MUNI SCI Bi4025en Molecular Biology Mgr. Jiří Kohoutek, Ph.D. 1 Department of Experimental Biology Lecture 8 • Molecular mechanisms of mutagenesis and recombination. 2 Department of Experimental Biology Source of genetic variability • Mutations • Recombination • Transposition 3 Department of Experimental Biology MUNI SCI Mutations TABIE 14.1 Major types of mutations and their distinguishing features Basis of classification Major types of mutations Major features Origin Spontaneous Induced Occurs in absence of known mutagen Occurs in presence of known mutagen Cell type Somatic Germ-line Occurs in nonreproductivc cells Occurs in reproductive cells Expression Condrtional Unconditional Expressed only under restrictive conditions (such as high temperature) Expressed under permissive conditions as well as restrictive conditions Effect on function Loss-of-function (knockout null) Hypomorphic (leaky) Hyperm orphic Gain-ofn (ectopic expression) Eliminates normal function Reduces normal function Increases normal function Expressed at incorrect time or in inappropriate cell types Molecular change Nucleotide substitution Transition Transversion Insertion Deletion One base pair in duplex DNA replaced with a different base pair Pyrimidine (T or C) to pyrimidine, or purine (A or C) to purine Pyrimidine (T or C) to punne, or purine (A or C) to pyrimidine One or more extra nucleotides present One o' inoic m ssins nucleotides Effect on translation Synonymous (silent) Mtssense (nonsynonymous) Nonsense (termination) Frameshift No change in amino acid encoded Change in amino acid encoded Creates translational termination codon (UAA. UAG. or UGA) Shifts triplet reading of codons out of correct phase 4 Define footer - presentation title / department https://www.uky.edu/~tphillip/2FChapter14.ppt MUNI SCI Mutations • Mutation is an inherited change in the genetic material of an organism. • Consequence of replication failure or accidental DNA damage. • Mostly without significant effect. • Sometimes fatal. • Sometimes mutations bring an advantage (e.g. resistance of bacteria to antibiotics). • Increase diversity among individuals of a given species. 5 Department of Experimental Biology MUNI SCI Mutations • Mutations occur randomly. • More likely to cause harm than good. • Responsible for thousands of human diseases, including cancer. • The survival of the cell/organism depends on minimizing changes in DNA. 6 Department of Experimental Biology MUNI SCI Mutations • Change in the primary structure of the nucleic acid: o at the gene level (base pair substitutions, insertions, deletions), o at the level of structure or number of chromosomes. • Genotype can also be changed by new combinations of existing genetic variants - alleles, recombination. • The basis of evolution, adaptation to the environment. • Use in research (identification of genes, research of their function, regulation of expression, etc.) 7 Department of Experimental Biology MUNI SCI Polymorphism •A state where there are at least two genetic variants (alleles). Eventually, the occurrence of different forms among the members of a population or colony. •We talk about a mutation if the percentage of the allele in a population less than 1%. •Changes in gene expression that are phenotypically manifested, and which are not the result of changes in the DNA nucleotide sequence are referred to as epigenetic. 8 Department of Experimental Biology MUNI SCI Standard x Mutant phenotype Standard allele - standard phenotype. Mutant allele - mutant phenotype (mostly recessive). • > If 3! TI ( • Wild type tigers have orange fur and black stripes. One mutation prevents the deposition of the orange/brown pigment, and the result is a "white tiger" that still has dark stripes. A different mutation prevents any melanin (brown pigment) from forming at all, and the result is an albino tiger. MUNI SCI 9 Department of Experimental Biology http://www.bio.miami.edu/dana/dox/wildtype.html What does mutation affect? • The sequence of the genes, and thus structure of their products or regulatory areas in DNA. • Chromosome structure (chromosome aberrations: duplication, deletion, inversion, translocation). • Genome structure: • Aneuploidv - change in the number of certain chromosomes. • Euploidv - change in the number of chromosomal sets. 10 Department of Experimental Biology MUNI SCI Classification of Mutations • Direction of mutations: • Forward mutation - mutation changes wild type (ancestral) to mutant (derived). • „Reverse" mutation - mutation changes mutant (derived) to wild type (ancestral). o Reversion to the wild type amino acid restores function. o Reversion to another amino acid partly or fully restores function. • Suppressor mutation - partially or completely cancels out the effect of another so-called suppressor-sensitive mutation. o Intragenic suppressors occur on the same codon; e.g., nearby addition restores a deletion, o Intergenic suppressors occur on a different gene. 11 Department of Experimental Biology MUNI SCI Intragenic suppressor mutations - type I Intragenic suppressor mutation suppresses suppressor-sensitive mutation at the same gene level (intragen). suppressor-sensitive mutation ATC CTC CCT TTC Insertion of T ATC TCT CCC TTT C frameshift mutation (reading frame shift) 12 Department of Experimental Biology suppressor mutation i ATC TCT CCC TTT C I Deletion of C ATC TCT CCT TTC restoration of the original reading frame MUNI SCI Intragenic suppressor mutations - type II Serine TCA • Original codon. | • Suppressor-sensitive (first) mutation. TAA • Stop codon, loss of product function. | • Suppressor-sensitive (second) mutation. Tyrosine TAT • Codon for another amino acid, restoration of function (sometimes only partial). 13 Department of Experimental Biology MUNI SCI Classification of Mutations By type of affected cell: Somatic mutation Arise in the somatic cells. Passed on to other cells through the process of mitosis. Effect of these mutations depends on the type of the cell in which they occur & the developmental stage of the organism. In single-celled organisms, each mutation is duplicated during replication and passed on to the next cell generation. In multicellular mutations are passed on to the offspring only if they appear in the genome of germ line cells. • Germline mutation • They occur in the cells that produce gametes. • Can provoke hereditary diseases. • Passed on to future generations. • In multicellular organisms, the term mutation is generally used for germ line mutations. Department of Experimental Biology MUNI SCI Classification of Mutations • According to the level at which it acts: • Gene (point) - change of bases or sequence of bases at the gene level. • Chromosome - change of sequence at the chromosome level. • Genome - genomic mutations - change in the number of chromosomes. 15 Department of Experimental Biology MUNI SCI Classification of Mutations • According to the effect on the viability of the organism: • Vital mutations - compatible with survival. • Lethal mutations - incompatible with survival. • Conditionally lethal mutation - compatible with survival under certain conditions o ts ("temperature-sensitive") - lethal at elevated temperature. o sus ("suppressor-sensitive") - lethal without the presence of a suppressor. 16 Department of Experimental Biology MUNI SCI Temperature sensitive mutation A conditional mutation that produces the mutant phenotype in one (restrictive or non-permissive) temperature range and the wild-type phenotype in another (permissive) temperature range. Restrictive temperature: protein not functional osxn Temperature-sensitive mutant subunit •J Wild subunlfs High temperature Misfolded interfaces block or destabilize assemblies ^ £ 20 seconds ^ Permissive " ) temperature: protein functional 17 Department of Experimental Biology A conditional mutation that produces the mutant protein folds correctly only at a lower permissive, temperature. At non-permissive temperature, the mutant protein is inoperative. Useful for experimentation (lethal mutations are difficult to study). MUNI SCI Bioessays 36: 836-846, DOI 10.1002/bies.201400062 Methods in Cell Biology, Volume 137, 2017, Pages 283-306. Classification of Mutations According to the degree of phenotypic manifestation (in diploid organisms): Dominant mutations - they manifest themselves even in heterozygous state. Recessive mutations - they manifest themselves only in a homozygous state, in a heterozygous state, the manifestation is masked by the dominant allele. Dominant and Recessive mutations Recessive Dominant Genotype \ Phenotype ■j 18 Department of Experimental Biology MUNI SCI Diploid character of genome protects against adverse effect of mutations • Diploid cell contains two complete sets of chromosomes, one from each parent. • In diploid organisms, mammals, each gene has 2 copies. • If one of them is damaged, the other can substitute the other one by providing the correct information. • Therefore diploid state prevents defect caused by mutations, only, if the mutation is not dominant. 19 Department of Experimental Biology MUNI SCI Point mutations - molecular change • 1. Base pair substitutions • Transitions o Convert a purine-purine to the other pyrimidine-pyrimidine. o 4 types of transitions; A <-> G and T <-> C o Most transitions results in synonymous substitution because of the degeneracy of the genetic code. • Transversions o Convert a purine-pyrimidine to a pyrimidine-purine. o 8 types of transversions; A <-> T, A <-> C, G <-> T & G <-> C. o Transversions are more likely to result in nonsynonymous substitution. 2. Base pair substitution, deletions and insertions 20 Department of Experimental Biology MUNI SCI Point mutations molecular change Cytosine Guanine Although there are twice as many possible transversions, because of the molecular mechanisms by which they are generated, transition mutations are generated at higher frequency than transversions. As well, transitions are less likely to result in amino acid substitutions (due to "wobble"), and are therefore more likely to persist as "silent substitutions" in populations as single nucleotide polymorphisms (SNPs). 21 Department of Experimental Biology https://www.mun.ca/biology/scarr/Transitions_vs_Transversions.html MUNI SCI Point mutations molecular change Insertion Insertions are mutations in which extra base pairs are inserted into a new place in the DNA. Insertion CTGGAG «—« CTGGTGGAG Deletions Deletions are mutations in which a section of DNA is lost, or deleted. Deletion C T G (a A G I C T A G 22 Department of Experimental Biology https://evolution.berkeley.edu/dna-and-mutations/types-of-mutations/ MUNI SCI Substitution point mutations Effect of translation Substitution mutations change base pairs of a nucleotide sequence with different base pairs. The substitution may or may not give effects depending on the type of mutation. Silent mutation, missense mutation and nonsense mutation are three types of substitution mutations. No mutation DMA level TTC mRNAIevel AAG protein level LyS Silent Point mutations I Nonsense ATC UAG STOP Missense conservative r»n-conservati¥e T C AGG Arg I ■V T TGC AGG Thr Cast I 23 Department of Experimental Biology https://www.differencebetweenxom/difference-between-substitution-insertion-and-deletion-mutations/ MUNI SCI Substitution and point mutations Missense mutation Base pair substitution results in substitution of a different amino acid. Nonsense mutation Base pair substitution results in a stop codon (and shorter polypeptide). Neutral mutation Base pair substitution results in substitution of an amino acid with similar chemical properties (protein function is not altered). Silent mutation Base pair substitution results in the same amino acid. Frameshift mutations Deletions or insertions (not divided by 3) result in translation of incorrect amino acids, stops codons (shorter polypeptides), or read-through of stop codons (longer polypeptides). MUNI Department of Experimental Biology r> r» t Substitution and point mutations • Missense mutation • Base pair substitution results in substitution of a different amino acid. 5' TCTCAA AATTTACG 3' 3' AGAGTT TTAAATGC 5' ■•• Ser Gin Lys Phe Thr ••• 5' TCTCAA AATTTACG 3' 3' AGAGTT TTAAATGC 5' ••• Ser Gin Phe Thr ••• • Nonsense mutation • Base pair substitution results in a stop codon (and shorter polypeptide). 5' TCTCAA AATTTACG 3' 3' AGAGTT TTAAATGC 5' 5' TCTCAA AATTTACG 3' 3' AGAGTT TTAAATGC 5' ••• Ser Gin Lys Phe Thr ••• ■•• Ser Gin 25 Department of Experimental Biology MUNI SCI Substitution and point mutations • Neutral mutation • Base pair substitution results in substitution of an amino acid with similar chemical properties (protein function is not altered). 5' TCTCAAA ATT TACG 3' 5' TCTCAAA ATTTACG 3' 3' AGAGTTT TAAATGC 5' 3' AGAGTTT TAAATGC 5' •-- Scr Gin Lys Phc Thr ••• •■• Ser Gin HTTU Phe Thr ••• • Silent mutation • Base pair substitution results in the same amino acid 5' TCTCAAAAflTTTACG 3' 3' AGAGT T TTilAAATGC 5' ••• Ser Gin Lyt Phe Thr — 5' 3 TCTCAAAA AGAGT J J J. TTTACG AAATGC 3' 5' — Ser Gin Ly« Phe Thr ••• 26 Department of Experimental Biology MUNI SCI Substitution and point mutations • Frameshift mutations • Deletions or insertions (not divided by 3) result in translation of incorrect amino acids, stops codons (shorter polypeptides), or read-through of stop codons (longer polypeptides). 5' TCTCAAAAATTTACG 3' 3' AGAGTTTTTAAATGC 5' ••• Ser Gin Lyt Phe Thr ••• 5' 3' TCTCAA AGAG T T AAATTTACG 3' TTTAAATGC 5' ••• Ser Gin Glu I II« I Tyr 27 Department of Experimental Biology MUNI SCI Additional type of Mutations • null mutation - complete loss of function o often deletion of the gene or part of it. • tight mutation - clear phenotypic expression o e.g. complete loss of ability to grow under certain conditions or preventing the formation of a product of a given biochemical pathway. • leaky mutation - partial activity of the gene product preserved o e.g. residual activity of the enzyme will allow cells to survive. • frameshift mutation - changes the reading frame, o usually deletions or insertions. • polar mutation - affects the expression of neighboring genes, o In operons. 28 Department of Experimental Biology MUNI SCI Mutation and structural abberations B E D C F A B C D D E F inversion Duplication A B C D E F Deletion A B D E Insertion CD L E F Translocation A B C D E F A B C o p q I m n o p q I m n D E F • Breakage of a chromosome can produce variety of arrangements. • Chromosomal structural changes usually occur during meiosis , formation of egg or sperm cells, in early fetal development, or in any cell after birth. • Pieces of DNA can be rearranged within one chromosome or transferred between two or more chromosomes. • Some changes cause health problems, while others may have no effect on a person's health. Department of Experimental Biology https://biologyboom.com/change-in-chromosome-structure/ https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations Inversion An inversion occurs when a chromosome breaks in two places; the resulting piece of DNA is reversed and re-inserted into the chromosome. Genetic material may or may not be lost as a result of the chromosome breaks. An inversion that includes o the chromosome's constriction point (centromere) is called a pericentric inversion, o the long (q) arm or short (p) arm and does not involve the centromere is called a paracentric inversion. Define footer - presentation title / department https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ Mutation and structural abberations Duplications Duplication Duplications occur when part of a chromosome is abnormally copied (duplicated). This type of chromosomal change results in extra copies of genetic material from the duplicated segment. Chromosome >Duplicated Genetic Material tional Library of Medicine 31 Department of Experimental Biology https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations Deletions Deletions occur when a chromosome breaks and some genetic material is lost. Deletions can be large or small, and can occur anywhere along a chromosome. Deletion ational Breaks in Chromosome 32 Department of Experimental Biology https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations Translocations • A translocation occurs when a piece of one chromosome breaks off and attaches to another chromosome. This type of rearrangement is described as balanced if no genetic material is gained or lost in the cell. 33 Department of Experimental Biology Chromosome B Chromosome A US National Library of Medicine https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Mutation and structural abberations • Translocations • A translocation occurs when a piece of one chromosome breaks off and attaches to another chromosome. • If there is a gain or loss of genetic material, the translocation is described as unbalanced. 34 Department of Experimental Biology Unbalanced Translocation https://medlineplus.gov/genetics/understanding/mutationsanddisorders/structuralchanges/ MUNI SCI Are mutatins good or bad? It depends. Mostly harmful with a negative effect on the function of the gene product. The damaged gene product may not always be a protein, but also RNA (tRNA, rRNA, atd.). Mutations can also damage non-coding but important signal sequences. Most mutations do not have a significant effect on the survival of the organism - they are neutral. Rarely, the mutation has a positive effect on the survival and reproduction of the organism. The accumulation of these beneficial mutations will allow the organism to develop into a changing with the environment. MUNI Department of Experimental Biology https://open.lib.umn.edu/evolutionbiology/chapter/5-8-using-the-genetic-code-2/ O 0 J. Classification of Mutations • According to the method of formation: Spontaneous - occur in the absence of known mutagen, without apparent external cause. • Consequence of metabolic disorders in the body. • Consequence of DNA replication errors. • Consequence of the presence of an unknown mutagenic substance in the environment. Induced - occur in the presence of known mutagen Physical. ^ • Chemical. I MUTAGENS • Biological factors. J MUNI 36 Department of Experimental Biology r> r» t • Spontaneous mutations MUNI 37 Department of Experimental Biology _ _ T O 0 J. Base pairing- tautomerization (.i) Stnníf.iťd bast-pairing arrangements H—C I H— H- O N^ / •MP* 0---U—N \ H Thymine (keto) Adenine (ammo) cytoslno (amino) [li) Anomalous base-pairing arrangements p—H—■ Guanine (keto) CH3 H—C ti—c 4 -J \ Standard base-pairing arrangements of the canonical nucleotide isomers. Anomalous base-pairing arrangements of the tautomers. Natural cause of certain genome instability. Base transitions to different forms change their pairing specificity. When tautomerization occurs during replication, the DNA sequence will be "misread", and anomalous base-pairing will occur: such as C* with A, or T*. 38 Department of Experimental Biology https://www.researchgate.net/publication/334974633_Unified_Physics_and_the_Entang lement Nexus of Awareness MUNI SCI Mutation caused by mismatch wobbl base pairing a) b) c) d) Guanine Mismatched GT GC-to-AT transition wobble pairs base pair after mutation produced with T replication after next DNA replication 5'_3' DNA ACGTC replication TGCAG 3'-5' Parental DNA 39 Department of Experimental Biology ACGTC TGTAG DNA replication ACGTC TGCAG First-generation progeny ACGTC TGCAG AC ATC TGTAG ACGTC TGCAG Wild type Mutant Wild type ACGTC TGCAG Wlldtype Seco nd-generation progeny MUNI SCI Insertion and deletion by DNA looping-out New strand 5 i i i i i i i li AGTCG CATAGTT TCAGCGTATCAAAAACGTCGATC Template strand 3f----1 I I I I I I I I I—I I I I I I I '----5' 5' 3 I I I I I I I I I AGTCGCATAGTT TCAGCGTATCAA AACGTCGATC a—- -4$r—m- Looping out of template strand 5' 3 One base deletion on now strand I I I I I I I........'I I I I I I I I I AGTCGCATAGTT TTGCAG CTAG TCAGCGTATCAA AACGTCGATC I I I I I I I I I I I IAl 3' 5' 3' Looping out of new strand 3' AGTCGCATAGTTTT TCAGCGTATCAA AAACGTCGATC 5' One base insertion on now strand 'Mill llrTl I I I I I I I I I AGTCGCATAGTT TTTGCAGCTAG TCAGCGTATCAAAAACGTCGATC / ■3' 5' 40 Department of Experimental Biology MUNI SCI Hot spots in repetitions of DNA 120 H E 100 O ro BO 5 E 60 0 QJ a 40 E D Z 20 0 B 2000 0) 1800 = D 1600 is 1400 £ 1200 0 1000 i_ fib 800 iqui 600 =f Z 400 200 Germiine mutations EI3E> \jSĚ> .kJ.iLl l\ .i... 1] 2 li.. i J,., 1J, <Í5ÍL | Acridinedyes De-aminating Agents Metal Ions (EMS, MMS, nitro gen mustard etc) (5BU, 2-AP, TMU etc) (Acraflavin, acridine orange, ethidium bromide etc). (some bisulfite etc) (Ni, Cr, Co, Cd, As, etc) Bacteria Transposonsand T-DNA ■ Targeted Genome editing r^TALENS ^"CRISPR ZFN 47 Department of Experimental Biology Journal of Applied Biology & Biotechnology Vol. 9(04), pp. 162-169, July, 2021 MUNI SCI Physical mutagens • Ionizing radiation - X-ray, gamma, cosmic, causes DNA breaks. • Non-ionizing radiation (UV) - specific absorption at wavelength 260 - 280 nm, formation of thymine dimers. • Heat - the phosphodiester bonds break in DNA when heated above 95°C resulting in breakage of DNA strand. Electromagnetic Radiation Spectrum 10» io» 10? Wavelength (Metres) -I-1-h- io« io< io* io* 10» 10» io* io* io* io« 10« 10" 10* 10" +——I- 1 1 —\-1- I I —r--1-1-1-h Quentum (Photon) Energy (eV) 10* 10» 10» 10'« 10" —I-1-1-1-1— I + Radio Wovts H-1- Human Body Hert Uciowawn Radar -1- 105 10* 10* Frequency (H2) 10* 10* 10' 75x10-"M 10« 10" 10" 10" 10" '35x10-"M Non-lonismo Radiation > 48 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen IOP Conf. Series: Materials Science and Engineering 374 (2018) 012009 MUNI SCI Ionizing radiation - physical mutagens • Ionizing radiation - X-ray, Gamma and Cosmic radiations. • Shorter wavelengths and greater energy than visible light, which penetrates deep into tissues, crashes into atoms, releases electrons, positively charged radicals and ions are formed, which provoke the formation of other ions (ionization process). • These radiations exert a lethal (i.e., killing the cell) or sub-lethal (i.e., changing the functioning of the cell) effect by directly damaging the DNAorthe nucleotides by: o inducing-cross-linking of DNAor protein, o breaking of chromosomes, o breaking of strands or chromosomal loss, o molecularly deletion of bases/DNA strand breakages. 49 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI UV radiation - physical mutagens • Lower energy than ionizing radiation. • Does not cause ionization. • Penetrates only into the upper layers. • Strong mutagen in unicellular organisms. • The energy of radiation is captured by atoms whose electrons pass to the excited state - increase in the reactivity of atoms and molecules, leading to mutations in DNA. Maximum mutagenic effects at 254 nm (maximum absorption). 50 Department of Experimental Biology https://genesiswatertech.com/blog-post/types-of-ultraviolet-uv-lamps/ MUNI SCI UV radiation - physical mutagens • UV radiations are of three types - UV A, UV B, and UV C. • UV-A is the UV rays with a wavelength of 320nm (near-visible range) and is known to result in dimerization of pyrimidines. This kind of pyrimidine dimerization results in alteration of the DNA structure which averts the formation of the replication fork during the process of replication. Such dimerization may lead to health issues. • UV-B has a wavelength of 290-320nm and highly lethal to DNA. • UV-C radiations have a wavelength of 180-290nm and are the most lethal as well as carcinogenic. UV-C radiations are mainly absorbed by the ozone layer. 51 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI UV radiation - physical mutagens After absorption of UV, Pyrimidines become nh2 very reactive and change themself to A H 1^ / pyrimidine hydrates and then to the dimers. a+H0 N" M 1 > H Pyrimidine dimers results in formation of the I I replication fork and block of replication. „ x . „ ± . u ± Cytosine Cytosine hydrate H o ii O N ^ I Thymine CH3 H3C^ + h h" 52 Define footer - presentation title / department ? Thymine UV O I ch3 ch3 N 3 .A- N 5 V h c5 * 3"h H h Thymine dimer Thymine dimers induced by UV light. J U N I SCI Chemical mutagens • Chemical mutagens influence the structure of DNA: o Oxidizing agents (peroxides, oxygen radicals). o Deaminating substances (nitrites), o Alkylating agents (mustard gas), o Intercalation agents (acridines). o Aromatic amines (benzidine, naphthylamine) damaging the cellular apparatus for even distribution genetic information in cell division, o Colchicine • Chemical mutagens can cause mutations: o Regardless of whether DNA replication takes place (e.g. alkylating agents, nitric acid), o Only during DNA replication (base analogues, acridine dyes). 53 Department of Experimental Biology MUNI SCI Base analogues - chemical mutagens • 5-bromuracil is a thymine analogue - structurally similar to the normal bases. • Capable of non-standard pairing (tautomerism). • Incorporated into DNA during replication. • 5-bromuracil induces transitions in both directions (different charge distribution increases frequency of tautomeric rearrangement - other pairing). 0 |_j 0 H H R O R O---H-N 5-bromuracil H (5-BU) 5-BrU (keto) Adenine 5-BrU (enol) Guanine 54 Department of Experimental Biology https://pt.wikipedia.org/wiki/5-Bromouracil MUNI SCI Base analogues - chemical mutagens Due to structural similarities these agents with the DNA bases, base analogs get incorporated in the DNA structure during the process of replication. Aminopurine is similar to adenine and can form a base pair with C orT (though base pairing with C is rare). 5-Brornouracil HC NH \ / N-C r/ vo 2-Arninopurine N H H2N "N J- CH I -N H a) Base-pairing of 5-bromouracil in its normal state H Br \ ,c—c , c / \\ Attachment XL of base to sugar 5-bromouracil (behaves like thymine; normal state) / H f \Jl \ 2 a / \ C=ríi Attachment ^ of base to sugar O Adenine (normal state) b) Base-pairing of 5-bromouracil in its rare state H-c Br C \ 0-h...o N- O- \ 5-bromouracil (behaves like cytosine; rare state) Guanine (normal state) 55 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Base analogues - chemical mutagens Keto form of the 5-bromouracil replaces thymine, whereas enol tautomeric forms a replaces guanine. Upon replication DNA containing 5-Bromouracil changes base pair from A-T to G-C or from a G-C to an A-T. c) Mutagenic action of 5BU AT-to-GC transition mutation ^■T^H Add SBU DNA replication GC-to-AT transition mutation C Ci Add 5BU DNA replication Department of Experimental Biology T A 5BU A 5BU incorporated in normal state C G 58 U shifts lo rare states DNA replication 5BU returns to normal state SOU incorporated in rare state DNA replication 5BU shifts back to n firm a I state DNA replication" C G Transition mutation {instead of ATT il is CG) Transition mutation [instead of GC, it is AT) MUNI SCI Base modifying agents - chemical mutagens Base modifying agents affects DNAthat is not replicated: • Intercalating agents • Nitric acid • Hydroxylamine • Sodium bisulfate • Alkylating agents 57 Department of Experimental Biology MUNI SCI DNA intercalating agents - chemical mutagens • DNA Intercalating agents are the molecules that have a hydrophobic heterocyclic ring structure and resemble the ring structure of base pairs. • These agents place themselves in the DNA helix, which eventually interferes with the replication, translation, and transcription resulting in mutation, most commonly frameshift mutation. • Ethidium bromide, proflavine, acridine orange, actinomycin D, or daunorubicin, etc. are some of the common intercalating agents. • Daunorubicin along with Epirubicin and Mitoxantrone are some of the common anti-cancer or antineoplastic drugs. 58 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI DNA intercalating agents - chemical mutagens NHj Proflavine H->N Daunorubicin (R = H) Adripmycin {R = OH) 59 Department of Experimental Biology ethidium bromide (marked red)l intercalates between base pairs https://www.hoelzel-biotech.com/en/infothek/nucleic-acid-detection/ https://www.sciencedirect.com/topics/medicine-and-dentistry/intercalating-agent Deaminating agents - chemical mutagens • Deaminatnig agent causes oxidative deamination of adenine, guanine and cytosine. Amino groups are thus converted into keto groups. • Guanine —► xanthine, which pairs with cytosine, thus guanine deamination is not mutagenic. • Cytosine —► uracil, which is paired with cytosine. • Adenine —► hypoxanthine, which is paired with cytosine. 60 Department of Experimental Biology Original base a) 1) H. dR' f z \ n-h / N C Guanine^ n H 2) h N H Q dR 0 Cytosine 3) N H \ dR n-h 9 \ n Adenine Mutagen Nitrous acid (HN02) -► Nitrous acid (HNO,) -► Nitrous acid (HN02) -► Modified base Pairing partner H / p —h n h •c c —c wN"--7A AT—►GC MUNI SCI Deaminating agents - chemical mutagens • Bisulfide has the same effect as nitric acid, deamination of cytosine to uracil, GC —► AT. • 5mC can not be deaminated. OH HSOj" 5ulfon&tiQn Hydrorytic 3 deamlfiation HSQf ' 0H- Q _ AI kati 3 desulfonation Cvtosine sulfonate Uracil sulfonate Uracil B Original sequence Sequence after bisulfite treatment Unmethylated DNA Methylated DNA A-T-C-6-G-T-C-A-T-C-6-C-A-T A-T-U-G-G-T-U -A-T-U-S-U -A-T A-T-C-G-G-T-C-A-T-C-G-C-A-T A-T-C-G-G-T-U-A-T -C-G -U-A-T ■c G Genomic DNA m -c—c—c- -G-G-G- Ireatment with bisulfite I 5' •u — u- nv ■u- PCR (1st cycle) I m -u — u — c — u — ---A - -A- - G A- I PCR (amplification) I -T+--T----C —-J —" .....A --- A----G--*- A — sequencing + bisulfite C C T Ť O c g - £- conv 61 Department of Experimental Biology June 2005Biochemistry (Moscow) 70(5):596-603 Clinical Chemistry, 2009, 55(8), 1471-83. MUNI SCI Hydroxylating agents - chemical mutagens • Hydroxylation of an amino group of cytosine. • Hydroxyl-amino-cytosine forms pair with adenine. • Transition CG —► TA. Original base H N-H O dR 0 Cytosine Mutagen Hydroxylamine (NH2OH) Modified base Pairing partner H-Os » H N-'»H-N /N,5:VH dR O H Hydroxylaminocytosine Adenine Predicted transition CG—*TA MUNI 62 Department of Experimental Biology r> r» t Alkylating agents - chemical mutagens Alkylating agents induce alkyl groups (methyl, ethyl) in DNA resulting in altered pairing abilities or create inter-strands cross-links. The introduction of the alkyl groups increases ionization that results in base-pairing errors and eventually inducing gaps in the DNA strand. Some of the common alkylating agents are ethylnitrosourea, mustard gas, vinyl chloride, Methylhydrazine, Busulfan, Carmustine, lomustine, Dimethyl sulfate, Temozolomide, Dacarbazine, Ethyl ethane sulfate, and Thio-TEPA. Induces all types of mutations (transitions, transversions, frameshift mutations and chromosomal aberrations). CH3-CH2—0-S02—CH3 CI-CH2-CH2-S-CH2-CH2-CI Ethylmethansulfonate Di-(2-chlorylethyl) sulfide MuStard 935 MUNI 63 Department of Experimental Biology _ _ T O 0 J. Alkylating agents - chemical mutagens • By alkylation of guanine mustard gas causes changes that block replication and cell division (consideration of use in the treatment of cancer). • Though during the DNA repairing process, alkylated bases can be removed from the DNA by the depurination process. Depurination is a non-mutagenic process. Original base Mutagen Modified base Pairing partner Predicted transition c) N=c\ N-H / Methylmethane sulfonate (MMS) (alkylating agent) -*■ „R' ^\ iN—H-N C-H N-H.....0 dR / H 06-Methylguanine Thymine GC—*AT H Guanine 64 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen Biological mutagens • Viruses - can insert its viral DNA into the genome. • Certain viruses, e.g. Rous sarcoma virus, hepatitis B virus, HIV, Epstein-Barr virus, directly influence the genetic material in cells, changing the functioning of genes and triggering cancers. Thus, it can be said, that viruses can be mutagenic. • Bacteria - certain inflammation-inducing bacteria like Helicobacter pylori produces reactive oxygen species that results in DNA damage and reduced DNA repair. This raises the likelihood of the mutation. 65 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Biological mutagens • Transposons and Insertion sequences (IS) - are units of DNA that undertake self-directed relocation/multiplication of the DNA fragment. • Both IS and transposon are also known as jumping genes as they move from throughout the DNA. • The addition of transposons into chromosomal DNA interrupts the functionality of the genes. • Three types of transposons are usually found: o Replicative transposons - transposons that retain the original locus and translocate its copy, o Conservative transposons - the original transposon translocates itself, o Retrotransposons transpose - translocate via RNA intermediates. 66 Department of Experimental Biology https://www.biologyonline.com/dictionary/mutagen MUNI SCI Ames test American bacteriologist. In the late 60s, he is studying mutations in Salmonella at Berkeley . He observed that mutations in certain genes prevent the growth of bacteria on a Petri dish. In this strain there may be another mutation that allows the ability to restore the grow - a bacterial colony is formed on the dish. Bruce Ames More colonies, the greater the mutagenic capacity of the substance used, It can be quantified. The reversal rate reflects the strength of the mutagen. 67 Department of Experimental Biology https://gairdner.org/award_winners/bruce-n-ames/ MUNI SCI Ames test Ames Test is an inexpensive method used to screen possible carcinogens and mutagens. Histidine auxotroph Salmonella typhimurium (requires Histidine to grow) are mixed with rat liver enzymes and plated on media lacking histidine. Liver enzymes are required to detect mutagens that are converted to carcinogenic forms by the liver (e.g., procarcinogens). Test chemical is then added to medium. Control plates show only a small of revertants (bacteria cells growing without Histidine). Plates inoculated with mutagens or procarcinogens show a larger of revertants. Auxotroph will not grow without Histidine unless a mutation has occurred. MUNI 68 Department of Experimental Biology https://slidetodoc.com/chapter-7-a-dna-mutation-and-repair-mutation/ O 0 J. Arnes test Meg a live result 69 Department of Experimental Biology https://slidetodoc.com/chapter-7-a-dna-mutation-and-repair-mutation/ MUNI SCI THANK YOU FOR YOUR ATTENTION The Pqrafnecium Parlor 70 Department of Experimental Biology Sharing mutation stories was □ DNA camping tradition. https://cz.pinterest.com/pin/515451119831203910/ MUNI SCI