Method of diagnosis of colorectal cancer

SLABÝ, Ondřej, Petra VYCHYTILOVÁ, Marek SVOBODA and Milana ŠACHLOVÁ. Method of diagnosis of colorectal cancer. 2020.

Basic information

• Original name: Method of diagnosis of colorectal cancer
• Authors: SLABÝ, Ondřej (203 Czech Republic, guarantor, belonging to the institution), Petra VYCHYTILOVÁ (203 Czech Republic, belonging to the institution), Marek SVOBODA (203 Czech Republic, belonging to the institution) and Milana ŠACHLOVÁ (203 Czech Republic).
• Edition: Number: EP3431609B1, Publisher: European Patent Office, Place of publication: Munchen, Germany, Owner's name: Masarykova univerzita, Masarykův onkologický ústav, 2020.

Other information

• Original language: English
• Type of outcome: Patent
• Field of Study: 30204 Oncology
• Country of publisher: Germany
• Confidentiality degree: is not subject to a state or trade secret
• WWW: odkaz na stránku Evropského patentového úřadu
• RIV identification code: RIV/00216224:14740/20:00116999
• Organization unit: Central European Institute of Technology
• Keywords in English: colorectal;cancer;piRNA;miRNA;biomarker;prognosis;body fluid
• Tags: rivok
• Tags: International impact, Reviewed

Abstract

The present invention relates to a method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The biomarker can be combined with other piRNAs or miRNAs. The resulting method uses a body fluid as the input, and therefore is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.

Links

• NT13549, research and development project: Name: Vytvoření diagnostické sady cirkulujících mikroRNA pro neinvazivní časnou diagnostiku a sledování pacientů s kolorektálním karcinomem