SLABÝ, Ondřej, Petra VYCHYTILOVÁ, Marek SVOBODA and Milana ŠACHLOVÁ. Method of diagnosis of colorectal cancer. 2020.
Other formats:   BibTeX LaTeX RIS
Basic information
Original name Method of diagnosis of colorectal cancer
Authors SLABÝ, Ondřej (203 Czech Republic, guarantor, belonging to the institution), Petra VYCHYTILOVÁ (203 Czech Republic, belonging to the institution), Marek SVOBODA (203 Czech Republic, belonging to the institution) and Milana ŠACHLOVÁ (203 Czech Republic).
Edition Number: EP3431609B1, Publisher: European Patent Office, Place of publication: Munchen, Germany, Owner's name: Masarykova univerzita, Masarykův onkologický ústav, 2020.
Other information
Original language English
Type of outcome Patent
Field of Study 30204 Oncology
Country of publisher Germany
Confidentiality degree is not subject to a state or trade secret
WWW odkaz na stránku Evropského patentového úřadu
RIV identification code RIV/00216224:14740/20:00116999
Organization unit Central European Institute of Technology
Keywords in English colorectal;cancer;piRNA;miRNA;biomarker;prognosis;body fluid
Tags rivok
Tags International impact, Reviewed
Changed by Changed by: Ing. Daniela Tršová, Ph.D., učo 242921. Changed: 25/11/2020 08:47.
Abstract
The present invention relates to a method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The biomarker can be combined with other piRNAs or miRNAs. The resulting method uses a body fluid as the input, and therefore is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.
Links
NT13549, research and development projectName: Vytvoření diagnostické sady cirkulujících mikroRNA pro neinvazivní časnou diagnostiku a sledování pacientů s kolorektálním karcinomem
PrintDisplayed: 25/8/2024 18:13