Irradiation potentiates p53 phosphorylation and p53 binding to
the promoter and coding region of the TP53 gene

J 2023

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

LEGARTOVÁ, Soňa, Paolo FAGHERAZZI, Pratik GOSWAMI, Václav BRÁZDA, Gabriela LOCHMANOVÁ et. al.

Basic information

Original name

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

Authors

LEGARTOVÁ, Soňa, Paolo FAGHERAZZI (380 Italy, belonging to the institution), Pratik GOSWAMI (356 India, belonging to the institution), Václav BRÁZDA, Gabriela LOCHMANOVÁ (203 Czech Republic, belonging to the institution), Irena KOUTNÁ and Eva BÁRTOVÁ (guarantor)

Edition

Biochimie, Elsevier, 2023, 0300-9084

Other information

Language

English

Type of outcome

Článek v odborném periodiku

Field of Study

10608 Biochemistry and molecular biology

Country of publisher

France

Confidentiality degree

není předmětem státního či obchodního tajemství

References:

URL

Impact factor

Impact factor: 3.900 in 2022

RIV identification code

RIV/00216224:14740/23:00130443

Organization unit

Central European Institute of Technology

DOI

http://dx.doi.org/10.1016/j.biochi.2022.09.013

UT WoS

000921740700001

Keywords in English

p53; 53BP1; DNA damage; Epigenetics; Mass spectrometry; FLIM-FRET; AFM

Abstract

V originále

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Links

EF18_046/0015974, research and development project

Name: Modernizace České infrastruktury pro integrativní strukturní biologii

GF19-29701L, research and development project

Name: Funkce HDAC1 v T-buněčných lymfomech

Investor: Czech Science Foundation, Partner Agency (Austria)

90127, large research infrastructures

Name: CIISB II

Citovat

LEGARTOVÁ, Soňa, Paolo FAGHERAZZI, Pratik GOSWAMI, Václav BRÁZDA, Gabriela LOCHMANOVÁ, Irena KOUTNÁ and Eva BÁRTOVÁ. Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene. Biochimie. Elsevier, 2023, vol. 204, January, p. 154-168. ISSN 0300-9084. Available from: https://dx.doi.org/10.1016/j.biochi.2022.09.013.

@article{2267237,
   author = {Legartová, Soňa and Fagherazzi, Paolo and Goswami, Pratik and Brázda, Václav and Lochmanová, Gabriela and Koutná, Irena and Bártová, Eva},
   article_number = {January},
   doi = {http://dx.doi.org/10.1016/j.biochi.2022.09.013},
   keywords = {p53; 53BP1; DNA damage; Epigenetics; Mass spectrometry; FLIM-FRET; AFM},
   language = {eng},
   issn = {0300-9084},
   journal = {Biochimie},
   title = {Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene},
   url = {https://doi.org/10.1016/j.biochi.2022.09.013},
   volume = {204},
   year = {2023}
}

TY  - JOUR
ID  - 2267237
AU  - Legartová, Soňa - Fagherazzi, Paolo - Goswami, Pratik - Brázda, Václav - Lochmanová, Gabriela - Koutná, Irena - Bártová, Eva
PY  - 2023
TI  - Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene
JF  - Biochimie
VL  - 204
IS  - January
SP  - 154-168
EP  - 154-168
PB  - Elsevier
SN  - 03009084
KW  - p53
KW  - 53BP1
KW  - DNA damage
KW  - Epigenetics
KW  - Mass spectrometry
KW  - FLIM-FRET
KW  - AFM
UR  - https://doi.org/10.1016/j.biochi.2022.09.013
N2  - An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
ER  -

LEGARTOVÁ, Soňa, Paolo FAGHERAZZI, Pratik GOSWAMI, Václav BRÁZDA, Gabriela LOCHMANOVÁ, Irena KOUTNÁ and Eva BÁRTOVÁ. Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene. \textit{Biochimie}. Elsevier, 2023, vol.~204, January, p.~154-168. ISSN~0300-9084. Available from: https://dx.doi.org/10.1016/j.biochi.2022.09.013.

Detailed Information on Publication Record