Other formats:
BibTeX
LaTeX
RIS
@misc{1696157, author = {Slabý, Ondřej and Vychytilová, Petra and Svoboda, Marek and Šachlová, Milana}, keywords = {colorectal;cancer;piRNA;miRNA;biomarker;prognosis;body fluid}, language = {eng}, title = {Method of diagnosis of colorectal cancer}, url = {https://register.epo.org/espacenet/regviewer?AP=17181646&CY=EP&LG=en&DB=REG}, year = {2020} }
TY - PAT ID - 1696157 AU - Slabý, Ondřej - Vychytilová, Petra - Svoboda, Marek - Šachlová, Milana PY - 2020 TI - Method of diagnosis of colorectal cancer KW - colorectal;cancer;piRNA;miRNA;biomarker;prognosis;body fluid UR - https://register.epo.org/espacenet/regviewer?AP=17181646&CY=EP&LG=en&DB=REG L2 - https://register.epo.org/espacenet/regviewer?AP=17181646&CY=EP&LG=en&DB=REG N2 - The present invention relates to a method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The biomarker can be combined with other piRNAs or miRNAs. The resulting method uses a body fluid as the input, and therefore is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective. ER -
SLABÝ, Ondřej, Petra VYCHYTILOVÁ, Marek SVOBODA and Milana ŠACHLOVÁ. \textit{Method of diagnosis of colorectal cancer}. 2020.
|