MUNI SCI Bi4025en Molecular Biology Mgr. Jiří Kohoutek, Ph.D. 1 Department of Experimental Biology Lecture 8 • Molecular mechanisms of mutagenesis and recombination. 2 Department of Experimental Biology Source of genetic variability • Mutations • Recombination • Transposition 3 Department of Experimental Biology MUNI SCI Mutations TABIE 14.1 Major types of mutations and their distinguishing features Basis of classification Major types of mutations Major features Origin Spontaneous Induced Occurs in absence of known mutagen Occurs in presence of known mutagen Cell type Somatic Germ-line Occurs in nonreproductrvc cells Occurs in reproductive cells Expression Conditional Unconditional Expressed only under restrictive conditions (such as high temperature) Expressed under permissive conditions as well as restrictive conditions Effect on function Loss-of -function (knockout null) Hypomorphic (leaky) Hyperm orphic Gam of function (ectopic expression) Eliminates normal function Reduces normal function Increases normal function Expressed at incorrect time or in inappropriate cell types Molecular change Nucleotide substitution Transition Transversion Insertion Deletion One base pair in duplex DNA replaced with a different base pair Pyrimidine (T or C) to pyrimidine, or purine (A or C) to purine Pyrimidine (T or C) to punne, or purine (A or C) to pyrimidine One or more extra nucleotides present One or more missing nucleotides Effect on translation Synonymous (silent) Misscnsc (nonsynonymous) Nonsense (termination) Frame-shift No change in amino acid encoded Change in amino acid encoded Creates translations! termination codon (UAA, UAG. or UGA) Shifts triplet reading of codons out of correct phase 4 Define footer - presentation title / department https://www.uky.edu/~tphillip/2FChapter14.ppt MUNI SCI Mutations • Mutation is an inherited change in the genetic material of an organism. • Consequence of replication failure or accidental DNA damage. • Mostly without significant effect. • Sometimes fatal. • Sometimes bring an advantage (e.g. resistance of bacteria to antibiotics). • Increase diversity among individuals of a given species. 5 Department of Experimental Biology MUNI SCI Mutations • Mutations occur randomly. • More likely to cause harm than good. • Responsible for thousands of human diseases, including cancer. • The survival of the cell/organism depends on minimizing changes in DNA. 6 Department of Experimental Biology MUNI SCI Mutations • Change in the primary structure of the nucleic acid: o at the gene level (base pair substitutions, insertions, deletions), o at the level of structure or number of chromosomes. • Genotype can also be changed by new combinations of existing genetic variants - alleles, recombination. • The basis of evolution, adaptation to the environment. • Use in research (identification of genes, research of their function, regulation of expression, etc.) 7 Department of Experimental Biology MUNI SCI Polymorphism •A state where there are at least two genetic variants (alleles). Eventually, the occurrence of different forms among the members of a population or colony. •We talk about a mutation if the percentage of the allele in a population less than 1%. •Changes in gene expression that are phenotypically manifested, and which are not the result of changes in the DNA nucleotide sequence are referred to as epigenetic. 8 Department of Experimental Biology MUNI SCI Standard x Mutant phenotype Standard allele - standard phenotype. Mutant allele - mutant phenotype (mostly recessive). • Wild type tigers have orange fur and black stripes. One mutation prevents the deposition of the orange/brown pigment, and the result is a "white tiger" that still has dark stripes. A different mutation prevents any melanin (brown pigment) from forming at all, and the result is an albino tiger. MUNI SCI 9 Department of Experimental Biology http://www.bio.miami.edu/dana/dox/wildtype.html What does mutation affect? • The sequence of the genes (and thus structure of their products) or regulatory areas in DNA. • Chromosome structure (chromosome aberrations: duplication, deletion, inversion, translocation). • Genome structure: • Aneuploidv - change in the number of certain chromosomes. • Euploidv - change in the number of chromosomal sets. 10 Department of Experimental Biology MUNI SCI Classification of Mutations • Direction of mutations: • Forward mutation - mutation changes wild type (ancestral) to mutant (derived). • „Reverse" mutation - mutation changes mutant (derived) to wild type (ancestral). o Reversion to the wild type amino acid restores function. o Reversion to another amino acid partly or fully restores function. • Suppressor mutation - partially or completely cancels out the effect of another so-called suppressor-sensitive mutation. o Intragenic suppressors occur on the same codon; e.g., nearby addition restores a deletion, o Intergenic suppressors occur on a different gene. 11 Department of Experimental Biology MUNI SCI Intragenic suppressor mutations - type I Intragenic suppressor mutation suppresses suppressor-sensitive mutation at the same gene level (intragen). suppressor-sensitive mutation ATC CTC CCT TTC Insertion of T ATC TCT CCC TTT C frameshift mutation (reading frame shift) 12 Department of Experimental Biology suppressor mutation i ATC TCT CCC TTT C I Deletion of C ATC TCT CCT TTC restoration of the original reading frame MUNI SCI Intragenic suppressor mutations - type II Serine TCA • Original codon. | • Suppressor-sensitive (first) mutation. TAA • Stop codon, loss of product function. | • Suppressor-sensitive (second) mutation. Tyrosine TAT • Codon for another amino acid, restoration of function (sometimes only partial). 13 Department of Experimental Biology MUNI SCI Intergenic - Suppressor mutations • Many function in mRNA translation. • Each suppressor gene works on only one type of mutation - nonsense, missense, of frameshift mutation. Suppressor genes often encode tRNAs, which possess anti-codons that recognize stop codons and insert an amino acid. • Three classes of tRNA nonsense suppressors, one for each stop codon (UAG, UAA, UGA). o tRNA suppressor genes coexist with wild type tRNAs. o tRNA suppressors compete with release factors, which are important for proper amino acid chain termination. • Small number of read-through polypeptides are produced; tandem stop codons (UAGUAG) are required to result in correct translation termination. 14 Department of Experimental Biology MUNI SCI Intergenic - Suppressor mutations • The original mutated gene does not change, but the way of its mRNA translation is affected. • The actual mutation is suppressor-sensitive (sus-). • The codon turns into a nonsense codon or missense codon with altered sense. 5' i i i atg tXc . 3. i i i tag translation in the absence of suppressor tRNA i a t c mRNA 5 a u g OH aa f-Met' t a a att u a a 3' Met 15 Department of Experimental Biology MUNI SCI Intergenic - Suppressor mutations • Suppressor mutation: mutation in the tRNA gene, which produces tRNAwith altered antikodon. • Gene suppressor = mutant allele of genu for tRNA (sup-). translation in the presence of suppressor tRNA Department of Experimental Biology Classification of Mutations By type of affected cell: Somatic mutation Arise in the somatic cells. Passed on to other cells through the process of mitosis. Effect of these mutations depends on the type of the cell in which they occur & the developmental stage of the organism. In single-celled organisms, each mutation is duplicated during replication and passed on to the next cell generation. In multicellular mutations are passed on to the offspring only if they appear in the genome of germ line cells. • Germline mutation • They occur in the cells that produce gametes. • Can provoke hereditary diseases. • Passed on to future generations. • In multicellular organisms, the term mutation is generally used for germ line mutations. Department of Experimental Biology MUNI SCI Classification of Mutations • According to the level at which it acts: • Gene (point) - change of bases or sequence of bases at the gene level. • Chromosome - change of sequence at the chromosome level. • Genome - genomic mutations - change in the number of chromosomes. 18 Department of Experimental Biology MUNI SCI Classification of Mutations • According to the effect on the viability of the organism: • Vital mutations - compatible with survival. • Lethal mutations - incompatible with survival. • Conditionally lethal mutation - compatible with survival under certain conditions o ts ("temperature-sensitive") - lethal at elevated temperature. o sus ("suppressor-sensitive") - lethal without the presence of a suppressor. 19 Department of Experimental Biology MUNI SCI Temperature sensitive mutation A conditional mutation that produces the mutant phenotype in one (restrictive or non-permissive) temperature range and the wild-type phenotype in another (permissive) temperature range. osxn Restrictive temperature: protein not functional Temperature-sensitive mutant .subunit Wild-type subunits High temperature Misfolded interfaces block or destabilize assemblies ^ £ 20 seconds ^ Permissive temperature: protein functional 20 Department of Experimental Biology A conditional mutation that produces the mutant protein folds correctly only at a lower permissive, temperature. At non-permissive temperature, the mutant protein is inoperative. Useful for experimentation (lethal mutations are difficult to study). MUNI SCI Bioessays 36: 836-846, DOI 10.1002/bies.201400062 Methods in Cell Biology, Volume 137, 2017, Pages 283-306. Classification of Mutations According to the degree of phenotypic manifestation (in diploid organisms): Dominant mutations - they manifest themselves even in heterozygous state. Recessive mutations - they manifest themselves only in a homozygous state, in a heterozygous state, the manifestation is masked by the dominant allele. Dominant and Recessive mutations Recessive Dominant Genotype üü ÜÜ V Phenotype V / 21 Department of Experimental Biology MUNI SCI Dominant negative mutation DNA Mtiumi Transcription and translation \\'ilil-ti|K' piciu in Muknu prolciii ■ ■ Protein koi.i>in<; O .....I Defective subunit assembly • Dominant negative mutations are those where the mutant protein loses its own function but, in addition, the defective protein interferes with the function of another protein. • Thus a dominant negative mutation usually results from the presence of an altered, defective protein. • Relate to genes coding for components of multimeric proteins. • If the protein works as a dimer and in one both standard and mutant proteins appear in the cell non-functional heterodimers are formed. O O O 3/4 uon-fuiirtionaj 22 Department of Experimental Biology Possibility of experimental use for targeted inhibition of proteins (research of their function). https://www.brainkart.com/article/Dominant-Mutations-May-Be-Positive-or-Negative_13969/ MUNI SCI Diploid character of genome protects against adverse effect of mutations • Diploid cell contains two complete sets of chromosomes, one from each parent. • In diploid organisms, mammals, each gene has 2 copies. • If one of them is damaged, the other can substitute the other one by providing the correct information. • Therefore diploid state prevents defect caused by mutations, only, if the mutation is not dominant. 23 Department of Experimental Biology MUNI SCI Point mutations - molecular change • 1. Base pair substitutions • Transitions o Convert a purine-pyrimidine to the other purine-pyrimidine. o 4 types of transitions; A <-> G and T <-> C o Most transitions results in synonymous substitution because of the degeneracy of the genetic code. • Transversions o Convert a purine-pyrimidine to a pyrimidine-purine. o 8 types of transversions; A <-> T, A <-> C, G <-> T & G <-> C. o Transversions are more likely to result in nonsynonymous substitution. 2. Base pair substitution, deletions and insertions 24 Department of Experimental Biology MUNI SCI Point mutations molecular change Cytosine Guanine Although there are twice as many possible transversions, because of the molecular mechanisms by which they are generated, transition mutations are generated at higher frequency than transversions. As well, transitions are less likely to result in amino acid substitutions (due to "wobble"), and are therefore more likely to persist as "silent substitutions" in populations as single nucleotide polymorphisms (SNPs). 25 Department of Experimental Biology https://www.mun.ca/biology/scarr/Transitions_vs_Transversions.html MUNI SCI Point mutations molecular change Insertion Insertions are mutations in which extra base pairs are inserted into a new place in the DNA. Insertion C TG G A G CTGGTGGAG Deletions Deletions are mutations in which a section of DNA is lost, or deleted. Deletion CTGGAG C T A G 26 Department of Experimental Biology https://evolution.berkeley.edu/dna-and-mutations/types-of-mutations/ MUNI SCI Substitution point mutations Effect of translation Substitution mutations change base pairs of a nucleotide sequence with different base pairs. The substitution may or may not give effects depending on the type of mutation. Silent mutation, missense mutation and nonsense mutation are three types of substitution mutations. No mutation DMA level TTC mRNAIevel AAG pfotein level LyS Silent Point mutations I Nonsense ATC UAG STOP Missense conservative rwn-conservHlivB T C AGG Arg T TGC AGG Thr Cast I -.dar 27 Department of Experimental Biology https://www.differencebetweenxom/difference-between-substitution-insertion-and-deletion-mutations/ MUNI SCI Substitution and point mutations Missense mutation Base pair substitution results in substitution of a different amino acid. Nonsense mutation Base pair substitution results in a stop codon (and shorter polypeptide). Neutral mutation Base pair substitution results in substitution of an amino acid with similar chemical properties (protein function is not altered). Silent mutation Base pair substitution results in the same amino acid. Frameshift mutations Deletions or insertions (not divided by 3) result in translation of incorrect amino acids, stops codons (shorter polypeptides), or read-through of stop codons (longer polypeptides). MUNI Department of Experimental Biology r> r» t Substitution and point mutations • Missense mutation • Base pair substitution results in substitution of a different amino acid. 5' TCTCAA AATTTACG 3' 5' TCTCAA AATT TACG 3' AGAGTT TTAAATGC 5' 3' AGAGTT TTAAATGC Ser Gin Lys Phe Thr •■• ••• Ser Gin Phe Thr • • Nonsense mutation • Base pair substitution results in a stop codon (and shorter polypeptide). 5' TCTCAA AATTTACG 3' 5' TCTCAA AATTTACG 3' AGAGTlQTTAAATGC 5' 3' AG AGTTDT T A AATGC -•• Ser Gin Lys Phe Thr ■■■ -■■ Ser Gin Department of Experimental Biology Substitution and point mutations Neutral mutation Base pair substitution results in substitution of an amino acid with similar chemical properties (protein function is not altered). 5' TCTCAAA ATTTACG 3' 3' AGAGTTT TAAATGC 5' 5' TCTCAAA ATTTACG 3' 3' AGAGTTT TAAATGC 5' ••• S«r Gin Ly» Ph« Thr ••• ••• Ser Gin Phe Thr ••■ • Silent mutation Base pair substitution results in the same amino acid. TCTCAAAAHTTTACG 3' 5' TCTCAAAA TTTACG 3 AGAGT T TTilAA ATGC 5' 3- AGAGTT T TE AAATGC 5' • Ser Gin Ly» Phe Thr ••• ••• Ser Gin Lys Phe Thr ••• 30 Department of Experimental Biology MUNI SCI Substitution and point mutations • Frameshift mutations • Deletions or insertions (not divided by 3) result in translation of incorrect amino acids, stops codons (shorter polypeptides), or read-through of stop codons (longer polypeptides). 5' TCTCAAAAATTTACG 3' 3' AGAGTTTTTAAATGC 5' ••• Ser Gin Lyt Phe Thr ••• 5' 3' TCTCAA AGAG T T AAATTTACG 3' TTTAAATGC 5' Ser Gin Glu [lie ITyr 31 Department of Experimental Biology MUNI SCI Additional type of Mutations • null mutation - complete loss of function o often deletion of the gene or part of it. • tight mutation - clear phenotypic expression o e.g. complete loss of ability to grow under certain conditionsor preventing the formation of a product of a given biochemical pathway. • leaky mutation - partial activity of the gene product preserved o e.g. residual activity of the enzyme will allow cells to survive. • frameshift mutation - changes the reading frame, o usually deletions or insertions. • polar mutation - affects the expression of neighboring genes, o In operons. 32 Department of Experimental Biology MUNI SCI Mutation and structural abberations B E D C F A B C D D E F Breakage of a chromosome can produce variety of arrangements. inversion Duplication A B C D E F Deletion A B D E Insertion CD L E F Translocation ABCDEF ABCopq I m n o p q I m n D E F • Chromosomal structural changes usually occur during meiosis , formation of egg or sperm cells, in early fetal development, or in any cell after birth. • Pieces of DNA can be rearranged within one chromosome or transferred between two or more chromosomes. • Some changes cause health problems, while others may have no effect on a person's health. Department of Experimental Biology https://biologyboom.com/change-in-chromosome-structure/ https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations Inversion Paracentric Inversion An inversion occurs when a chromosome breaks in two places; the resulting piece of DNA is reversed and re-inserted into the chromosome. Genetic material may or may not be lost as a result of the chromosome breaks. An inversion that includes o the chromosome's constriction point (centromere) is called a pericentric inversion, o the long (q) arm or short (p) arm and does not involve the centromere is called a paracentric inversion. 34 Define footer - presentation title / department https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ .Reinserted J Piece of DNA with Centromere MUNI SCI Mutation and structural abberations Duplications Duplication Duplications occur when part of a chromosome is abnormally copied (duplicated). This type of chromosomal change results in extra copies of genetic material from the duplicated segment. Chromosome >Duplicated Genetic Material itional Library of Medicine 35 Department of Experimental Biology https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations • Deletions Deletions occur when a chromosome breaks and some genetic material is lost. Deletions can be large or small, and can occur anywhere along a chromosome. Deletion Breaks in Chromosome 36 Department of Experimental Biology https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations Translocations • A translocation occurs when a piece of one chromosome breaks off and attaches to another chromosome. This type of rearrangement is described as balanced if no genetic material is gained or lost in the cell. 37 Department of Experimental Biology Chromosome B Chromosome A U.S. National Library of Mediane https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations • Translocations • A translocation occurs when a piece of one chromosome breaks off and attaches to another chromosome. • If there is a gain or loss of genetic material, the translocation is described as unbalanced. 38 Department of Experimental Biology Unbalanced Translocation https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Are mutatins good or bad? It depends. Mostly harmful with a negative effect on the function of the gene product. The damaged gene product may not always be a protein, but also RNA (tRNA, rRNA, atd.). Mutations can also damage non-coding but important signal sequences. Most mutations do not have a significant effect on the survival of the organism - they are neutral. Rarely, the mutation has a positive effect on the survival and reproduction of the organism. The accumulation of these beneficial mutations will allow the organism to develop into a changing with the environment. MUNI Department of Experimental Biology https://open.lib.umn.edu/evolutionbiology/chapter/5-8-using-the-genetic-code-2/ O 0 J. Impact of mutation depeneds on many aspects • Mutations that alter the meaning of the codon ("missense mutations") are the most common. • Lead to the substitution of one amino acid for another in a protein molecule. • If the mutation replaces the original amino acid with a chemically related amino acid -usually without serious consequences (conservative substitution). • The consequences are serious if they change the way the protein is composed or the structure active site (non-conservative substitution). Conservative substitution Radical replacement Original protein 40 Department of Experimental Biology dna mutation g ca -» gga Amino acid change ala -» gly DNA mutation G CA -» GAA Amino acid change ALA -»GLU Mutated PROTEIN Original PROTEIN Mutated PROTEIN (glutanine has extra negative charge and folds incorrectly) MUNI SCI Classification of Mutations • According to the method of formation: Spontaneous - occur in the absence of known mutagen, without apparent external cause. • Consequence of metabolic disorders in the body. • Consequence of DNA replication errors. • Consequence of the presence of an unknown mutagenic substance in the environment. Induced - occur in the presence of known mutagen Physical. ^ • Chemical. I MUTAGENS • Biological factors. J MUNI 41 Department of Experimental Biology r> r» t • Spontaneous mutations MUNI 42 Department of Experimental Biology _ _ T O 0 J. Base pairing- tautomerization (.i) Stnntf.ird base pairing arrangements ImM—H-\ / N—C * V J O H Thymine (keto) Adenine (amino) 0---u—n \ Cylosirie (amino) (b) Anomalous base-pairing arrangements >-< H—C jííl-M — Hi H'—C J Guanine (ketoj —H—W Standard base-pairing arrangements of the canonical nucleotide isomers. Anomalous base-pairing arrangements of the tautomers. Natural cause of certain genome instability. Base transitions to different forms change their pairing specificity. When tautomerization occurs during replication, the DNA sequence will be "misread", and anomalous base-pairing will occur: such as C* with A, or T*. 43 Department of Experimental Biology https://www.researchgate.net/publication/334974633_Unified_Physics_and_the_Entang lement Nexus of Awareness MUNI SCI Mutation caused by mismatch wobbl base pairing a) b) c) cj) Guanine Mismatched GT GC-to-AT transition wobble pairs base pair after mutation produced with T replication after next DNA replication 5'_3' DNA ACGTC replication TGCAG 3'-5' Parentat DNA 44 Department of Experimental Biology AC T G —i—i—i—i—r~ ACGTC TGTAG DNA replication ACGTC TGCAG First-generation progeny ACGTC TGCAG Wild type AC ATC TGTAG ACGTC TGCAG Mutant Wild type ACGTC TGCAG Wild type i__ Seco nd -generati o n progeny MUNI SCI Insertion and deletion by DNA looping-out New strand 5 5 3' 5' 3J i i i i i i i II AGTCGCATAGTT TCAGCGTATCAAAAACGTCGATC Template strand 3f----' I I I I I I M I - ' ' I I M I '----5' I I I I I I I I I I I I AGTCGCATAGTT TCAGCGTATCAA AACGTCGATC I I I I I I.....IAS Ml - -^ty-- Looping out of template strand 5' One base deletion on new strand 3' i i I I I I I I I I i i i,i I I I I I I I I ' AGTCGCATAGTTTTGCAGCTAG TCAGCGTATCAA AACGTCGATC ...........B......... -r 3' 5' 3' Looping out of new strand 3 AGTCGCATAGTTTT TCAGCGTATCAA AAACGTCGATC 5' One base insertion on new strand ft..........-3' i i i i I AGTCGCATAGTT TTTGCAGCTAG TCAGCGTATCAAAAACGTCGATC 5' 45 Department of Experimental Biology MUNI SCI Hot spots in repetitions of DNA 120 M E 100 ~ E BO 5 E 60 0 QJ a 40 E D Z 20 0 B 2000 0) 1800 B 0 1600 1 1400 £ 1200 B 1000 i_ fib 800 iqui 600 Z 400 200 Germiine mutations MED A. \ L 1J ... J JjJ. (Í5ÍL I litU. J. CVJ M Amino acids Somatic mutations firTT?> .j!kULlli Amino acids TA • The distribution of mutations in the gene or genome is not uniform. • Certain DNA sequences have a higher risk of being affected by mutations „hot spots". I • Hot-spots - DNA sequences with increased probability of mutation events. • The replication apparatus has some problems with repetitive sequences. • Areas of tandem repeats are unstable, often occurence of insertions and deletions. pr DBD Tet Reg 46 Department of Experimental Biology Potential clinical relevance (p53). MUNI SCI Replication polymerase slippage Due to assembly of loops, part of the template can be copied during replication repeatedly or can be omitted replication slippageTpolymerase slippage". Trinucleotide expansion: neurological diseases (Huntigton's disease, expansion of trinucleotide CAG). 5' 3' 5' 3' 3' 5' 3'- Expansion 3' -■-►3' Replication 5' Strand dissociation 5' ^^^Contraction 5 I—i 5' 3'H 3' 5' 47 Department of Experimental Biology MUNI SCI Deamination • Depurination • Common; A or G are removed and replaced with a random base. • Deamination • Amino group is removed from a base (C —► U); if not replaced U pairs with A in next round of replication (CG —► TA). • Prokaryote DNA contains small amounts of 5mC; deamination of 5mC produces T (CG TA). • Regions with high levels of 5mC are mutation hot spots. 48 Define footer - presentation title / department MUNI SCI Deamination b) NH, N^4 3 5 N CH, H Methyl group Deamination 5-methylcytosine (5mC) H N3 4 5 2 1.5 N CH, H Thymine (T) 49 Department of Experimental Biology MUNI SCI Induced mutations rimental Biology Mutagens Mutagen - any agent, physical or environmental, that can induce a genetic mutation or can increase the rate of mutation. Mutagens can be physical mutagens, chemical mutagens, or biological mutagens. The ability of a substance to induce the alterations in the base pairs of DNA or mutation is known as mutagenicity. Physical Chemical Heat & Radiation Base analogs I nte rca I at i ng age nts Metal ions Alkylatingagents Viruses Biological ! 5 Bacteria 1 Transposons& Insertion sequ 51 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Mutagens Physical Mutagens, Biological Mutagens Ionizing radiation X-Rays, y-Rays ^ y-Rays Non-ionizing radiation UVRays, Heat \r\r\r ■ Virus Alkylating agents Base Analogues , > Acridinedyes ■ De-aminating Agents Metal Ions (EMS, MMS, nitro gen mustard etc) (5BU, 2-AP, TMU etc) (Acraflavin, acridine orange, ethidium bromide etc.). (some bisulfite etc) (Ni, Cr, Co, Cd, As, etc) Bacteria Transposonsand T-DNA ■ Targeted Genome editing r^TALENS ^CRISPR >ZFN ■ o 52 Department of Experimental Biology Journal of Applied Biology & Biotechnology Vol. 9(04), pp. 162-169, July, 2021 MUNI SCI Physical mutagens • Ionizing radiation - X-ray, gamma, cosmic, causes DNA breaks. • Non-ionizing radiation (UV) - specific absorption at wavelength 260 - 280 nm, formation of thymine dimers. • Heat - the phosphodiester bonds break in DNA when heated above 95°C resulting in breakage of DNA strand. Electromagnetic Radiation Spectrum io» Wavelength (Metres) -I-1-h- 10« 10« 10* 10* 10» lO* 10* 10* 10* 10« lO" 10" 10* 10" H- I I —I-1- I I —t-1-1-1-1-h- Quentum (Photon) Energy (eV) 10* 10» 10* 10'« 10" -I-1-1-1-r— I t R».dioWov»s H-1- . UKrowam ;.] Human Boöy He« I Win»*« Radar -1- XRays 103 10* 104 Frequency (H2) 10* 10* 10! 7 í xtC V Gamma Rays CowncRayj • —- -h- 10« 10» 10» 10» 10» 35x10-"M Non-Ionising Radiation > 53 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen IOP Conf. Series: Materials Science and Engineering 374 (2018) 012009 MUNI SCI Ionizing radiation - physical mutagens • Ionizing radiation - X-ray, Gamma and Cosmic radiations. • Shorter wavelengths and greater energy than visible light, which penetrates deep into tissues, crashes into atoms, releases electrons, positively charged radicals and ions are formed, which provoke the formation of other ions (ionization process). • These radiations exert a lethal (i.e., killing the cell) or sub-lethal (i.e., changing the functioning of the cell) effect by directly damaging the DNAorthe nucleotides by: o inducing-cross-linking of DNAor protein, o breaking of chromosomes, o breaking of strands or chromosomal loss, o molecularly deletion of bases/DNA strand breakages. 54 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI UV radiation - physical mutagens • Lower energy than ionizing radiation. • Does not cause ionization. • Penetrates only into the upper layers. • Strong mutagen in unicellular organisms. • The energy of radiation is captured by atoms whose electrons pass to the excited state - increase in the reactivity of atoms and molecules, leading to mutations in DNA. Maximum mutagenic effects at 254 nm (maximum absorption). 55 Department of Experimental Biology https://genesiswatertech.com/blog-post/types-of-ultraviolet-uv-lamps/ MUNI SCI UV radiation - physical mutagens • UV radiations are of three types - UV A, UV B, and UV C. • UV-A is the UV rays with a wavelength of 320nm (near-visible range) and is known to result in dimerization of pyrimidines. This kind of pyrimidine dimerization results in alteration of the DNA structure which averts the formation of the replication fork during the process of replication. Such dimerization may lead to health issues. • UV-B has a wavelength of 290-320nm and highly lethal to DNA. • UV-C radiations have a wavelength of 180-290nm and are the most lethal as well as carcinogenic. UV-C radiations are majorly absorbed by the ozone layer. 56 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI UV radiation - physical mutagens After absorption of UV, Pyrimidines become ^2 very reactive and change themself to A H 1^ / pyrimidine hydrates and then to the dimers. a+H0 N" M 1 > H Pyrimidine dimers results in formation of the I I replication fork and block of replication. „ x . „ ± . u ± Cytosine Cytosine hydrate H ^-c CH3 H3C, I II + S!l^ H H" Thymine ? Thymine UV CH3 CH3 H. H O N H r H I Thymine dimer 57 Define footer - presentation title / department Thymine dimers induced by UV light. J U N I SCI Chemical mutagens • Chemical mutagens influence the structure of DNA: o Oxidizing agents (peroxides, oxygen radicals). o Deaminating substances (nitrites), o Alkylating agents (mustard gas), o Intercalation agents (acridines). o Aromatic amines (benzidine, naphthylamine) damaging the cellular apparatus for even distribution genetic information in cell division, o Colchicine • Chemical mutagens can cause mutations: o Regardless of whether DNA replication takes place (e.g. alkylating agents, nitric acid), o Only during DNA replication (base analogues, acridine dyes). 58 Department of Experimental Biology MUNI SCI Base analogues - chemical mutagens • 5-bromuracil is a thymine analogue - structurally similar to the normal bases. • Capable of non-standard pairing (tautomerism). • Incorporated into DNA during replication. • 5-bromuracil induces transitions in both directions (different charge distribution increases frequency of tautomeric rearrangement - other pairing). 0 |_j H^N/C^c/Br BrO- - -H-r/. B(/°~H"~~ VVS 0 H H R O R O---H-N 5-bromuracil H (5-BU) 5-BrU (keto) Adenine 5-BrU (enol) Guanine 59 Department of Experimental Biology https://pt.wikipedia.org/wiki/5-Bromouracil MUNI SCI Base analogues - chemical mutagens Due to structural similarities these agents with the DNA bases, base analogs get incorporated in the DNA structure during the process of replication. Aminopurine is similar to adenine and can form a base pair with C orT (though base pairing with C is rare). 5-Brornouracil HC \ / N-C 2-Arninopurine h N C hX n ch I -n h a) Base-pairing of 5-bromouracil in its normal state H Br \ ,c—c , c / \\ Attachment XL of base to sugar 5-bromouracil (behaves like thymine; normal state) / H ^ of base to sugar O Attachment Adenine (normal state) b) Base-pairing of 5-bromouracil in its rare state H-c Br \ t \ 0-H..-0 N- w 0- ■H-N \ 5-bromouracil (behaves like cytosine; rare state) Guanine (normal state) 60 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Base analogues - chemical mutagens • Keto form of the 5-bromouracil replaces thymine, whereas enol tautomeric forms a replaces guanine. Upon replication DNA containing 5-Bromouracil changes base pair from A-T to G-C or from a G-C to an A-T. c) Mutagenic action of 58U AT-to-GC transition mutation Add&BU DNA replication GC-to-AT transition mutation _G_ DNA replication 61 Department of Experimental Biology T A 5BU A 5BU shifts to rare states SBU incorporated in normal slate C G DNA replication' 1 5BU returns to normal slate SBU incorporated in rare state DNA replication' SBU A 5BU shifts back to normal state DNA re plica tiorr C G Transition mutation (instead of ATT il is CG) DNA replication^ T A Transition mutation [instead of GC, it is AT) MUNI SCI Base modifyining agents - chemical mutagens Base modifying agents affects DNA that is not replicated: • Intercalating agents • Nitric acid • Hydroxylamine • Sodium bisulfate • Alkylating agents 62 Department of Experimental Biology MUNI SCI DNA intercalating agents - chemical mutagens • DNA Intercalating agents are the molecules that have a hydrophobic heterocyclic ring structure and resemble the ring structure of base pairs. • These agents place themselves in the DNA helix, which eventually interferes with the replication, translation, and transcription resulting in mutation, most commonly frameshift mutation. • Ethidium bromide, proflavine, acridine orange, actinomycin D, or daunorubicin, etc. are some of the common intercalating agents. • Daunorubicin along with Epirubicin and Mitoxantrone are some of the common anti-cancer or antineoplastic drugs. 63 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI DNA intercalating agents - chemical mutagens Ettiidiurn 0 oh o Adripmycin {R = OH) 64 Department of Experimental Biology https://www.hoelzel-biotech.com/en/infothek/nucleic-acid-detection/ |y| |j j https://www.sciencedirect.com/topics/medicine-and-dentistry/intercalating-agent SCI Deaminating agents - chemical mutagens • Deaminatnig agent causes oxidative deamination of adenine, guanine and cytosine. Amino groups are thus converted into keto groups. • Adenine —► hypoxanthine, which is paired with cytosine. • Cytosine —► uracile, which is paired with cytosine. • Guanine —► xanthine, which pairs with cytosine, thus guanine deamination is not mutagenic. 65 Department of Experimental Biology Original base a) 1> h^nv t OR' N---U \-H / n c 2) Guanine^ H h Vh o dR 0 Cytosine n h 3) H \ hv^n\ n-h n Adenine Mutagen Nitrous acid (HN02) -► Nitrous acid (HNO,) -► Nitrous acid (HN02) -► Modified base Pairing partner H / p —h n h •c c —c --{' n-h—n NC-h dR \ I \ / / n — C h o Xanthine \ / C —n O* dR Cytosine h 0-—h-n NdR dR O Uracil Adenine P — h-n h C c —C u // \ // \ n h—n C-h n=< C—n H 0* dR Hypoxanthine Cytosine Predicted transition None CG—►TA AT—>GC MUNI SCI Deaminating agents - chemical mutagens • Bisulfide has the same effect as nitric acid, deamination of cytosine to uracil, GC —► AT. • 5mC can not be deaminated. 5' Genomic DNA ■c G C G m G-G treatment with bisulfite u I U-C ■U Sulfon&tion OH 3 deamlfiation HSQf ' 0H- 0 _ Alküli 3 desulfonation Cytosine sulfonate Uracil sulfonate B Uracil Original sequence Sequence after bisulfite treatment Unmethylated DNA Methylated DNA A-T-C-G-G-T-C-A-T-C-G-C-A-T A-T-U -G-G-T-U - A-T-U-G-U -AT A-T-C-G-G-T-C-A-T-C-G-C- A-T A-T-C-G -G-T-U-A-T -C-G -U-A-T PCR (1st cycle) I m 5' -u — u — c — u ---A - -A- - G-**~A I PCR (amplification) I ■T+--T----C A "-- A----G- t- A sequencing + bisulfite C C T 1— Ť O c g - £- conv 66 Department of Experimental Biology June 2005Biochemistry (Moscow) 70(5):596-603 Clinical Chemistry, 2009, 55(8), 1471-83. Hydroxylating agents - chemical mutagens • Hydroxylation of an amino group of cytosine. • Hydroxyl-amino-cytosine forms pair with adenine. • Transition CG —► TA. Original base h Vh dR 0 Cytosine Mutagen Hydroxylamine (NHjOH) Modified base Pairing partner h-os » H N-—H-N Z*1"^" dR o H Hydroxylaminocytosine Adenine Predicted transition CG—*-TA 67 Department of Experimental Biology MUNI SCI Alkylating agents - chemical mutagens Alkylating agents induce alkyl groups (methyl, ethyl) in DNA resulting in altered pairing abilities or create inter-strands cross-links. The introduction of the alkyl groups increases ionization that results in base-pairing errors and eventually inducing gaps in the DNA strand. Some of the common alkylating agents are ethylnitrosourea, mustard gas, vinyl chloride, Methylhydrazine, Busulfan, Carmustine, lomustine, Dimethyl sulfate, Temozolomide, Dacarbazine, Ethyl ethane sulfate, and Thio-TEPA. Induces all types of mutations (transitions, transversions, frameshift mutations and chromosomal aberrations). CH3-CH2—0-S02—CH3 CI-CH2-CH2-S-CH2-CH2-CI Ethylmethansulfonate Di-(2-chlorylethyl) sulfide MuStard 935 MUNI 68 Department of Experimental Biology _ _ T O 0 J. Alkylating agents - chemical mutagens • By alkylation of guanine mustard gas causes changes that block replication and cell division (consideration of use in the treatment of cancer). • Though during the DNA repairing process, alkylated bases can be removed from the DNA by the depurination process. Depurination is a non-mutagenic process. Original base Mutagen Modified base Pairing partner Predicted transition c) N=c\ N-H / Methylmethane sulfonate (MMS) (alkylating agent) -*■ Hy^-\ /0_cm' °n\ ,ch3 I >-< /c"\ „R'^^-\ iN—H-N C-H N-H.....0 dR / H 06-Methylguanine Thymine GC—*AT H Guanine 69 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen Biological mutagens • Viruses - can insert its viral DNA into the genome. • Certain viruses, e.g. Rous sarcoma virus, hepatitis B virus, HIV, Epstein-Barr virus, directly influence the genetic material in cells, changing the functioning of genes and triggering cancers. Thus, it can be said, that viruses can be mutagenic. • Bacteria - certain inflammation-inducing bacteria like Helicobacter pylori produces reactive oxygen species that results in DNA damage and reduced DNA repair. This raises the likelihood of the mutation. 70 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Biological mutagens • Transposons and Insertion sequences (IS) - are units of DNA that undertake self-directed relocation/multiplication of the DNA fragment. • Both IS and transposon are also known as jumping genes as they move from throughout the DNA. • The addition of transposons into chromosomal DNA interrupts the functionality of the genes. • Three types of transposons are usually found: o Replicative transposons - transposons that retain the original locus and translocate its copy, o Conservative transposons - the original transposon translocates itself, o Retrotransposons transpose - translocate via RNA intermediates. 71 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Ames test •American bacteriologist. • In the late 60s, he is studying mutations in Salmonella at Berkeley . • He observed that mutations in certain genes prevent the growth of bacteria on a Petri dish. • In this strain there may be another mutation that allows the ability to restore the grow - a bacterial colony is formed on the dish. • The more colonies, the greater the mutagenic capacity of the substance used, It can be quantified. Bruce Ames The reversal rate reflects the strength of the mutagen. 72 Department of Experimental Biology https://gairdner.org/award_winners/bruce-n-ames/ MUNI SCI Ames test Ames Test is an inexpensive method used to screen possible carcinogens and mutagens. Histidine auxotroph Salmonella typhimurium (requires Histidine to grow) are mixed with rat liver enzymes and plated on media lacking histidine. Liver enzymes are required to detect mutagens that are converted to carcinogenic forms by the liver (e.g., procarcinogens). Test chemical is then added to medium. Control plates show only a small of revertants (bacteria cells growing without histidine). Plates inoculated with mutagens or procarcinogens show a larger of revertants. Auxotroph will not grow without Histidine unless a mutation has occurred. MUNI 73 Department of Experimental Biology https://slidetodoc.com/chapter-7-a-dna-mutation-and-repair-mutation/ O 0 J. Arnes test Negative result 74 Department of Experimental Biology https://slidetodoc.com/chapter-7-a-dna-mutation-and-repair-mutation/ MUNI SCI THANK YOU FOR YOUR ATTENTION The Paramecium Parlor _ 75 Department of Experimental Biology Sharing mutation stories was a DNA camping tradition. https://cz.pinterest.com/pin/515451119831203910/ MUNI SCI