387 9 ACG, CGA, GAC, CGU, GUC, UCG 533888 10 ACU, CUA, UAC, AGU, GUA, uag 152747 (183296) 1. Tandem repeats of all 61 different codons are observed, strongest for aggressive groups, as expected GCU 243706 GGU 125946 GAU 115500 GAA 114278 the topmost in codon usage GUU 102550 GCA 95493 GCC 92153 AUU 89648 UUU 87861 AAA 84194 next topmost in codon usage UUA 80660 GGA 74934 GGC 71770 … 2. Middle codons abc in “sandwiches” GCUabcGCU (total 3 168 933) are most often first derivatives of GCU This also holds for most of other codons GCT_sandw A B Occurrence of the triplet XYZ (A) and its first derivatives (B) in the middle sequence abc1abc2…abcn „Thick“ sandwiches XYZabc1abc2…abcnXYZ XYZ XnZ XYn nYZ 2. The first derivatives between the identical codons in mRNA keep memory of initial tandem repetition of the codons The sequences like XYZ nnn nnn nnn nnn XYZ nnn nnn nnn nnn nnn nnn XYZ are likely descendants of XYZ XYZ XYZ XYZ XYZ XYZ XYZ XYZ… DistribProtMaxCodon.bmp Enrichment of mRNA sequences by one or another dominant codon Kirpichi1.bmp GAA and GCT “bricks” in mRNA of ribosomal protein L12 of Ps. Atlantica Frequent triplets make clusters, remnants of original ideal repeats Repeat_Codons.bmp 3. The more frequently the codon appears in tandem the more frequent it is also in non-repeating regions of mRNA TANDEMS NON-REPEATING REGIONS Ala GCC 110 465 Arg CGC 70 177 Arg AGA 55 62 GCA 94 195 CGU 46 45 AGG 29 22 GCU 93 245 CGG 41 86 1st columns - codons GCG 88 386 CGA 33 39 (millions) Asn AAU 121 523 Asp GAU 148 359 Cys UGC 31.9 18 2nd columns - repeats AAC 85 170 GAC 107 236 UGU 31.5 7 (thousands) Gln CAA 88 269 Glu GAA 163 584 Gly GGC 107 500 CAG 87 459 GAG 122 367 GGU 92 229 GGA 87 135 GGG 56 17 His CAU 58 62 Ile AUU 128 151 Leu UUA 91 127 CAC 49 61 AUC 100 107 UUG 73 30 AUA 70 63 Leu CUG 108 375 Lys AAA 158 403 Met AUG 109 117 CUU 75 43 AAG 104 277 CUC 70 59 CUA 40 8 Phe UUU 112 68 Pro CCA 62 89 Ser UCU 63 81 UUC 82 85 CCG 59 169 UCA 62 90 CCU 58 59 UCC 50 67 CCC 50 11 UCG 44 54 Ser AGC 59 147 Thr ACC 76 138 Trp UGG 60 22 AGU 53 36 ACA 71 126 ACU 65 45 ACG 51 59 Tyr UAU 86 68 Val GUG 91 187 UAC 61 41 GUU 88 92 GUC 74 103 GUA 61 23 In 17 of 21 codon repertoires the most frequent codon is also the most repetitive This result came as a surprize, considering zelions of factors known to influence the codon usage More frequent codons keep memory of tandem repetition of these codons in the past The triplet expansion of codons is the major single factor shaping the codon usage According to the Theory of Early Molecular Evolution based on the Evolutionary Chart of Codons the very first genes have been repeats …GGC GGC GGC GGC GGC GGC… and complementary …GCC GCC GCC GCC GCC GCC… encoding Glyn and Alan, respectively Thus, life started with the replication (and expansion) and subsequent mutations of tandemly repeating triplets GGC and GCC. (self-reproduction with variation) Life continued then to spontaneously emerge within the primitive early genomes and further on, in form of replication and expansion and subsequent mutations of other tandem repeats as well (self-reproduction with variation) Life never stopped emerging “… if (and oh what a big if) we could conceive in some warm little pond with all sort of ammonia and phosphoric salts, - light, heat, electricity etc., present, that a protein compound was chemically formed, ready to undergo still more complex changes, at the present day such matter would be instantly devoured, or absorbed, which would not have been the case before living creatures were formed.” (Darwin 1871) With the new view on genome origin and evolution the emerging life is not consumed by the earlier life, but rather protected by the environment within the cell. The tandem repeats have been considered as a class of “selfish DNA” (Orgel and Crick, 1980; Doolittle and Sapienza, 1980). They are, actually, more than just parasites tolerated by genome. They are even more than building material for the genome (Ohno, Junk DNA, 1972). The tandem repeats represent constantly emerging life, and genomes are products of their everlasting domestication. Genomes are built by the expansion and mutational domestication of the tandem repeats Genomes ARE the repeats (some already unrecognizable) Painful symbiosis of repeats with genomes For genomes accepted repeats are useful. new repeats are dangerous. For repeats genomes are natural habitats. initiation is at high risk PREDICTION: GENOMES SHOULD BE EQUIPPED BY DEFENSE SYSTEMS AGAINST CONSTANTLY EMERGING REPEATS The amino acid repeats in prokaryotes are far less frequent compared to eukaryotes. Defense in prokaryotes: Brutal negative selection, death of individuals contracting the repeats Defense in eukaryotes: Expulsion of the repeats into introns and intergenic sequences? (Alternative splicing as an intermediate stage) Possible defense devices: Prevention of slippage. Nucleosomes. Excision of slippage loops. Methylation of repeats. Sequence-specific nucleases ….. The simplest life forms – simple tandem repeats – represent a whole class of pathological agents, not considered as such up to now. Apparently, most of the attacks are normally stopped by the defense system. Some of the new expansions or insertions are accomodated by the genomes. Some are neither stopped, nor accomodated, causing disaster. A DIFFERENT VIEW ON CANCER, EXPANSION DISEASES AND DISEASES WITH UNKNOWN CAUSATIVE AGENT: The repeats in the diseases are not symptoms. They are cause of the diseases. Genomes evolve under constant attacks by various repeats. THANKS TO ZOHAR KOREN, ZAKHARIA FRENKEL, ALEXANDRA RAPOPORT, THOMAS BETTECKEN MISA ZEMKOVA } Haifa München Prague Low complexity (simple repeat) – just appeared intermediates High complexity – used to be simple repeat long time ago - genome today - genome at the origin of life ………….. } some 4 bln yrs Genomes are all built from simple repeats. Just many of them already unrecognizable } GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA CAA GAA GGA GAU GAA GAA UAC GAG GAA GAA AAA CAA GAA CAA GGA GGA AAU GAA GCA UAC GAG GAA GGA AAU CAG GUA CAG GGU GGA AAU GAA GCC UUC GGG GAA CGG ACU CAG AUA CCG GGU GGG AAU UAC GCC UUC UGG AAA CGG ACU CCG AUA CCG UGU GGG ACU UAC UCC UUC UGG AAC CGG ACU CCG AUC CCG UGU UGG ACU UCC UCC UUC UGG AGC CGG ACU 83 138448 TTTTTTTTTTTTTGA Tn 84 137643 TCAAAAAAAAAAAAA An 85 135070 TTTTTTTTTTTTGAG Tn 86 134465 TTTTTTTTTTTGAGA Tn 87 134262 CTCAAAAAAAAAAAA An 88 133917 TCTCAAAAAAAAAAA An ----------------------- Alu and variants of the above 185 85432 TTTATTTATTTATTT TTTAn 186 85142 AAATAAATAAATAAA AAATn ------------------------------------------ 293 70591 AGAGAGAGAGAGAGA AGn ------------------------------------------ 298 70411 TCTCTCTCTCTCTCT TCn ------------------------------------------ 945 33435 AATAATAATAATAAT AATn ------------------------------------------ 999 31742 CTTCCTTCCTTCCTT TTCCn ------------------------------------------ The list ends at line ~700 000 000 ~300 000 000 15-mers do not appear at all (of total 1 073 741 824) GCTGGGATTACAGGC GCT RYY GGG RRR ATT RYY ACA RYR GGC RRY (Gct)n (RYY)n In the vocabulary of human genome 15-mers the simple repeats (low complexity words) dominate. The high complexity words (of no repeat structure) are expected to be rather avoided. Complexity Occurrences of simple sequence 15-mers are anomalously high GCTGGGATTACAGGC (Alu sequence) (complexity 0.68) GCT GGG ATT ACA GGC repeating RYY5 GCT5 aggressive triplet TWO STRANDS OF THE SAME REPEATING DUPLEX ARE REPRESENTED IN mRNA SEQUENCE BY 6 DIFFERENT TRIPLETS GCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCU GCU GCU GCU GCU GCU GCU GCU GCU GCU GCU GCU GCU (GCU)n G CUG CUG CUG CUG CUG CUG CUG CUG CUG CUG CUG CU (CUG)n GC UGC UGC UGC UGC UGC UGC UGC UGC UGC UGC UGC U (UGC)n AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC AGC AGC AGC AGC AGC AGC AGC AGC AGC AGC AGC AGC (AGC)n A GCA GCA GCA GCA GCA GCA GCA GCA GCA GCA GCA GC (GCA)n AG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG C (CAG)n Complexity 15-mers of human genome are on low sequence complexity side. High complexity words are rather avoided Genomes are simpler than we have thought They are dominated by simple sequences because they originate from simple sequences, as non-stop local births of new life