Author contributions: N.M.: collection and/or assembly of data, data analysis and interpretation, manuscript writing; Y.J.: collection and/or assembly of
data; J.W.: data analysis and interpretation, manuscript writing; J.A.N.: conception and design, data analysis and interpretation; manuscript writing;
M.A.Z.: conception and design, data analysis and interpretation, financial support, manuscript writing; P.Z.: conception and design, data analysis and
interpretation, financial support, manuscript writing, final approval of manuscript.
Correspondence: Ping Zhou, Ph.D., Stem Cell Program, Department of Internal Medicine, University of California Davis, 2921 Stockton Blvd,
Sacramento, CA 95817, Phone: 916 703 9371; Fax: 916 703 9310; 3
Current address: Center for Regenerative Medicine, Massachusetts General Hospital,
Harvard Stem Cell Institute, Harvard Medical School, Boston, MA 02114, USA.; E-mail: ping.zhou@ucdmc.ucdavis.edu; Financial Support: UC Davis
Academic Federation Innovation Development Award (P. Z.) and a grant (TR2-01857) from California Institute of Regenerative Medicine (M. A. Z.).;
Received April 26, 2013; accepted for publication June 18, 2013; option. 1066-5099/2013/$30.00/0 doi: 10.1002/stem.1478
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and
proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/stem.1478
STEM CELLS®
EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS
Insulin and IGFs Enhance Hepatocyte Differentiation from Human
Embryonic Stem Cells via the PI3K/AKT Pathway
Nataly L Magner,1
Yunjoon Jung,1,3
Jian Wu2
, Jan A. Nolta1
, Mark A. Zern,2
Ping Zhou1
1
Stem Cell Program, and 2
Transplant Research Program, Department of Internal Medicine, University of California Davis
Medical Center, Sacramento, CA, USA,
Key words. IGF embryonic stem cells hepatocyte differentiation signal transduction
ABSTRACT
Human embryonic stem cells (hESCs) can be
progressively differentiated into definitive endoderm
(DE), hepatic progenitors and hepatocytes, and thus
provide an excellent model system for the mechanistic
study of hepatocyte differentiation, which is currently
poorly understood. Here, we found that insulin
enhanced hepatocyte differentiation from hESCderived
DE. Insulin activated the PI3K/AKT pathway,
but not the MAPK pathway in the DE cells, and
inhibition of the PI3K/AKT pathways by inhibitors
markedly inhibited hepatocyte differentiation. In
addition, IGF1 and IGF2 also activated the PI3K/AKT
pathway in DE cells and their expression was robustly
upregulated during hepatocyte differentiation from
DE. Furthermore, inhibition of IGF receptor 1
(IGF1R) by a small molecule inhibitor PPP or
knockdown of the IGF1R by shRNA attenuated
hepatocyte differentiation. Moreover, simultaneous
knockdown of the IGF1R and the insulin receptor (IR)
with shRNAs markedly reduced the activation of AKT
and substantially impaired hepatocyte differentiation.
The PI3K pathway specifically enhanced the
expression of HNF1 and HNF4 to regulate hepatocyte
differentiation from DE. Although inhibition of the
PI3K pathway was previously shown to be required for
the induction of definitive endoderm from hESCs, our
study revealed a positive role of the PI3K pathway in
hepatocyte differentiation after the DE stage, and has
advanced our understanding of hepatocyte cell fate
determination.
INTRODUCTION
Liver and other respiratory, gastrointestinal
organs are derived from definitive endoderm
(DE). Developmental studies in various models
have revealed that the fibroblast growth factors
(FGFs) secreted from cardiac mesoderm and
bone morphogenic proteins (BMPs) secreted
from septum transversum mesenchyme induce
hepatic and suppress pancreatic specification in
the foregut endoderm [1-4]. The newly specified
hepatic progenitor cells, which express fetoprotein
(AFP), undergo proliferation and
differentiation to become bipotent hepatoblasts
and subsequently give rise to hepatocytes
(albumin+
) and cholangiocytes (cytokeratin 7+
).
Fully mature hepatocytes, which express various
cytochrome P450 enzymes, tryptophan
oxygenase (TDO) and asialoglycoprotein
receptor 1(ASGPR1), appear only after the
Insulin and IGFs Enhance Hepatic Differentiation
2
postnatal stage. Other growth factors, such as
oncostatin M, hepatocyte growth factor (HGF)
and glucocorticoids have been shown to regulate
hepatocyte differentiation at the later stage [5-
10]. Although development studies have
revealed important clues concerning liver
organogenesis, major gaps in our knowledge
about the molecular mechanisms that regulate
hepatocyte differentiation remain. For example,
how these growth factors dictate cell fate is
poorly understood and whether additional
growth factors play roles in hepatocyte fate
determination remains to be determined.
Pluripotent human embryonic stem cells
(hESCs) have been actively investigated as a
potential alternative cell source for hepatocytes.
We and others have established protocols to
differentiate hESCs to hepatocytes with less than
desirable hepatic functions [4, 11]. The lack of
understanding of the molecular mechanisms
regulating hepatocyte differentiation hinders us
in achieving the full potential that hESCs
provide. Previous study has revealed that insulin
enhances hepatocyte differentiation from ESCderived
embryoid bodies [12]. Whether insulinlike
growth factors (IGFs) act similar to insulin
on hepatocyte differentiation is unknown. We
aimed to identify growth factor-mediated
signaling pathways which regulate hepatocyte
differentiation from definitive endoderm in this
study. We found that the PI3K pathway,
activated by insulin and/or insulin-like growth
factors (IGFs), plays an important role in
hepatocyte fate determination from DE.
Understanding the molecular mechanisms
regulating hepatocyte differentiation will
significantly facilitate the development of stem
cell-based therapy to treat liver disease.
MATERIALS AND METHODS
ES Cell Culture and Hepatocyte
Differentiation
The hESC line, H9, was purchased from WiCell
Research Institute (Madison, WI) and cultured
either on mouse embryonic fibroblasts (MEFs)
or on hESC-qualified matrigel (BD
Biosciences)-coated plates using MEF
conditioned ESC culture medium, as instructed
by the provider. Hepatocyte differentiation was
induced in 3 stages as previously described with
minor modification at the DE stage [13]. Briefly,
DE was induced from hESCs in RPMI medium
(Gibco) with 100 ng/ml activin A (R&D Systems
Inc.) and 0.5% bovine serum albumin (BSA)
(Sigma-Aldrich, MO) for 2 days and then BSA
was replaced with B27 (Gibco) for the next 6
days. Cells were lifted using trypsin and plated
into collagen (Invitrogen) coated culture plates
and grown for 8 days in IMDM media (Gibco)
with 20% FBS (Hyclone), 2 mM L-glutamine
(Gibco), 0.3 mM 1-thioglycerol (Sigma), 0.5%
DMSO (Sigma), 100 nM dexamethasone
(Sigma), 0.126 U/ml human insulin, 20 ng/ml
FGF4 (R&D systems), 20 ng/ml HGF (R&D
systems), 10 ng/ml BMP2 (R&D systems) and
10 ng/ml BMP4 (R&D systems). At the 3rd
stage, cells were grown in HBM basal medium
(Lonza, Walkersville) with HCM SingleQuots
kit (Lonza), 0.5% DMSO, 100 nM
dexamethasone, 20 ng/ml FGF4, 10 ng/ml HGF,
and 50 ng/ml oncostatin M (R&D systems). This
protocol was referred to as the P1 protocol. The
P2 protocol differs from the P1 protocol only at
stage 2 by the removal of FGF4, BMP2, BMP4
and HGF (R&D Systems Inc.) from stage 2
medium.
Human Primary Hepatocytes
Human primary hepatocytes were freshly isolate
and directly plated in culture plates by the Liver
Tissue Cell Distribution System of NIH
(University of Pittsburg). Growing cells were
delivered to us within 48 h and further cultured
for 1-2 days in HCM medium (Lonza) upon
receiving the cells.
Quantitative RT-PCR (qRT-PCR)
Total RNA isolation, cDNA generation and
quantitative real-time PCR were carried out as
previously described [14]. Primers and probes
for tested genes are listed in supplementary table
1.
Insulin and IGFs Enhance Hepatic Differentiation
3
Immunoblot Analysis and
Immunofluorescence staining
Cell lysates were collected using RIPA buffer
with proteinase and phosphatase inhibitor
cocktail and 5 mM EDTA (Thermo Fisher
Scientific). Total proteins of 30-50 g was used
for immunoblot analysis as previously described
[15]. Immunofluorescence staining was carried
out as previously described [16]. Antibody
against ALB was purchased from Bethyl
Laboratories Inc. Antibodies for IR, phosphorIR/IGF1R,
IGF1R, phosphor-AKT, phosphorERK,
phosphor-p38, phosphor-JNK, phosphorFOXO1
and phosphor-FOXO3a were purchased
from Cell Signaling Technology. Antibody
against -actin was purchased from SigmaAldrich.
HRP-conjugated secondary antibodies
against rabbit or mouse (Cell Signaling
Technology) were diluted 1:2500 before use.
ELISA Assay for ALB
ALB in culture media at day 24 of hepatocyte
differentiation from hESCs was analyzed using
an ALB ELISA assay kit (Bethyl Laboratories
Inc) according to the manufacturer’s
instructions.
Periodic Acid Schiff (PAS) Staining
Cells were first fixed in 4% paraformadehyde for
20 min and stained for glycogen using the PAS
stain kit (PolySciences) according to the
manufacturer’s instructions.
Small Molecule Inhibitors
LY294002 (Millipore), AKT inhibitor IV
(Millipore), and PPP (Santa Cruz
Biotechnology) were used at the concentration of
10, 0.2, and 0.2 M, respectively.
Viral Vectors and Transduction
Lentiviral vector, pLKO.1 (Addgene,
Cambridge, MA) was used as a scrambled
control vector. To construct shRNA viral vectors
targeting IR or IGF1R, DNA oligos targeting IR
(5’CCGGGAAGTGAGTTATCGGCGATATCT
CGAGATATCGCCGATAACTCAC
TTCTTTTTGCTAGCG-3’ and
5’AATTCGCTAGCAAAAAGAAGTGAGTTA
TCGG
CGATATCTCGAGATATCGCCGATAACTCA
CTTC-3’) or IGF1R (5’CCGGCGGC
AACCTGAGTTACTACATCTCGAGATGTAG
TAACTCAGGTTGCCGTTTTTGCT AGCG3’
and
5’AATTCGCTAGCAAAAACGGCAACCTGA
GTTACTACATCT
CGAGATGATGTAACTCAGGTTGCCG3’)
were annealed and then cloned into pLKO.1
between the AgeI and EcoRI sites. To generate
viruses, 2.5 x 107
HEK293T cells were
transfected with 25 g of shRNA vectors, 25 g
of pCMV-dR8.91 and 5 g of pMDG-VSV-G
(gift from Kohn DB, University of California
Los Angeles) by TransIT-293 transfection
reagent (Mirus). Media were changed to
UltraCULTURE (Lonza) the next day.
Supernatants were filtered through 0.22 m
MILLEX-GS filters (Millipore) 48 h later,
centrifuged with Centricon plus-70 (Millipore)
for 35 minutes at 3500 rpm and stored at -80°C.
Cells were transduced by viruses in the presence
of 8 g/ml polybrene at both day 6 and 8 during
hepatocyte differentiation from hESCs.
Statistics
Four to five samples for each condition were
analyzed and were presented as average ±
standard deviation. Probability (p) was
calculated using the unpaired student’s t-test.
RESULTS
Insulin Enhances Hepatocyte Differentiation
from DE
We used our previously published protocol, the
P1 protocol, as a reference to derive hepatocytes
from hESCs [13]. H9 cells was progressively
differentiated to DE using activin A with 0.5%
FBS or B27 at stage 1, and then to hepatocyte
progenitors using a combination of insulin, HGF,
FGF4, BMP2 and BMP4 at stage 2, and finally
to ESC-derived hepatocytes (EDH) using a
combination of insulin, EGF, FGF4, HGF, OSM,
hydrocortisone and dexamethasone at stage 3
(Fig. 1A).
Insulin and IGFs Enhance Hepatic Differentiation
4
Since hepatic lineage commitment occurred at
stage 2 in the presence of 5 growth factors, we
tested the effects of these growth factors on
hepatocyte differentiation by the addition of one
growth factor at a time in stage 2 at the same
concentration as it was used in the P1 protocol
without altering the other stages. The stage 2
basic medium, which contains 20% FBS without
additional growth factors, served as a control
(Basic). All cells were analyzed for hepatic gene
expression and function at day 24 of the
differentiation. We found that the addition of
insulin but not HGF, or FGF4, or BMP2, or
BMP4 alone to the basic medium at stage 2 was
sufficient to increase the expression of the
hepatocyte markers including ALB, antitrypsin
(AAT) and ASGPR1 to levels
comparable to those in cells grown in the P1
conditions and the human primary hepatocytes
(PH) (Fig. 1B). Moreover, insulin at 3 doses
tested substantially increased ALB secretion
compared to the basic medium, suggesting
increased hepatic function in insulin- treated
cells (Fig. 1C). The dose of 0.126 U/ml was used
in the P1 protocol and all other experiments. In
contrast, HGF, FGF4 and BMP2 alone failed to
enhance ALB secretion (Fig. 1C). We thus
omitted FGF4, BMP2, BMP4 and HGF but kept
insulin at stage 2 medium in the following
sections and refer to this modified protocol as
the P2 protocol. The majority of the EDH
obtained using the P2 protocol exhibited
characteristic hepatocyte morphology, ALB
positive staining (Fig. 1D) and glycogen storage
(Fig. 1E), which is another function of
hepatocytes.
Expression Profiles of Transcription Factors
and Hepatic Marker Genes during
Hepatocyte Differentiation from hESCs
To understand how hepatocyte differentiation
was induced from hESCs at the molecular level,
we examined the expression profiles of 10
transcription factors known to play roles in
hepatocyte differentiation and 6 hepatic markers
during the differentiation process using qRTPCR
analysis.
Human hematopoietically-expressed homeobox
protein (HHEX), GATA6, forkhead box protein
A2 (FOXA2) and T-box protein (TBX3) were all
robustly induced in stage 1, suggesting the
formation of a foregut endoderm competent for
hepatocyte induction (Fig. 2A, B). The
expression of HHEX and GATA6 rapidly
declined, whereas the expression of FOXA2 and
TBX3 persisted throughout the remaining
differentiation process with moderate reduction.
HNF4 expression was markedly increased in
stage 1 and 2 followed by a moderate reduction
in stage 3 but still maintained at a level
comparable to that in PHs (Fig. 2C). FOXA1 and
FOXA3 levels gradually increased until day 18
of the differentiation (Fig. 2C).
HNF1A and CCAAT-enhancer-binding protein
(CEBPA) were only moderately induced at the
DE stage, but robustly induced at stage 2 and
early stage 3, followed by a reduction (Fig. 2D).
The expression of prospero-related homeobox1
(PROX1) increased moderately during DE
induction, decreased during the first half of stage
2, then increased again thereafter (Fig. 2D).
The expression of 3 hepatocyte marker genes,
AFP, ALB and AAT, was not induced at the DE
stage but was progressively and substantially
induced at stage 2, and peaked at stage 3 at
levels comparable to those in PH (Fig. 2E). The
absence of AFP and the presence of FOXA2,
HHEX and GATA6 in stage 1 cells support that
these cells were true DE but not visceral
endoderm (Fig. 2E). However, the presence of
high levels of AFP in EDHs suggests that these
cells were not fully mature when compared to
PH, which expressed very low amounts of AFP
(Fig. 2E). The expression of ASGPR1 and
cytochrome CYP3A4 increased progressively
from late stage 2 to stage 3 during the
differentiation (Fig. 2F). The P2 protocol did not
significantly induce differentiation of
cholangiocyte, lung and pancreas lineages as
demonstrated by a minor increase of CK7,
NKX2.1 and PDX1 during the differentiation
(Fig. 2E, F).
Insulin and IGFs Enhance Hepatic Differentiation
5
The expression profiles of these tested genes
evident progressive differentiation toward
hepatocytes under the P2 condition, which
recapitulated many aspects of liver development
in vivo.
Insulin Enhances Hepatocyte Differentiation
via Activation of the PI3K/AKT Pathway
Insulin acts by binding to its receptor IR and
triggers the autophosphorylation of IR on
tyrosine residues. The phosphorylated IR recruits
insulin receptor substrate-1 (IRS-1), 2 (IRS-2),
Shc and growth factor receptor-bound protein 2
(Grb2) to the receptor to further activate the
signaling pathways of PI3K/AKT and mitogenactivated
protein kinase (MAPK) including
ERK, p38 and JNK [17]. To understand how
insulin stimulates hepatocyte differentiation
from DE, we investigated the signaling pathways
induced by insulin in DE. For comparison, the
signaling events activated by FGF and HGF
were also assessed.
DE cells were serum-deprived for 6-7 h and
subsequently stimulated for 15 min with insulin,
FGF4 or HGF individually or in combination.
Cells not exposed to these growth factors served
as a control. As expected, insulin induced the
phosphorylation of its receptor IR in these cells
(Fig. 3A). Insulin did not induce the
phosphorylation of the MAPKs including ERK,
p38 and JNK (Fig. 3A), but did induce the
phosphorylation of AKT and its downstream
targets, FoxO3a and FoxO1 in these DE cells
(Fig. 3A). FGF4 and HGF induced the
phosphorylation of ERK, p38 and JNK, but only
weakly induced the phosphorylation of AKT,
FOXO3a and FOXO1 (Fig. 3A, B). The
combination of insulin and FGF4 showed no
significant additive effect on activation of AKT,
ERK, p38 and JNK compared to the individual
growth factor alone (Fig. 3A). Therefore, our
data suggest that insulin primarily activates the
PI3K/AKT pathway but not MAPKs in DE,
whereas FGF4 and HGF are strong inducer for
the MAPK pathway and weak inducers for the
PI3K/AKT pathway in DE.
Since insulin activates the PI3K/AKT pathway,
we next investigated whether blocking the
PI3K/AKT pathway impairs hepatocyte
differentiation. A PI3K inhibitor, LY294002 at
10 uM, was added to the media from Day 8 to 24
during hepatocyte differentiation. The expression
of hepatic markers, ALB, ASGPR1, AAT,
TDO2 and CYP3A4, was markedly reduced in
LY294002-treated cells compared to the control
cells not exposed to LY294002 (Fig. 3B). We
found that LY294002 enhanced the expression
of cholangiocyte marker CK7 and lung lineage
markers, SOX2 and NKX2.1, but had no or
minimal effect on the expression of the
pancreatic marker PDX1 and intestinal marker
CDX2 (Fig. 3C). Therefore, the inhibition of
hepatocyte differentiation by LY294002 was
specific. Similar data were obtained using an
AKT inhibitor, AKT IV (data not shown). To
understand how LY294002 inhibited hepatocyte
differentiation, we assessed the level of hepatic
transcription factors, HNF4 and HNF1 in
stage 2 cells treated with or without LY294002
for 24 h. LY294002 markedly reduced the
protein levels of HNF4 and HNF1 (Fig. 3D).
We confirmed that LY294002 was able to inhibit
the activation of AKT in these cells (Fig. 3D).
The PI3K/AKT Pathway Promotes Cell
Survival
We next investigated whether the PI3K/AKT
pathway regulates proliferation or survival of the
DE or hepatic progenitor cells. Cells were
treated with or without 10 M LY294002 from
day 8 to 10 or from day 8 to 16 during the
differentiation. No significant difference was
observed on the expression of a proliferation
marker Ki67 in LY294002- treated and nontreated
cells. In contrast, the RNA contents,
which correlate with the number of cells, were
partially reduced in LY294002 treated cultures at
the concentration used (Fig. 4C, D). These data
suggest a role of the PI3K/AKT pathway in
preventing cell death rather than promoting
proliferation in hepatic progenitor cells.
Insulin and IGFs Enhance Hepatic Differentiation
6
Role of the IGF Signaling Pathway in
Hepatocyte Differentiation
IGF1 and IGF2 share considerable similarity
with insulin. Both IGFs bind to IGF1 receptor
(IGF1R) and trigger autophosphorylation of the
receptor. Similar to IR, phosphorylated IGF1R
can recruit IRS-1 and 2, Shc and Grb2 to the
receptor and subsequently activate the PI3K and
MAPK pathway [18, 19]. IGF2 also binds to the
IGF2 receptor (IGF2R), which negatively
regulates IGF2 signaling. We found that both
IGF1 and IGF2 activated AKT but not MAPKs
in the DE cells (Fig. 5A and data not shown).
The expression of both IGF1 and IGF2 increased
robustly very early during hepatocyte
differentiation, and reached its peak expression
at day 10 or day 20 of the differentiation,
respectively (Fig. 5B). Furthermore, although the
mRNA levels of IGF1R and IR were not
markedly altered during hepatocyte
differentiation (Fig. 5B), higher protein levels of
IR, IGF1R or the phosphorylated
IR/phosphorylated IGF1R (p-IR/p-IGF1R) were
present in the ESC-derived hepatocytes with
higher levels of ALB (Fig. 5C). Therefore, the
stronger activation of insulin and IGF signaling
pathway correlated with more differentiated
hepatocytes.
We next investigated whether inhibition of the
IGF1 receptor impairs hepatocyte differentiation.
An IGF1R inhibitor, PPP at 0.2 uM, was added
to the media at stage 2 only during hepatocyte
differentiation. Analysis of the expression of
hepatic markers at the end of stage 3 revealed
that the levels of ALB, ASGPR1, AAT, TDO2
and CYP3A4 were markedly decreased in PPPtreated
cells compared to the control cells not
exposed to PPP (Fig. 5C). Similar to the PI3K
inhibitor LY294002, PPP also moderately
increased the expression of the cholangiocyte
marker CK7 and lung marker NKX2.1 but not
the pancreatic marker PDX1 and intestine
marker CDX2 (Fig. 5D).
Knockdown of the IGF1 Receptor and/or
Insulin Receptor by shRNAs Inhibited
Hepatocyte Differentiation
To directly prove that insulin and IGF signaling
pathways play a critical role in hepatocyte
differentiation from DE, we knocked down the
expression of the subunit of the IR or IGF1R
individually or in combination in the DE cells
using lentiviral vectors carrying shRNAs against
these receptors. The shRNA against IR (shIR)
knocked down the mRNA level of the IR but not
the IGF1R, and the protein levels of both the IR
and IGF1R in these cells (Fig. 6A, B). The
shRNA against IGF1R (shIGF1R) only knocked
down the expression of IGF1R but not the IR at
both the mRNA and protein levels (Fig. 6A, B).
The shIR and/or shIGF1R had no significant
effect on the expression of IGF1 (Fig. 5A).
However, shIR significantly reduced the level of
IGF2 (Fig. 6A). Furthermore, the shIR markedly
reduced the protein levels of phosphor-AKT,
HNF4 and HNF1 (Fig. 6B) To a lesser extent,
shIGF1R also reduced the levels of these
proteins (Fig. 6B). Either shIR or shIGF1R was
sufficient to eliminate the expression of ALB at
both the protein and mRNA levels (Fig. 6B, C),
suggesting impaired hepatocyte differentiation in
the IR and/or IGF1R null cells. In addition, the
shIR markedly reduced the mRNA levels of
ASGPR1, AAT and TDO2 (Fig. 6C). The
IGF1R knockdown cells also showed
significantly reduced mRNA levels of ASGPR1
but not AAT and TDO2 (Fig. 6C).
Simultaneously using shIR and shIGF1R
resulted in reduced hepatic expression similar to
shIR (Fig. 6A, C, and D). This is because the
shIR vector knocked down both IR and IGF1R at
the protein levels (Fig. 6B). Therefore, our data
suggest that both insulin and IGF signaling
pathways play an important role in hepatocyte
differentiation from DE.
Similar to the inhibition the PI3K or IGF1R by
small molecule inhibitors, the knockdown of
IGF1R and/or IR enhanced the expression of
cholangiocyte marker CK7 and lung lineage
marker NKX2.1 (Fig. 6D), supporting specific
Insulin and IGFs Enhance Hepatic Differentiation
7
regulation of hepatocyte differentiation by
insulin and the IGF signaling pathway.
DISCUSSION
Hepatocyte fate determination has been
investigated primarily through developmental
studies, which revealed that multiple growth
factors, such as FGFs and BMPs, are involved in
this process [1-4]. However, genetic ablation of
any of these growth factors alone failed to
induce significant defects in liver organogenesis.
The complex and dynamic nature of hepatocyte
fate determination makes it difficult to study
signals that regulate this process in animals. We
took advantage of the in vitro system of
hepatocyte differentiation from hESCs to study
growth factor-mediated signaling pathways
which regulate hepatocyte differentiation from
DE. We found that the addition of insulin to DE
cells enhanced hepatocyte differentiation, even
in the absence of several other exogenous factors
thought to be critical in the process, such as
FGFs and BMPs. We found that the expression
of both IGF1 and IGF2 were induced robustly at
the DE stage and that their levels were either
maintained or further increased in later stages of
hepatocyte differentiation from hESCs.
Upregulation of IGF2 during hepatocyte
differentiation from hESCs has also been
reported by DeLaForest et al [20]. Ablation of
the IGF1R and/or IR by shRNAs markedly
impaired hepatocyte differentiation. Our data
demonstrated an important role of insulin and
IGF in hepatocyte differentiation from DE.
Although the foregut endoderm may not access
insulin during early development, it may access
IGFs produced by mesoderm or developing
heart, which start to express IGF2 as earlier as
E8 in mouse embryos [21, 22].
Suppression rather than activation of the PI3K
signaling pathway has been shown to be required
for DE induction from ESCs [23, 24]. Calmont
et al. showed that the PI3K pathway is active in
the foregut endoderm at the time hepatic genes
are activated during embryonic development (7-
8S stages). However, they found that inhibition
of the MAPK but not the PI3K pathway
impaired ALB expression in mouse embryo
explants, while inhibition of the PI3K pathway
inhibited the growth of the explants [25]. Since
the embryo explants were only cultured for 48 h
in their experiment, it remains to be determined
whether blockage of PI3K for longer time or at
different developmental stages would affect
hepatocyte differentiation in vivo. We found that
inhibition of the PI3K pathway in ESC-derived
DE reduced cell survival rather than
proliferation. Interestingly, inhibition of the
PI3K pathway by small molecule inhibitors
resulted in impaired hepatocyte differentiation.
Furthermore, inhibition of the insulin and IGF
signaling pathways by knocking down their
receptors markedly reduced the activation of the
PI3K pathway and diminished hepatocyte
differentiation. The impaired hepatocyte
differentiation was not likely due to the reduced
survival under these conditions, because the
same conditions increased the expression of the
cholangiocyte and lung lineage markers.
Therefore, we provide compelling evidence that
the PI3K signaling pathway regulates hepatocyte
differentiation after the DE stage.
The importance of HNF1 and HNF4 in
hepatocyte differentiation is highlighted by a
number of studies. Both HNF1 and HNF4
directly promote the transcription of many
hepatic specific genes [26]. Knockdown of
HNF4A in hESCs inhibits hepatocyte
differentiation [20]. Moreover, ectopic
expression of a combination of HNF4A with a
FOXA gene or a combination of HNF1A,
GATA4, FOXA and inactivation of p19(Arf)
in
mouse fibroblasts can directly induce hepatocyte
differentiation [27, 28]. We found that FOXA
and GATA6 were already substantially
upregulated at the DE stage and thus likely
played important roles in DE rather than
hepatocyte specification. The expression of
HNF4 was induced initially at stage 1, but
further increased at stage 2. HNF1 were
primarily induced at stage 2 in cells that were
exposed to exogenous insulin and endogenous
IGFs. The expression of HNF1 and HNF4
Insulin and IGFs Enhance Hepatic Differentiation
8
were specifically down-regulated by the
inhibition of the PI3K or knockdown of IR
and/or IGF1R, while insulin upregulated the
expression of these transcription factors.
Therefore, an increase of HNF1 and HNF4
induced by the PI3K pathway may be
responsible for the enhanced hepatocyte
differentiation through this pathway.
Although the addition of FGF4, BMP2, BMP4
and HGF to the stage 2 basic medium failed to
further enhance hepatocyte differentiation, our
data do not suggest that these growth factors
play no role in hepatocyte differentiation. The
stage 2 basic medium contains 20% FBS and
may provide sufficient amounts of these growth
factors. Low concentrations of FGF2 have been
reported to induce hepatocyte differentiation
from DE, but high concentrations of FGF2
promote pancreatic and intestinal cell fates [29].
Our previous study showed that HGF, EGF,
bFGF and aFGF counteract the effect of insulin
on hepatocyte differentiation from embryoid
bodies spontaneously differentiated from hESCs
[12]. We showed here that both FGF4 and HGF
primarily induced the activation of MAPK in DE
cells. Apparently, high levels of MAPK
activation may impede hepatocyte
differentiation.
CONCLUSION
We revealed a non-overlapping critical role of
insulin and IGFs in hepatocyte differentiation
from hESCs and demonstrated that the
mechanism by which insulin and IGFs act is
through activation of the PI3K pathway followed
by upregulation of HNF1 and HNF4 .
Identification of the role of the PI3K pathway in
hepatocyte differentiation has significantly
advanced on our understanding of hepatocyte
cell fate determination.
ACKNOWLEDGMENTS
We thank Karen Paper and Catherine Nacey for
packaging lentivirus for us. This work is
supported in part by an Academic Federation
Innovative Developmental Award from
University of California Davis (to P.Z.) and a
grant from the California Institute for
Regenerative Medicine (to M.Z.).
Disclosure of Potential Conflicts of Interest
The authors declare no potential conflicts of
interest.
REFERENCES
1. Zaret KS, Grompe M. Generation and regeneration of
cells of the liver and pancreas. Science.
2008;322:1490-1494.
2. Zorn AM, Wells JM. Vertebrate endoderm development
and organ formation. Annu Rev Cell Dev Biol.
2009;25:221-251.
3. Si-Tayeb K, Lemaigre FP, Duncan SA. Organogenesis
and development of the liver. Dev Cell. 2010;18:175-
189.
4. Behbahan IS, Duan Y, Lam A, et al. New approaches in
the differentiation of human embryonic stem cells and
induced pluripotent stem cells toward hepatocytes.
Stem Cell Rev. 2011;7:748-759.
5. Kamiya A, Kinoshita T, Miyajima A. Oncostatin M and
hepatocyte growth factor induce hepatic maturation via
distinct signaling pathways. FEBS Lett. 2001;492:90-
94.
6. Clotman F, Lemaigre FP. Control of hepatic
differentiation by activin/TGFbeta signaling. Cell
Cycle. 2006;5:168-171.
7. Lorent K, Yeo SY, Oda T, et al. Inhibition of Jaggedmediated
Notch signaling disrupts zebrafish biliary
development and generates multi-organ defects
compatible with an Alagille syndrome phenocopy.
Development. 2004;131:5753-5766.
8. McCright B, Lozier J, Gridley T. A mouse model of
Alagille syndrome: Notch2 as a genetic modifier of
Jag1 haploinsufficiency. Development.
2002;129:1075-1082.
9. Kamiya A, Kinoshita T, Ito Y, et al. Fetal liver
development requires a paracrine action of oncostatin
M through the gp130 signal transducer. EMBO J.
1999;18:2127-2136.
10. Schmidt C, Bladt F, Goedecke S, et al. Scatter
factor/hepatocyte growth factor is essential for liver
development. Nature. 1995;373:699-702.
11. Snykers S, De Kock J, Rogiers V, et al. In vitro
differentiation of embryonic and adult stem cells into
hepatocytes: state of the art. Stem Cells. 2009;27:577-
605.
12. Shirahashi H, Wu J, Yamamoto N, et al.
Differentiation of human and mouse embryonic stem
Insulin and IGFs Enhance Hepatic Differentiation
9
cells along a hepatocyte lineage. Cell Transplant.
2004;13:197-211.
13. Duan Y, Ma X, Zou W, et al. Differentiation and
characterization of metabolically functioning
hepatocytes from human embryonic stem cells. Stem
Cells. 2010;28:674-686.
14. Zhou P, Lessa N, Estrada DC, et al. Decellularized
liver matrix as a carrier for the transplantation of
human fetal and primary hepatocytes in mice. Liver
Transpl. 2011;17:418-427.
15. Zhou P, Gross S, Liu JH, et al. Flavokawain B, the
hepatotoxic constituent from kava root, induces GSHsensitive
oxidative stress through modulation of
IKK/NF-kappaB and MAPK signaling pathways.
FASEB J. 2010;24:4722-4732.
16. Zhou P, Hohm S, Olusanya Y, et al. Human progenitor
cells with high aldehyde dehydrogenase activity
efficiently engraft into damaged liver in a novel model.
Hepatology. 2009;49:1992-2000.
17. Taniguchi CM, Emanuelli B, Kahn CR. Critical nodes
in signalling pathways: insights into insulin action. Nat
Rev Mol Cell Biol. 2006;7:85-96.
18. Pollak M. The insulin and insulin-like growth factor
receptor family in neoplasia: an update. Nat Rev
Cancer. 2012;12:159-169.
19. Harris LK, Westwood M. Biology and significance of
signalling pathways activated by IGF-II. Growth
Factors. 2012;30:1-12.
20. DeLaForest A, Nagaoka M, Si-Tayeb K, et al. HNF4A
is essential for specification of hepatic progenitors
from human pluripotent stem cells. Development.
2011;138:4143-4153.
21. Lee JE, Pintar J, Efstratiadis A. Pattern of the insulinlike
growth factor II gene expression during early
mouse embryogenesis. Development. 1990;110:151-
159.
22. Li P, Cavallero S, Gu Y, et al. IGF signaling directs
ventricular cardiomyocyte proliferation during
embryonic heart development. Development.
2011;138:1795-1805.
23. McLean AB, D'Amour KA, Jones KL, et al. Activin a
efficiently specifies definitive endoderm from human
embryonic stem cells only when phosphatidylinositol
3-kinase signaling is suppressed. Stem Cells.
2007;25:29-38.
24. Touboul T, Hannan NR, Corbineau S, et al. Generation
of functional hepatocytes from human embryonic stem
cells under chemically defined conditions that
recapitulate liver development. Hepatology.
2010;51:1754-1765.
25. Calmont A, Wandzioch E, Tremblay KD, et al. An
FGF response pathway that mediates hepatic gene
induction in embryonic endoderm cells. Dev Cell.
2006;11:339-348.
26. Odom DT, Zizlsperger N, Gordon DB, et al. Control of
pancreas and liver gene expression by HNF
transcription factors. Science. 2004;303:1378-1381.
27. Sekiya S, Suzuki A. Direct conversion of mouse
fibroblasts to hepatocyte-like cells by defined factors.
Nature. 2011;475:390-393.
28. Huang P, He Z, Ji S, et al. Induction of functional
hepatocyte-like cells from mouse fibroblasts by defined
factors. Nature. 2011;475:386-389.
29. Ameri J, Stahlberg A, Pedersen J, et al. FGF2 specifies
hESC-derived definitive endoderm into foregut/midgut
cell lineages in a concentration-dependent manner.
Stem Cells. 2010;28:45-56.
Insulin and IGFs Enhance Hepatic Differentiation
10
Figure. 1. Insulin enhanced hepatocyte differentiation. (A): Schematic representation of the
differentiation protocol. (B): qRT-PCR analysis of hepatic gene expression in EDHs cultured with
indicated growth factors at stage 2. *p< 0.005 vs. Basic. (C): Secreted ALB levels in the culture media
were assessed by ELISA. *p< 0.005 vs. Basic. (D) Immunofluorescent staining of EDHs derived using
the P2 protocol for ALB. Magnification: 200. (E): PAS stain of EDHs derived using the P2 protocol.
Magnification: 200.
Insulin and IGFs Enhance Hepatic Differentiation
11
Figure. 2. Expression profiles of transcription factors and hepatic genes during hepatocyte
differentiation. hESCs were differentiated into EDHs using the P2 protocol. The expression of the
indicated genes was analyzed by qRT-PCR at the indicated time points. The missing points for
HNF1A and CYP3A4 indicated their levels not detectable.
Insulin and IGFs Enhance Hepatic Differentiation
12
Figure. 3. The PI3K/AKT signaling pathway was required for hepatocyte differentiation. (A):
Immunoblot analysis of the indicated proteins in DE cells treated with the indicated growth factors for
15 min. (B, C): Differentiated cells were treated with or without LY294002 (10 M) from day 8 to 24.
The expression of the indicated genes was analyzed by qRT-PCR. *p<0.002 vs. control in B; *p<0.02
vs. control in C. (D): Immunoblot analysis of the phosphorylated AKT, HNF4 and HNF1 in the DE
cells treated with or without LY294002 (10 M) for 24 h.
Insulin and IGFs Enhance Hepatic Differentiation
13
Figure. 4. Effects of the PI3K/AKT pathway on proliferation and survival. Differentiated cells were
treated with or without LY294002 (10 M) from day 8 to 10 or from day 8 to 16. The expression of
Ki67 was analyzed by qRT-PCR (A) and the RNA contents in these cultures were measured (B).
*p<0.005 vs. control.
Insulin and IGFs Enhance Hepatic Differentiation
14
Figure. 5. Role of the IGF signaling pathway on hepatocyte differentiation. (A): Immunoblot analysis
of phosphorylated AKT and total AKT in DE cells treated without or with IGF1 or IGF2 for 15 or 30
min. (B): The expression of IGF1, IGF2, IGF1R and IR during hepatocyte differentiation from hESCs
assessed by qRT-PCR. (C) Immunostaining of EDHs for ALB and IR, IGF1R or phosphorIR/phosphor-IGF1R.
The same cells are shown in an upper panel and the panel underneath.
Magnification: 200. (D, E): qRT-PCR analysis of the indicated genes in the cells at day 24 of
differentiation with or without exposing to PPP (0.2 M) from day 8 to 16. * p< 0.005, # p< 0.01 vs.
no PPP.
Insulin and IGFs Enhance Hepatic Differentiation
15
Figure. 6. Knockdown of IR or IGF1R impaired hepatocyte differentiation. (A, C, D): qRT-PCR
analysis of the indicated genes in the cells transduced with scramble or shIR, and/or shIGF1R vector. *
p< 0.005, # p<0.05 vs. scramble. (B): Immunoblot analysis of the indicated proteins in the cells
transduced with scramble or shIR, or shIGF1R vector.