Další formáty:
BibTeX
LaTeX
RIS
@article{1831041,
author = {Kejnovska, I. and Stadlbauer, P. and Trantírek, Lukáš and Renciuk, D. and Gajarský, Martin and Krafčík, Daniel and Palacky, J. and Bednarova, K. and Sponer, J. and Mergny, J.L. and Vorlickova, M.},
article_location = {WEINHEIM},
article_number = {47},
doi = {http://dx.doi.org/10.1002/chem.202100895},
keywords = {CD spectroscopy; DNA quadruplexes; G-quartets; nucleic acid folding; molecular dynamics calculations; NMR spectroscopy},
language = {eng},
issn = {0947-6539},
journal = {Chemistry - A European Journal},
title = {G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly},
url = {https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895},
volume = {27},
year = {2021}
}
TY - JOUR
ID - 1831041
AU - Kejnovska, I. - Stadlbauer, P. - Trantírek, Lukáš - Renciuk, D. - Gajarský, Martin - Krafčík, Daniel - Palacky, J. - Bednarova, K. - Sponer, J. - Mergny, J.L. - Vorlickova, M.
PY - 2021
TI - G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly
JF - Chemistry - A European Journal
VL - 27
IS - 47
SP - 12115-12125
EP - 12115-12125
PB - Wiley
SN - 09476539
KW - CD spectroscopy
KW - DNA quadruplexes
KW - G-quartets
KW - nucleic acid folding
KW - molecular dynamics calculations
KW - NMR spectroscopy
UR - https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895
N2 - Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
ER -
KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK, D. RENCIUK, Martin GAJARSKÝ, Daniel KRAFČÍK, J. PALACKY, K. BEDNAROVA, J. SPONER, J.L. MERGNY a M. VORLICKOVA. G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly. \textit{Chemistry - A European Journal}. WEINHEIM: Wiley, 2021, roč.~27, č.~47, s.~12115-12125. ISSN~0947-6539. Dostupné z: https://dx.doi.org/10.1002/chem.202100895.
|
