KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK, D. RENCIUK, Martin GAJARSKÝ, Daniel KRAFČÍK, J. PALACKY, K. BEDNAROVA, J. SPONER, J.L. MERGNY a M. VORLICKOVA. G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly. Chemistry - A European Journal. WEINHEIM: Wiley, 2021, roč. 27, č. 47, s. 12115-12125. ISSN 0947-6539. Dostupné z: https://dx.doi.org/10.1002/chem.202100895.
Další formáty:   BibTeX LaTeX RIS
Základní údaje
Originální název G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly
Autoři KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK (203 Česká republika, garant, domácí), D. RENCIUK, Martin GAJARSKÝ (703 Slovensko, domácí), Daniel KRAFČÍK (703 Slovensko, domácí), J. PALACKY, K. BEDNAROVA, J. SPONER, J.L. MERGNY a M. VORLICKOVA.
Vydání Chemistry - A European Journal, WEINHEIM, Wiley, 2021, 0947-6539.
Další údaje
Originální jazyk angličtina
Typ výsledku Článek v odborném periodiku
Obor 10400 1.4 Chemical sciences
Stát vydavatele Německo
Utajení není předmětem státního či obchodního tajemství
WWW URL
Impakt faktor Impact factor: 5.020
Kód RIV RIV/00216224:14740/21:00120225
Organizační jednotka Středoevropský technologický institut
Doi http://dx.doi.org/10.1002/chem.202100895
UT WoS 000674838100001
Klíčová slova anglicky CD spectroscopy; DNA quadruplexes; G-quartets; nucleic acid folding; molecular dynamics calculations; NMR spectroscopy
Štítky rivok
Příznaky Mezinárodní význam, Recenzováno
Změnil Změnila: Mgr. Pavla Foltynová, Ph.D., učo 106624. Změněno: 26. 2. 2022 10:43.
Anotace
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Návaznosti
NV19-08-00450, projekt VaVNázev: Atomárně rozlišená NMR spektroskopie in vivo jako nástroj pro biologické testování terapeuticky významných cílů v genomové ne-kanonické DNA a jejich interakcí s léčivy ve fenotypově diverzifikovaných nádorových buňkách.
Investor: Ministerstvo zdravotnictví ČR, Atomically resolved in vivo NMR spectroscopy as a novel tool for biological testing of therapeutically important genomic non-canonical DNA targets and their interactions with drugs in phenotypically diversified cancer cells.
VytisknoutZobrazeno: 12. 10. 2024 22:50