G-Quadruplex Formation by DNA Sequences Deficient in Guanines:
Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

J 2021

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK, D. RENCIUK, Martin GAJARSKÝ et. al.

Základní údaje

Originální název

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Autoři

KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK (203 Česká republika, garant, domácí), D. RENCIUK, Martin GAJARSKÝ (703 Slovensko, domácí), Daniel KRAFČÍK (703 Slovensko, domácí), J. PALACKY, K. BEDNAROVA, J. SPONER, J.L. MERGNY a M. VORLICKOVA

Vydání

Chemistry - A European Journal, WEINHEIM, Wiley, 2021, 0947-6539

Další údaje

Jazyk

angličtina

Typ výsledku

Článek v odborném periodiku

Obor

10400 1.4 Chemical sciences

Stát vydavatele

Německo

Utajení

není předmětem státního či obchodního tajemství

Odkazy

URL

Impakt faktor

Impact factor: 5.020

Kód RIV

RIV/00216224:14740/21:00120225

Organizační jednotka

Středoevropský technologický institut

DOI

http://dx.doi.org/10.1002/chem.202100895

UT WoS

000674838100001

Klíčová slova anglicky

CD spectroscopy; DNA quadruplexes; G-quartets; nucleic acid folding; molecular dynamics calculations; NMR spectroscopy

Štítky

rivok

Příznaky

Mezinárodní význam, Recenzováno

Změněno: 26. 2. 2022 10:43, Mgr. Pavla Foltynová, Ph.D.

Anotace

V originále

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Návaznosti

NV19-08-00450, projekt VaV

Název: Atomárně rozlišená NMR spektroskopie in vivo jako nástroj pro biologické testování terapeuticky významných cílů v genomové ne-kanonické DNA a jejich interakcí s léčivy ve fenotypově diverzifikovaných nádorových buňkách.

Investor: Ministerstvo zdravotnictví ČR, Atomically resolved in vivo NMR spectroscopy as a novel tool for biological testing of therapeutically important genomic non-canonical DNA targets and their interactions with drugs in phenotypically diversified cancer cells.

Citovat

KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK, D. RENCIUK, Martin GAJARSKÝ, Daniel KRAFČÍK, J. PALACKY, K. BEDNAROVA, J. SPONER, J.L. MERGNY a M. VORLICKOVA. G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly. Chemistry - A European Journal. WEINHEIM: Wiley, 2021, roč. 27, č. 47, s. 12115-12125. ISSN 0947-6539. Dostupné z: https://dx.doi.org/10.1002/chem.202100895.

@article{1831041,
   author = {Kejnovska, I. and Stadlbauer, P. and Trantírek, Lukáš and Renciuk, D. and Gajarský, Martin and Krafčík, Daniel and Palacky, J. and Bednarova, K. and Sponer, J. and Mergny, J.L. and Vorlickova, M.},
   article_location = {WEINHEIM},
   article_number = {47},
   doi = {http://dx.doi.org/10.1002/chem.202100895},
   keywords = {CD spectroscopy; DNA quadruplexes; G-quartets; nucleic acid folding; molecular dynamics calculations; NMR spectroscopy},
   language = {eng},
   issn = {0947-6539},
   journal = {Chemistry - A European Journal},
   title = {G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly},
   url = {https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895},
   volume = {27},
   year = {2021}
}

TY  - JOUR
ID  - 1831041
AU  - Kejnovska, I. - Stadlbauer, P. - Trantírek, Lukáš - Renciuk, D. - Gajarský, Martin - Krafčík, Daniel - Palacky, J. - Bednarova, K. - Sponer, J. - Mergny, J.L. - Vorlickova, M.
PY  - 2021
TI  - G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly
JF  - Chemistry - A European Journal
VL  - 27
IS  - 47
SP  - 12115-12125
EP  - 12115-12125
PB  - Wiley
SN  - 09476539
KW  - CD spectroscopy
KW  - DNA quadruplexes
KW  - G-quartets
KW  - nucleic acid folding
KW  - molecular dynamics calculations
KW  - NMR spectroscopy
UR  - https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895
N2  - Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
ER  -

KEJNOVSKA, I., P. STADLBAUER, Lukáš TRANTÍREK, D. RENCIUK, Martin GAJARSKÝ, Daniel KRAFČÍK, J. PALACKY, K. BEDNAROVA, J. SPONER, J.L. MERGNY a M. VORLICKOVA. G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly. \textit{Chemistry - A European Journal}. WEINHEIM: Wiley, 2021, roč.~27, č.~47, s.~12115-12125. ISSN~0947-6539. Dostupné z: https://dx.doi.org/10.1002/chem.202100895.

Podrobný výpis o publikaci